Last 7 days
Bookmark and Share    
Full Text
See detailParameter Identification Methods in a Model of the Cardiovascular System
Pironet, Antoine ULg; Desaive, Thomas ULg; Dauby, Pierre ULg et al

Poster (2015, September 01)

To be clinically relevant, mathematical models have to be patient-specific, meaning that their parameters have to be identified from patient data. To achieve real time monitoring, it is important to ... [more ▼]

To be clinically relevant, mathematical models have to be patient-specific, meaning that their parameters have to be identified from patient data. To achieve real time monitoring, it is important to select the best parameter identification method, in terms of speed, efficiency and reliability. This work presents a comparison of seven parameter identification methods applied to a lumped-parameter cardiovascular system model. The seven methods are tested using in silico and experimental reference data. To do so, precise formulae for initial parameter values first had to be developed. The test results indicate that the trust-region reflective method seems to be the best method for the present model. This method (and the proportional method) are able to perform parameter identification in two to three minutes, and will thus benefit cardiac and vascular monitoring applications. [less ▲]

Detailed reference viewed: 47 (4 ULg)
Full Text
See detailRare recombination events and occurrence of superinfection exclusion during synchronous and asynchronous infection with homologous murine norovirus strains
Elisabetta, Di Felice; Ludwig, Louisa ULg; Toffoli, Barbara et al

Poster (2015, September 01)

Objective: Human noroviruses (HuNoVs) are recognised as one of the major global causes of non-bacterial gastroenteritis with significant morbidity and mortality in developing countries and a high economic ... [more ▼]

