References of "Poster"
     in
Bookmark and Share    
Peer Reviewed
See detailHigh diversity in late Early Cretaceous ichthyosaurs
Fischer, Valentin ULg; Guiomar, Myette; Godefroit, Pascal

Poster (2009, October)

Considered as the last survivors of a dying group, all Cretaceous ichthyosaurs have traditionally been incorporated within a single genus, Platypterygius. This waste-basket genus includes large ... [more ▼]

Considered as the last survivors of a dying group, all Cretaceous ichthyosaurs have traditionally been incorporated within a single genus, Platypterygius. This waste-basket genus includes large ichthyosaurs with numerous, large and conical tooth crowns and bulbous polygonal root well anchored in dental grooves. With such a dentition, Platypterygius can be included within the “Smash guild”. However, the study of new specimens from the Aptian-Albian marls of the Vocontian basin (SE France) reveals an unexpected diversity of late Early Cretaceous ichthyosaurs. Beside “classical” Platypterygius specimens, another type of ichthyosaur with very tiny and pointed teeth has been found in the mid-Albian marls of Sisteron, in High-Provence Alps. This new taxon is based on a partial crushed skull, two basioccipitals, 8 teeth, and 15 centra. The teeth range from 20mm to 2cm and are highly compressed labio-lingualy, with a thickness/wideness ratio of the root sometimes as low as 1/4. Crowns are slightly curved and sharply pointed, indicating a diet of small and soft preys. Interestingly, although the rostral bones are slender and delicate – thus radically different from conventional Late Early Cretaceous ichthyosaurs – the basioccipital of this taxon shares many characters with Platypterygius and is of the same overall size. Together with the recently named genus Maiaspondylus from the Albian of western Canada, these specimens suggest a higher diversity of late Early Cretaceous ichthyosaurs, in contradiction with the current view of ichthyosaur extinction, said to be gradually decreasing in diversity since the Middle Jurassic. In fact, the number of ecological niches occupied by ichthyosaurs apparently even increased from the Late Jurassic until the late Early Cretaceous. Therefore, the ecological impact of the Cenomanian-Turonian boundary on marine reptile faunas was probably more severe than previously thought. [less ▲]

Detailed reference viewed: 291 (5 ULg)
Full Text
See detailPrediction of genetic interactions in yeast using machine learning
Schrynemackers, Marie ULg

Poster (2009, October)

Detailed reference viewed: 10 (2 ULg)
Full Text
Peer Reviewed
See detailVariations in sound production in <i>Dascyllus flavicaudus<i>
Kever, Loïc ULg; Lecchini, David; Parmentier, Eric ULg

Poster (2009, October)

Detailed reference viewed: 10 (4 ULg)
Peer Reviewed
See detailVaccination with class-I restricted PrP peptides induces cytotoxic CD8+ T cells and prolongs the clinical phase duration of murine scrapie
Bruley Rosset, Martine; Sacquin, Antoine; Defaweux, Valérie ULg et al

Poster (2009, October)

Detailed reference viewed: 10 (2 ULg)
Full Text
Peer Reviewed
See detailSwimming ontogeny in Dicentrarchus labrax
Olivier, Damien ULg; Parmentier, Eric ULg

Poster (2009, October)

Detailed reference viewed: 14 (0 ULg)
Full Text
Peer Reviewed
See detailPrevalence of Chronic Kidney Disease in an Elderly Population: Impact of the Choice of the Equation Used for Estimating GFR
Mariat, Christophe; Cavalier, Etienne ULg; Maillard, Nicolas et al

Poster (2009, October)

Detailed reference viewed: 21 (6 ULg)
See detailAffective valence influences participant’s susceptibility to false memories and illusory recollection
Dehon, Hedwige ULg; laroi, Frank; Van der Linden, Martial

Poster (2009, October)

Detailed reference viewed: 25 (0 ULg)
Full Text
See detailTetrazolium testing in Allium genus
Rodriguez Quilon, Isabel; Adam, Gilles ULg; Duran, José María

Poster (2009, September 29)

Detailed reference viewed: 54 (9 ULg)
Full Text
See detailLiposomes loaded with diglyceride ester of methotrexate and mephalan: sutdies on stability and hemocompatibilit
Kuznetsova, N; Sevrin, Chantal ULg; Lespineux, David et al

