ORBi: Amato Jussara - Targeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences

Reference : Targeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences


	Document type :	Scientific journals : Article
	Discipline(s) :	Life sciences : Biochemistry, biophysics & molecular biology Physical, chemical, mathematical & earth Sciences : Chemistry
	To cite this reference:	http://hdl.handle.net/2268/95073

Title :	Targeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences
Language :	English
Author, co-author :	Amato, Jussara [ > > ]
	Pagano, Bruno [ > > ]
	Borbone, Nicola [ > > ]
	Oliviero, Giorgia [ > > ]
	Gabelica, Valérie [Université de Liège - ULg > Département de chimie (sciences) > GIGA-R : Laboratoire de spectrométrie de masse (L.S.M.) >]
	De Pauw, Edwin [Université de Liège - ULg > Département de chimie (sciences) > GIGA-R : Laboratoire de spectrométrie de masse (L.S.M.) >]
	D'Errico, Stefano [ > > ]
	Piccialli, Vincenzo [ > > ]
	Varra, Michela [ > > ]
	Giancola, Concetta [ > > ]
	Piccialli, Gennaro [ > > ]
	Mayol, Luciano [ > > ]
Publication date :	2011
Journal title :	Bioconjugate Chemistry
Publisher :	American Chemical Society
Volume :	22
Pages :	654-663
Audience :	International
ISSN :	1043-1802
e-ISSN :	1520-4812
City :	Washington
Country :	DC
Keywords :	[en] mass spectrometry ; G-quadruplex ; non-covalent ; DNA ; nucleic acids ; PNA
Abstract :	[en] The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K+- or NH4+-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1 P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In Kþ buffer, P1-P4 bind the ckit87up quadruplex structure as “quadruplex-binding agents”. The same holds for P1 in NH4þ solution. On the contrary, in NH4þ solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as “quadruplex openers”.
Research units :	Giga-Systems Biology and Chemical Biology
Funders :	Fonds de la Recherche Scientifique (Communauté française de Belgique) - F.R.S.-FNRS
Permalink :	http://hdl.handle.net/2268/95073
DOI :	10.1021/bc100444v

File(s) associated to this reference

Fulltext file(s):

	File	Commentary	Version	Size	Access
Restricted access	2011-BioconjChem_Jussara_ckit.pdf		Publisher postprint	3.95 MB	Request copy

All documents in ORBi are protected by a user license.

Dspace v1.5