Objective: Human noroviruses (HuNoVs) are recognised as one of the major global causes of non-bacterial gastroenteritis with significant morbidity and mortality in developing countries and a high economic impact in developed countries. Spread primarily via the faecal-oral route, HuNoV infection is typically an acute self-limiting gastrointestinal illness. However, chronic HuNoV infection of immunocompromised persons has been identified as a persistent cause of disease and viral populations in such patients have been postulated as possible reservoirs for novel NoV variants. The Norovirus genus belongs to the Caliciviridae family of small, non-enveloped, positive sense, single-stranded RNA viruses. This genus is subdivided into at least six genogroups, which infect humans and various animal species. Until the recent report of low-level infection of cultured human B cells, no viable cell culture system existed for the study of HuNoVs. The robustness of this new cell culture system still poses a major hurdle, so that the murine norovirus (MuNoV), replicating efficiently in murine dendritic or macrophage cells, remains the model of choice for in vitro study of noroviruses. The molecular mechanisms driving viral evolution and specifically that of NoVs, are accumulation of point mutations and recombination, which enables the emergence of new combinations of genetic materials to generate potentially dramatic genomic changes in a recombinant NoV, which clusters within two distinct groups of NoV strains when two different genomic regions are phylogenetically analysed. The mechanism for NoV recombination is proposed to follow the copy-choice mechanism, involving a template shift during simultaneous replication of two strains infecting the same cell. Numerous NoV recombination events have been highlighted by in silico methods and the phenomenon has recently been shown in vitro with two homologous MuNoV strains. The object of this study was to qualitatively and quantitatively assess virus progenies generated by the use of different parameters of co- and superinfection of RAW264.7 cells with two homologous MuNoV strains (CW1 and Wu20) and thus help to specify important parameters for the occurrence of recombination events. As prerequisite for recombination events, co-and superinfection are of special interest in viral diseases, such as NoV, for which a persistent stage can be developed. Methods: Viruses and Cells Murine NoVs isolates CW1 and Wu20 were plaque purified and propagated in RAW 264.7 cells (ATCC TIB-71).Virus stocks were produced by infection of RAW 264.7 cells at an MOI of 0.05 and clarified by centrifugation. Passages 8 and 7 for CW1 and Wu20, respectively, were used for the experiments. Co-infection and superinfection experiments Monolayers of RAW 264.7 cells were infected with Wu20 at a MOI of 1 on ice. After 1 h, the Wu20 inoculums were removed and stored. The cells were washed twice with PBS and infected with CW1 at various MOI (0.1 ; 1 ; 10) and at various delays of co- or superinfection (0 min, 30 min, 1 h, 2 h, 4 h, 8 h, 12 h and 24 h). For co-infections, CW1 and Wu20 were simultaneously inoculated on the cells for 1 h on ice. Twenty-four hours after CW1 co- or superinfections, cells and supernatants were collected. Molecular analysis RNA was extracted both from supernatants from the experiment and from propagations of individual plaques, reverse transcribed into cDNA and analysed via two parallel real time PCR reactions allowing discrimination between CW1 and Wu20 at both genomic extremities (regions 1 and 5, located at the ORF1 and ORF3 terminal respectively), as previously described by Mathijs et al., 2010. For analysis of the supernatants, quantifications were also performed via real time PCR. Accordingly, amplicons corresponding to region 1 were amplified for both CW1 and Wu20, then cloned and in vitro transcribed to provide a standard curve for RNA copies. Following this, values for genomic copies were deduced and results were normalised with GAPDH gene transcripts. Isolation and screening of progeny viruses A plaque assay for virus isolation from the co- or superinfection experiments was set up by modifying the protocol described by Hyde et al. (2009). Thus, after 24 h of incubation, 36 plaques were randomly picked for each condition and propagated by inoculation onto RAW 264.7 cells. After this amplification step, monitoring of recombination events was performed by PCR and Real-Time PCR on extracted, reverse transcribed viral RNA, using two sets of primers to amplify regions 1 and 5. The use of two pairs of TaqMan probes allowed discrimination of the strains WU20 and CW1 in two different regions and identification of recombinant strains. Results: Molecular analysis The Real-Time PCR performed on supernatants collected at 24 h post infection showed a greater number of copies of MuNoV Wu20 cDNA in almost all conditions, except t 0 h, 0.5 h, 1 h, 2 h at the MOI 10, where an increase in the number of copies of the CW1 strain was noted. In particular, the latter showed a peak at 1 h at the MOI 10 (89%) followed by a rapid reduction in later times (t 8 h: 20%). Interestingly, for both viruses expected ratios were never attained during the study with the notable exception of the MOI ratio 0.1/1 and the condition t1 MOI 10/1. Isolation and screening of progeny viruses Molecular analysis conducted on plaques selected in the condition of coinfection at MOI 1 and 10 highlighted a predominance of the strain MuNoV CW1 (90%) from t 0h to t 2h, followed by a sharp reduction from t 4h leading to complete absence at t 24h. The Wu20 strain showed a progressive increase from 4h (10%) to 24h (100%). Overall, the occurrence of recombination events was very rare. Only three putative recombination events were detected at t1 h MOI 1/1 and t 4 h MOI 1/1. Conclusion: The profiles of viral ratios over time are highly interesting. Particularly the infection with CW1 at the MOI 10, with a relative percentage of genomic quantifications of about 50% at the two first time points is intriguing. While the percentage is changed completely at t1 MOI 1 to give the expected ratio of 90/10, it then gradually decreases over the next time points to less than 10% at 24 h post infection. The presence of numerous recombinant viruses as a possible explanation for the t1 MOI 1 peak seems unlikely, as very few putative recombinants were detected during the screening process. The single-step growth kinetics established by Mathijs et al in 2010, showing great similarities for both strains, indicate that the replicative cycle dynamics of the viruses are probably also not responsible. The decrease, especially marked after 8 h, is suggestive of a superinfection exclusion mechanism, where productive infection with Wu20 induces a resistance of the cells to infection with the homologous CW1. Alternatively, in view of the above-mentioned growth curve at high MOI, the decrease might also be due to the end of the first replication cycle having been reached, with no more viable cells left for infection. Considering the 50% viral ratio estimated by genomic copies for the early time-points, the identification of CW1 as the predominant strain (90%) after plaque purification for the same time appears to be somewhat of a discrepancy and merits further investigation Although circulating recombinant NoV strains seem to be common, in vitro recombination is a rare event, at least in the protocol described above, and does not seem to be easily influenced by parameter changes such as time of infection and MOI. Parameters where putative recombinations were identified include t1 MOI 1 and t4 MOI 1. The possible recombinants are yet to be confirmed by sequencing reactions. Further study is necessary to understand mechanisms favouring the predominance of replication of recombinant virus strain in vivo and the challenges of such a replication in vitro. The occurrence of recombination was theoretically limited to one cycle of replication by the protocol (MOI 1 of Wu20). More than one replication cycle might be necessary to enhance the process of recombination by increasing the number of replicating events that could favour recombination. Thus, initial infection at a lower MOI might be an interesting future consideration. Other mechanisms than a time-dependent coinfection might also be worth exploring. Acknowledgements: We thank Professor Herbert Virgin and Dr Larissa Thackray (Washington University, St Louis, MO, USA) for providing the MNV isolates and RAW 264.7 cells. [less ▲]