Poster (2009, September 28)

Detailed reference viewed: 25 (0 ULg)
Full Text
Peer Reviewed
See detailNano-sized drug carriers and their interactions with biomimetic model membranes
Frost, R; Cerda, B; Grandfils, Christian ULg et al

Poster (2009, September 28)

Detailed reference viewed: 11 (0 ULg)
Full Text
See detailActivation of the complement by PLGA nanoparticles.
Cerda, B; Sevrin, Chantal ULg; Patronidou, C et al

Poster (2009, September 28)

Detailed reference viewed: 14 (1 ULg)
Full Text
See detailDroplet internal flow measurement using micro-PIV
Lebeau, Frédéric ULg; Vetrano, Maria-Rosaria; van Beeck, Jeroen et al

Poster (2009, September 25)

The micro-PIV technique represents a development of the general particle image velocimetry technique to applications in fluid mechanics phenomena at a micrometric scale. It takes advantage from the very ... [more ▼]

The micro-PIV technique represents a development of the general particle image velocimetry technique to applications in fluid mechanics phenomena at a micrometric scale. It takes advantage from the very small depth of field of long distance objectives with high magnification to carry out accurate measurements in the focusing plane. The typical configuration consists of a microscope coupled to a pulsated laser and a double exposure PIV camera. The flow is seeded using sub-micrometric fluorescent particles. The laser light is directed on the investigated flow through the epifluorescent microscope objective. The light re-emitted by the fluorescent particles is detected by the PIV camera equipped of an optical filter to select only the fluorescence wavelength. The micro-PIV technique presents a large interest in the validation of numerical codes developed in different micro-fluidic framework such as biological flows and in industrial application as the ink-jet print-head. To investigate the micro-PIV measurements capabilities for fast moving and deforming droplets, measurement of the flow inside a jet ejected by a piezo-driven capillary up to the droplet formation by Rayleigh instability are studied in combination with PTV in order to distinguish the main liquid movement from the bulk one. Liquids differing from each other for their viscosity and their surface tension as well as piezo-element frequency in the 1 to 8 KHz range are investigated. The flow rate of the jet is adjusted by means of a pushing syringe system. Low concentration of 0.86 microns fluorescent particles is employed as seeding in order to have good signal to noise ratios. The ensemble averaging method is used to increase the height of the correlation peaks. Stroboscopic method is used to achieve several couples of frames taken in the same conditions thanks to high repeatability of piezo-driven instabilities. Moreover changing the delay of stroboscopy all the droplet formation phases can be analyzed in detail. In the experimental configuration, optical aberrations play a role since they affect the position and shape of the particle images and as a consequence the velocity field. The two main optical aberration experienced are astigmatism and measurement plane deformation. Astigmatism cannot be avoided in the experimental configuration, as it is clearly observed on droplet images were particles above and bellow the focalisation plane appear as perpendicular lines (Fig 1a). Nevertheless cross correlation method is not sensitive on particle image shape. As the measurement plane defined by the focal plane of the microscope is located inside a curved transparent object, it deformed as it was passing through a lens. The deformation of the objective plane affects the measurements as a function of the optical configuration, droplet curvature and relative refractive index. However, in the studied configuration, deformed plane differs only from the straight one of about 8 µm. The micro-PIV method is therefore suited to measure the instantaneous vector field inside droplets through cross-correlation methods (Fig 1b). The internal flow recirculation is observed. Measurements can be also performed in different planes inside the droplet depending on focalisation plane. [less ▲]

Detailed reference viewed: 277 (5 ULg)
Full Text
Peer Reviewed
See detailRisks analysis of dairy practices impact on herd udder health in walloon dairy farms
Theron, Léonard ULg; Saegerman, Claude ULg; Hanzen, Christian ULg

Poster (2009, September 22)

As most of production pathologies in dairy farming, mastitis is characterized by a multifactorial aetiology. Its diagnosis and treatment requires a good knowledge of its determinant and predisposing ... [more ▼]