Detailed reference viewed: 42 (5 ULg)
See detailRelationship between Stroke Volume and Pulse Wave Velocity
Kamoi, Shun; Pretty, Christopher; Chiew, Yeong Shiong et al

Conference (2015, September 01)

Stroke Volume (SV) measurements are essential for evaluating patient hemodynamic status and response to therapy. However, current methods for monitoring SV require either invasive or non- invasive ... [more ▼]

Stroke Volume (SV) measurements are essential for evaluating patient hemodynamic status and response to therapy. However, current methods for monitoring SV require either invasive or non- invasive additional measurements. This study investigates the relationship between SV and Pulse Wave Velocity (PWV) to examine whether the value of PWV can capture the changes in SV. The analysis was performed using data from six porcine experiments (N=6 Pietrain Pigs, 20-29 kg) in which left ventricular volume, aortic arc pressure, and descending aortic pressure waveforms were measured simultaneously. From the measured data, correlation coefficients were determined between absolute value of aortic PWV, SV and trend value ‘PWV – mean PWV’, ‘SV – mean SV’ during periods when changes in SV were induced from preload changes, as well as infusion of dobutamine. The results showed good correlation (r = 0.59) for trend value, however, the correlation coefficient were poor with r = 0.028 for absolute value across all pigs. The analysis showed that value of PWV is reliable for capturing trend value of SV in preload changes. However, it is unreliable for capturing absolute value of SV or changes in SV made from dobutamine. [less ▲]

Detailed reference viewed: 46 (0 ULg)
Peer Reviewed
See detailFitness evaluation and molecular characterization of a recombinant murine norovirus (MuNoV) during serial passages in cell culture
Ferreira de Oliveira Filho, Edmilson; Di Felice, Elisabetta; Toffoli, Barbara et al

Conference (2015, September 01)

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a ... [more ▼]

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a recombinant Wu20/CW1 strain was obtained after in vitro coinfection of RAW264.7 cells with parental MuNoV strains CW1 and Wu20 (Mathijs et al 2010). The recombinant strain showed reduced plaque size compared to the parental strains and it was suggested that this was due to modified virulence properties in vitro. The aim of this study was to observe and molecularly characterize the natural genetic evolution of the recombinant MuNoV strain across in vitro replications. Methods: MNV strains used in this study were CW1, WU20 (Thackray et al., 2007, kindly provided by prof. H. Virgin) and Rec MNV (Mathijs et al., 2010). RAW 264.7 cells (ATCC TIB-71) grown in Dulbecco’s modified Eagle’s medium (Invitrogen) complemented (DMEMc) with 10 % heat inactivated FCS (BioWhittaker), 2 % penicillin (5000 U /ml) and streptomycin (5000 mg/ml) (PS; Invitrogen) and 1 % HEPES buffer (1 M; Invitrogen). The recombinant strain was serially replicated in vitro in RAW264.7 cells (up to 14 passages). RAW 264.7 (Mouse leukaemic monocyte macrophage) cells were infected with MNV for 72 hours and afterwards lysed by freeze and thaw and viruses purified by ultracentrifugation of both cells and supernatant. Viral plaque sizes of early and late progenies (30 for each virus) were compared with the Image J software. The experiment was repeated two times. RNA was extracted from 140 ml purified suspension 1:5 diluted using the QIAamp Viral RNA Mini KitTM (Qiagen) according to the manufacturer’s instructions. cDNA was generated using a poly-A primer tagged GCCAACGACCGGGAGGCCAGC(T)20 previously described (Müller et al 2007) using superscript ii reverse transcriptase kit (Invitrogen®) treated with RNase H or with other antisense primers using iScript select kit (Bio-Rad®). For the genetic characterization two different studies were conducted. The first study aimed to develop a sequencing strategy in order to obtain the complete genome of the recombinant MNV. Then, in the second study, sequences obtained from different viral passages into RAW cells (e.g. P5 and P14) were compared in order to study the viral adaptation. Primers were designed using the Primer Express® software and netprimer® (Premier biosoft). PCR was performed using taq polymerase with thermopol buffer (new England biolabs) as per manufacturer’s instructions. Afterwards, fragments were excised from agarose gel and DNA purified using the QIAquick Gel Extraction KitTM (Qiagen) and cloning using the PGEM T easy cloning kit (Promega) plasmid DNA was transferred to sequencing by GATC Biotech (Koblenz, Germany). Results: The size of the lysis plaque surface of P2 and P14 showed a considerable divergence. The average plaque size increased from the earlier to the later progenies (from 0.1 mm2 to around 0.5 mm2). A significant difference was demonstrated between them with the Mann and Whitney non parametric statistical test. The genetic characterization of the recombinant strain obtained in vitro was previously based on partial genomic sequences, which provided limited information. Accordingly to our initial molecular analysis of 1.5 kb partial genomic sequence comprising the part of the RdRp and the part of the VP1 did not show any genetic modifications between passage 4 (accession number HM044221) and passage 14 recMNV. Therefore, a strategy for sequencing the complete genome of the different MNV strains was established. The genome of the recombinant MNV was divided into seven regions and the amplification was performed using either new designed or previous published primers. Molecular analysis using the nearly complete genome of the recombinant MNV passage 14 and the two parental strains (CW1 and WU20) showed nine modifications in the genome, comprising three aminoacid changes. Accordingly, two modification were in the RdRp region aa position 1384 Glycine (G) instead of Aspartic acid (D) and aa position 1393 Serine (S) instead of Asparagine (N) and one modification was in the capsid region one modification on aa position 296 Glutamic Acid (E) instead of Lysine. Conclusion: Even preliminary, our data provide evidence of virus adaptation to a new environment (here a cell culture system) after a recombination event. In order to specify whether these hints of genetic mutations could explain fitness modifications during in vitro evolution we need to compare the sequences of passage 14 and the previous viral cellular passages. In addition, two other parameters of in vitro virulence modification will be investigated: (i) virus production and (ii) growth kinetics. The data should provide interesting information about genetic evolution in the genus Norovirus, especially regarding recombination events and explain how a recombinant strain, first disadvantaged compared to its parental strains, could regain fitness by genetic evolution. [less ▲]

Detailed reference viewed: 17 (1 ULg)
See detailCross-linked polymer micelles made of polyphosphate containing amphiphilic copolymers for drug delivery
Riva, Raphaël ULg; Vanslambrouck, Stéphanie ULg; Ergül, Zeynep ULg et al

Conference (2015, September 01)

In the pharmaceutical field, amphiphilic block copolymers are of great interest for the nanovectorization of active principles in Drug Delivery. Indeed, new drugs are synthesized each day but in too many ... [more ▼]

In the pharmaceutical field, amphiphilic block copolymers are of great interest for the nanovectorization of active principles in Drug Delivery. Indeed, new drugs are synthesized each day but in too many cases, their high hydrophobicity makes them useless because of the absence of an appropriated administration method. Typically, amphiphilic block copolymers present the remarkable property to self-assemble in water with formation, in most cases, of spherical micelles characterized by a hydrophobic core and a hydrophylic corona. Rapidly, their ability to encapsulate a hydrophobic drug in their hydrophiobic core was investigated to increase the solubility of the drug in aqueous media, prevent its degradation and decrease its toxicity. However, polymer micelles suffer of the main drawback to be unstable in diluted medium, leading to a premature release of the drug, when the concentration falls down the critical micellar concentration (CMC), which it is rapidly observed after intravenous injection. This work aims at reporting on the development of a drug delivery device based on a new amphiphilic block copolymers made of degradable polyphosphate and bioeliminable poly(ethylene oxide). Thanks to their biocompatibility, biodegradability and their structure similar to natural biomacromolecules, polyphosphates are appealing polymers for biomedical applications. In contrast to aliphatic polyesters, polyphosphate properties and functionality are easily tuned via the chemical nature of the lateral chains R. In order to get rid of the CMC, the crosslinking of the micelle’s core was realized by UV radiation, in order to fulfill the increasingly stringent requirements of biomedical applications. For this purpose, photo-cross-linkable groups were introduced on the polyphosphate backbone. The effect of the crosslinking rate on the drug loading and the drug release was evaluated using doxorubicin as model drug. [less ▲]