As most of production pathologies in dairy farming, mastitis is characterized by a multifactorial aetiology. Its diagnosis and treatment requires a good knowledge of its determinant and predisposing factors. The comparative epidemiology of 349 walloon farms registered to individual milk analysis programs led to highlight the practices used in farms whose last 3 months' herd somatic cell count was above 400.000 cells/ml. We identified the following risk indicators relative to 1) herd demography : age, composition, herd production average, percentage of high cell counts animals 2) the animal housing : use of straw as bedding stall for all classes of animals and lack of a calving pen 3) the milking machine : milking cups cleaning 4) the dairy practices : lack of washing cloth towels between 2 milkings, occasional foremilk check, stripping, lack of post-dip and 5) animal nutrition : mould on beet pulp silos and composition of the main concentrate. This descriptive and univariate analysis confirmed the risky situation of a large majority of dairy farms regarding the recommendations of good dairy practices guides. [less ▲]

Detailed reference viewed: 91 (28 ULg)
Full Text
See detailMarital satisfaction and emotional communication in couples with an alcoholic member
Dethier, Marie ULg; Counerotte, Christelle; Blairy, Sylvie ULg

Poster (2009, September 18)

Detailed reference viewed: 63 (6 ULg)
Full Text
Peer Reviewed
See detailMarital satisfaction, emotion and mental health in parents of child with autism spectrum disorder
Blairy, Sylvie ULg; Counerotte, Christelle; Léonard, Cathy

Poster (2009, September 18)

Detailed reference viewed: 37 (1 ULg)
Peer Reviewed
See detailThe impact of culture on cognitive performance in neuropsychological tests.
Schmitz, Xavier ULg; Mardaga, Julie; Meulemans, Thierry ULg

Poster (2009, September 17)

Detailed reference viewed: 20 (7 ULg)
Full Text
See detailIn situ formation of stabilizers for the implementation of dispersion nitroxide mediated polymerization of MMA in supercritical carbon dioxide
Grignard, Bruno ULg; Gigmes, Didier; Jérôme, Christine ULg et al

Poster (2009, September 17)

Controlled dispersion Nitroxide Mediated Polymerization (NMP) of methyl methacrylate (MMA) was successfully carried out for the first time in supercritical carbon dioxide (scCO2) in the presence of CO2 ... [more ▼]

Controlled dispersion Nitroxide Mediated Polymerization (NMP) of methyl methacrylate (MMA) was successfully carried out for the first time in supercritical carbon dioxide (scCO2) in the presence of CO2-philic perfluorinated surfactant that was generated “in situ”. The control of the MMA polymerization relies on the strategy developed by Charleux et al. that consists of using a SG1-based alkoxyamine, i.e. the block-builder, in the presence of small amount of styrene. In a first step, CO2 soluble polyheptadecafluorodecylacrylate was prepared in scCO2 using block-builder as an alkoxyamine. In a second step, nitroxide SG1 mediated dispersion polymerization of MMA was conducted at 70°C and 300 bar in the presence of 5 w% of SG1 terminated surfactant compared to the monomer. Different monomer to alkoxyamine molar ratios were investigated in order to target different molecular weights. In each case, the monomer conversion was high (>90 %), the experimental molecular weight was in good agreement with the theoretical value and the polydispersity was narrow (Mw/Mn ~1.2). Moreover, after depressurisation of the cell, PMMA was collected as a free flowing powder consisting of small sized microspheres. [less ▲]

Detailed reference viewed: 38 (7 ULg)
Full Text
See detailNew perfulorinated macroligand for the implementation of dispersion atom transfer radical polymerization in sc CO2
Grignard, Bruno ULg; Calberg, Cédric ULg; Jérôme, Christine ULg et al

Poster (2009, September 17)

Due to an increasing need for polymers with well-defined architecture (diblock-, graft-, star-shaped copolymers), molecular weight and/or functional end-groups, the use of controlled radical ... [more ▼]