Detailed reference viewed: 294 (7 ULg)
Full Text
See detailHot Jupiters with relatives: discovery of additional planets in orbit around WASP-41 and WASP-47
Neveu-VanMalle, M.; Queloz, D.; Anderson, D. R. et al

E-print/Working paper (2015)

We report the discovery of two additional planetary companions to WASP-41 and WASP-47. WASP-41 c is a planet of minimum mass 3.18 $\pm$ 0.20 M$_{\rm Jup}$ and eccentricity 0.29 $\pm$ 0.02, and it orbits ... [more ▼]

We report the discovery of two additional planetary companions to WASP-41 and WASP-47. WASP-41 c is a planet of minimum mass 3.18 $\pm$ 0.20 M$_{\rm Jup}$ and eccentricity 0.29 $\pm$ 0.02, and it orbits in 421 $\pm$ 2 days. WASP-47 c is a planet of minimum mass 1.24 $\pm$ 0.22 M$_{\rm Jup}$ and eccentricity 0.13 $\pm$ 0.10, and it orbits in 572 $\pm$ 7 days. Unlike most of the planetary systems that include a hot Jupiter, these two systems with a hot Jupiter have a long-period planet located at only $\sim$1 au from their host star. WASP-41 is a rather young star known to be chromospherically active. To differentiate its magnetic cycle from the radial velocity effect induced by the second planet, we used the emission in the H$\alpha$ line and find this indicator well suited to detecting the stellar activity pattern and the magnetic cycle. The analysis of the Rossiter-McLaughlin effect induced by WASP-41 b suggests that the planet could be misaligned, though an aligned orbit cannot be excluded. WASP-47 has recently been found to host two additional transiting super Earths. With such an unprecedented architecture, the WASP-47 system will be very important for understanding planetary migration. [less ▲]

Detailed reference viewed: 13 (0 ULg)
Full Text
See detailWASP-120b, WASP-122b and WASP-123b: Three newly discovered planets from the WASP-South survey
Turner, O. D.; Anderson, D. R.; Collier Cameron, A. et al

E-print/Working paper (2015)

We present the discovery by the WASP-South survey of three planets transiting moderately bright stars (V ~ 11). WASP-120b is a massive (5.0MJup) planet in a 3.6-day orbit that we find likely to be ... [more ▼]

We present the discovery by the WASP-South survey of three planets transiting moderately bright stars (V ~ 11). WASP-120b is a massive (5.0MJup) planet in a 3.6-day orbit that we find likely to be eccentric (e = 0.059+0.025-0.018) around an F5 star. WASP-122b is a hot-Jupiter (1.37MJup, 1.79RJup) in a 1.7-day orbit about a G4 star. Our predicted transit depth variation cause by the atmosphere of WASP-122b suggests it is well suited to characterisation. WASP-123b is a hot-Jupiter (0.92MJup, 1.33RJup) in a 3.0-day orbit around an old (~ 7 Gyr) G5 star. [less ▲]

Detailed reference viewed: 6 (0 ULg)
Full Text
Peer Reviewed
See detailA stochastic computational multiscale approach; Application to MEMS resonators
Lucas, Vincent ULg; Golinval, Jean-Claude ULg; Paquay, Stéphane et al

in Computer Methods in Applied Mechanics & Engineering (2015), 294

The aim of this work is to develop a stochastic multiscale model for polycrystalline materials, which accounts for the uncertainties in the micro-structure. At the finest scale, we model the micro ... [more ▼]

The aim of this work is to develop a stochastic multiscale model for polycrystalline materials, which accounts for the uncertainties in the micro-structure. At the finest scale, we model the micro-structure using a random Voronoi tessellation, each grain being assigned a random orientation. Then, we apply a computational homogenization procedure on statistical volume elements to obtain a stochastic characterization of the elasticity tensor at the meso-scale. A random field of the meso-scale elasticity tensor can then be generated based on the information obtained from the SVE simulations. Finally, using a stochastic finite element method, these meso-scale uncertainties are propagated to the coarser scale. As an illustration we study the resonance frequencies of MEMS micro-beams made of poly-silicon materials, and we show that the stochastic multiscale approach predicts results in agreement with a Monte Carlo analysis applied directly on the fine finite-element model, i.e. with an explicit discretization of the grains. [less ▲]

Detailed reference viewed: 137 (90 ULg)
See detailL'emploi du conjonctif en kirundi
Tuyubahe, Pascal ULg

Conference (2015, September 01)

The verb in the conjuctive mood accompagnies always an other verb (auxiliary verb or verb in subordinate clause (valencielle or not) not introduced by a linking word. It is marked by an initial high tone ... [more ▼]

The verb in the conjuctive mood accompagnies always an other verb (auxiliary verb or verb in subordinate clause (valencielle or not) not introduced by a linking word. It is marked by an initial high tone on the first vowel after the first consonnant. After an auxiliary, the high tone disappears in the presence of -ra- morpheme in the present tense. Auxiliaries trigger raising from subject to subect and distinguish two type of morpheme -ra- in the conjunctive verb: -ra- determined syntactically and -ra- determined lexically. [less ▲]

Detailed reference viewed: 14 (2 ULg)
See detailEthnopharmacologie et développement de nouveaux médicaments d’origine naturelle
Frederich, Michel ULg; Jansen, Olivia ULg

Scientific conference (2015, September 01)

Detailed reference viewed: 22 (3 ULg)
Full Text
See detailDetermination of air‐sea ice transfer coefficient for CO2: Significant contribution of gas bubble transport during sea ice growth
Kotovitch, Marie ULg; Moreau, S.; Zhou, Jiayun et al

Poster (2015, September)

Air‐ice CO2 fluxes were measured continuously from the freezing of a young sea‐ice cover until its decay. Cooling seawater was as a sink for atmospheric CO2 but asthe ice crystalsformed,sea ice shifted to ... [more ▼]

Air‐ice CO2 fluxes were measured continuously from the freezing of a young sea‐ice cover until its decay. Cooling seawater was as a sink for atmospheric CO2 but asthe ice crystalsformed,sea ice shifted to a source releasing CO2 to the atmosphere throughout the whole ice growth. Atmospheric warming initiated the decay, re‐shifting sea‐ice to a CO2 sink. Combining these CO2 fluxes with the partial pressure of CO2 within sea ice, we determined gas transfer coefficients for CO2 at air‐ice interface for growth and decay. We hypothesize that this difference originates from the transport of gas bubbles during ice growth, while only diffusion occurs during ice melt. In parallel, we used a 1D biogeochemical model to mimic the observed CO2 fluxes. The formation of gas bubbles was crucial to reproduce fluxes during ice growth where gas bubbles may account for up to 92 % of the upward CO2 fluxes. [less ▲]

Detailed reference viewed: 19 (0 ULg)
Full Text
Peer Reviewed
See detailDroit d'auteur et compétence internationale : de la territorialité à la mode de la Cour de justice
Wautelet, Patrick ULg

in LAMBRECHT, Maxime; Fossoul, Virginie; Delforge, Véronique (Eds.) et al 20 ans de la loi sur le droit d'auteur (2015)

Ce texte fait le point sur la jurisprudence de la Cour de justice relative au contentieux de la contrefaçon du droit d'auteur. Il s'intéresse en particulier à l'application de l'article 7(2) du Règlement ... [more ▼]

Ce texte fait le point sur la jurisprudence de la Cour de justice relative au contentieux de la contrefaçon du droit d'auteur. Il s'intéresse en particulier à l'application de l'article 7(2) du Règlement Bruxelles IIbis à ce contentieux [less ▲]

Detailed reference viewed: 61 (0 ULg)
Full Text
Peer Reviewed
See detailBifacial serrated technology in the southern African Still Bay: new data from Sibudu Cave, Kwazulu-Natal
Schmid, Viola; Porraz, Guillaume; Rots, Veerle ULg et al

Conference (2015, September)

Detailed reference viewed: 28 (3 ULg)
Full Text
See detailRegional occurence of greenhouses gases in groundwater: Initial results in shallow Belgian aquifers.
Hakoun, Vivien ULg; Gesels, Julie ULg; Tseng, Jean Hsiao-Chun et al

Poster (2015, September)

Currently, the lack of robust, context-distributed subsurface greenhouses gases (GHG) concentrations data is a key bottleneck to reduce the uncertainty range of GHG groundwater input to continental ... [more ▼]

Currently, the lack of robust, context-distributed subsurface greenhouses gases (GHG) concentrations data is a key bottleneck to reduce the uncertainty range of GHG groundwater input to continental surface water bodies such as rivers or lakes estimates. Carbon dioxyde (CO2), methane (CH4) and nitrous oxyde (N2O) are likely to be indirectly transferred to the atmosphere through groundwater discharge into continental surface water bodies. We aim to extend regional-scale estimates of indirect GHG emissions by screening, in numerous hydrogeological (such as alluvial, sandstone, chalk and limestone aquifers) and land use contexts (such as industrial and agricultural), the occurence of these gases. Here, we report and discuss CO2, CH4 and N2O concentrations from an initial survey conducted over selected sites (n= 40) within shallow (0-100 m depth) aquifers in Wallonia (Belgium) for the first time. The preliminary results obtained in this study show that the range of GHG concentrations varies between 5160 and 47544 ppm, 0 and 1064 nmol.L-1, as well as 1 and 5637 nmol.L-1 for the partial pressure of CO2, CH4 and N2O respectively. This new and unique regional dataset provides a first step in developping a refined understanding of favorable contexts for GHG occurence in groundwater which may be used to reduce the uncertainties related to indirect emissions of GHG through groundwater-surface water transfers. [less ▲]

Detailed reference viewed: 69 (16 ULg)
Full Text
See detailComment favoriser l'apprentissage et la formation des adultes ?
Faulx, Daniel ULg; Danse, Cédric ULg

Book published by De Boeck (2015)

Comment aider les autres à apprendre et se développer ? Telle est la question centrale de cet ouvrage qui vise non seulement les formateurs, animateurs et enseignants pour adultes et adolescents mais ... [more ▼]

Comment aider les autres à apprendre et se développer ? Telle est la question centrale de cet ouvrage qui vise non seulement les formateurs, animateurs et enseignants pour adultes et adolescents mais aussi toute personne engagée dans une action de développement des autres. Ce livre propose un ensemble de théories et de concepts éclairants pour la pratique formative ainsi que des méthodologies et outils applicables en situation, le tout illustré par des exemples concrets puisés dans des formations aux thématiques psychosociales, techniques, linguistiques, artistiques ou sportives. Il est structuré en quatre parties et présente en fin de volume un ensemble de fiches-outils. 
• Partie 1. Les quatre dimensions d’une formation. Cette partie décrit les quatre gammes d'effets induits par une formation et comment le formateur peut penser son action en conséquence. 
• Partie 2. Les grands déterminants de l’action pédagogique. Ce modèle conceptuel, constitué de six paramètres, balise l’ensemble des ressources qui sont à la disposition d’un formateur pour générer les effets souhaités.
 • Partie 3. Rendre les apprenants actifs lors d’un exposé. Cette partie traite de l’art et la manière de réaliser un discours pédagogique susceptible de stimuler les auditeurs et de leur permettre d’apprendre. 
• Partie 4. L’apprentissage par expérience. Cette dernière partie porte sur les stratégies d’animation de groupe qui peuvent être déployées dans le cadre des pédagogies expérientielles (ou pédagogies fondées sur l’action). [less ▲]

Detailed reference viewed: 169 (21 ULg)
See detailCrossoads
Sacré, Robert ULg

Diverse speeche and writing (2015)

Programme de radio hebdomadaire sur Equinoxe FM 100.1 ; streaming on line www.equinoxefm.be ; podcasts www.mixcloud.com/robertsacre9 ; infos www.facebook.com/robert.sacre.9

Detailed reference viewed: 17 (0 ULg)
Full Text
See detailInsolvabilité européenne et procédures secondaires
Wautelet, Patrick ULg

in Brulard, Yves (Ed.) Règlement 2015/848 relatif aux procédures d'insolvabilité - premier commentaire (2015)

Ce texte tente d'éclairer la portée des dispositions du Règlement N° 2015/848 du 20 mai 2015 relatives aux procédures secondaires : après un bilan sommaire de l'application des dispositions du Règlement ... [more ▼]

Ce texte tente d'éclairer la portée des dispositions du Règlement N° 2015/848 du 20 mai 2015 relatives aux procédures secondaires : après un bilan sommaire de l'application des dispositions du Règlement 1346/2000 relatives aux procédures secondaires, qui s'appuie principalement sur la jurisprudence de la Cour de justice, le texte commente les principales innovations du Règlement révisé. Une attention particulière est accordée à la technique de l'engagement par laquelle le syndic de la procédure principale peut éviter l'ouverture d'une procédure secondaire. [less ▲]

Detailed reference viewed: 99 (0 ULg)
Full Text
Peer Reviewed
See detailOne injection of platelet-rich plasma associated to a submaximal eccentric protocol to treat chronic jumper's knee
Kaux, Jean-François ULg; Croisier, Jean-Louis ULg; Bruyère, Olivier ULg et al

in The Journal of sports medicine and physical fitness (2015), 55(9), 953-61

INTRODUCTION: Jumper's knee is a frequent chronic overuse syndrome of the upper part of the patellar tendon. Platelets contain lots of growth factors which could enhance the healing process of tendons ... [more ▼]

INTRODUCTION: Jumper's knee is a frequent chronic overuse syndrome of the upper part of the patellar tendon. Platelets contain lots of growth factors which could enhance the healing process of tendons. METHODS: Twenty patients with chronic upper patellar tendinopathy were enrolled. Assessments were made before infiltration of PRP, and 6 weeks and 3 months after the infiltration, using a 10--point Visual Analogic Scale, clinical examinations with a pressure algometer, algofunctional scores (IKDC and VISA--P), functional assessments (isokinetic and optojump evaluations) and imagery (ultrasounds and MRI). The PRP was obtained with an apheresis system (COM.TEC, Fresenius). Six millilitres of PRP were injected without local anaesthetic. One week after infiltration, patients started a standardised sub--maximal eccentric reeducation. RESULTS: Pain during daily activities significantly decreased with time. During functional evaluation, it decreased as well, but without significant functional improvement. No improvements in the imagery measurements were observed. Younger patients seemed to be more susceptible to have an improvement of pain by the PRP infiltration. CONCLUSION: This study demonstrates that a local infiltration of PRP associated with a submaximal eccentric protocol can improve symptoms of chronic jumper's knee in patients non--responsive to classical conservative treatments. [less ▲]

Detailed reference viewed: 195 (43 ULg)
Full Text
See detailUncertainty in biology: a computational modeling approach
Geris, Liesbet ULg; Gomez-Cabrero, David

Book published by Springer (2015)

Computational modeling of biomedical processes is gaining more and more weight in the current research into the etiology of biomedical problems and potential treatment strategies. Computational modeling ... [more ▼]

Computational modeling of biomedical processes is gaining more and more weight in the current research into the etiology of biomedical problems and potential treatment strategies. Computational modeling allows to reduce, refine and replace animal experimentation as well as to translate findings obtained in these experiments to the human background. However these biomedical problems are inherently complex with a myriad of influencing factors, which strongly complicates the model building and validation process. This book wants to address four main issues related to the building and validation of computational models of biomedical processes: 1. Modeling establishment under uncertainty 2. Model selection and parameter fitting 3. Sensitivity analysis and model adaptation 4. Model predictions under uncertainty In each of the abovementioned areas, the book discusses a number of key-techniques by means of a general theoretical description followed by one or more practical examples. This book is intended for graduate students and researchers active in the field of computational modeling of biomedical processes who seek to acquaint themselves with the different ways in which to study the parameter space of their model as well as its overall behavior. [less ▲]

Detailed reference viewed: 48 (6 ULg)
See detailIUVS observations of Nitric Oxide nightglow
Stiepen, Arnaud ULg; The IUVS team

Conference (2015, September)

Detailed reference viewed: 23 (4 ULg)