Due to an increasing need for polymers with well-defined architecture (diblock-, graft-, star-shaped copolymers), molecular weight and/or functional end-groups, the use of controlled radical polymerization (CRP) in scCO2 has started to gain attention. Among all the controlled processes, Atom Transfer Radical Polymerization has emerged as a robust tool for the preparation of polymers with well-defined molecular weight, architecture and chain-end functionality. In a very recent paper, we reported the first efficient dispersion ATRP of methyl methacrylate (MMA) in scCO2 using a fluorinated polymeric ligand that had a dual role, i.e., the complexation of the copper salt and the stabilization of PMMA growing particles. In this contribution, we extended this new system to the dispersion ATRP of styrene2, to the synthesis of diblock copolymers beads2 or to the preparation of PMMA particles by AGET ATRP. Because both ATRP and alkyne-azide Huisgen’s 1,3-dipolar cycloaddition relies on the use of a Cu(I) catalyst, synthesis of pyrene end-functionalized polymers by simultaneous dispersion ATRP and click reaction was also investigated in supercritical carbon dioxide. Finally, the immobilization of these new macroligands onto an inorganic support leads to the formation of pseudo-homogeneous catalyst that were successfully used to prepare CO2-soluble perfluorinated methacrylate and depending on the molecular weight and TEDETA composition of the macroligand, results obtained by supported ATRP without addition of Cu(II) as deactivator are identical to those obtained by homogeneous ATRP. [less ▲]

Detailed reference viewed: 47 (5 ULg)
Full Text
See detailCobalt-mediated radical polymerization of vinyl monomers: investigation of cobalt-coordination
Debuigne, Antoine ULg; Piette, Yasmine ULg; Poli, Rinaldo et al

Poster (2009, September 17)

Controlled Radical Polymerization techniques have been developed to obtain well-defined architectures and to control polymer parameters. Among these systems is Cobalt-Mediated Radical Polymerization (CMRP ... [more ▼]

Controlled Radical Polymerization techniques have been developed to obtain well-defined architectures and to control polymer parameters. Among these systems is Cobalt-Mediated Radical Polymerization (CMRP), which is based on the reversible deactivation of the growing radical chains with a cobalt complex, the cobalt (II) bis(acetylacetonate). The interest of this system is not only due to its ability to control the polymerization of very reactive monomers such as vinyl acetate (VAc) and N-vinylpyrrolidone (NVP), but also its peculiar mechanism which exhibits two pathways depending on the polymerization conditions; a reversible termination process and a degenerative chain transfer mechanism. Furthermore, it has been showed that the Co-C bond strength and thus the polymerization are strongly influenced by the use of some additives, such as water, dimethylformamide, dimethylsulfoxide and pyridine, which coordinate the cobalt free site. In this presentation we report the use of a preformed alkyl-cobalt(III) adduct as initiator for the polymerization of various vinyl monomers of different reactivity (VAc, acrylonitrile,…) and on the effect of several ligands on their polymerization control. The preparation of novel block copolymers by CMRP will finally be presented. As a conclusion, cobalt-coordination appears today as a unique opportunity to adjust the Co-C bond strength and to push back the bounds of possibilities in terms of macromolecular engineering assisted by CMRP. [less ▲]

Detailed reference viewed: 74 (9 ULg)
Full Text
See detailCobalt mediated radical polymerization (CMRP) using bis(acetylacetonato)cobalt(II): a unique tool for controlling the radical polymerization of conjugated and unconjugated vinyl monomers
Hurtgen, Marie ULg; Debuigne, Antoine ULg; Jérôme, Christine ULg et al

Poster (2009, September 17)

Cobalt-Mediated Radical Polymerization (CMRP) imparts a high level of control on the polymerization of acrylic and vinylic esters, acrylic acid and acrylonitrile. However, each class of monomers appears ... [more ▼]

Cobalt-Mediated Radical Polymerization (CMRP) imparts a high level of control on the polymerization of acrylic and vinylic esters, acrylic acid and acrylonitrile. However, each class of monomers appears to be controlled by one class of cobalt complexes. For example, the polymerization of acrylates and acrylic acid is mediated by cobalt porphyrin complexes while vinyl acetate (VAc) and acrylonitrile are efficiently controlled by bis(acetylacetonato)cobalt(II) (Co(acac)2). Therefore, a challenging issue in CMRP remains to broaden the range of monomers that can be controlled by the same cobalt complex. Recently, the controlled random copolymerization of butyl acrylate (BuA) with VAc was performed using the conventional V-70/Co(acac)2 CMRP system, but the homopolymerization of BuA remained uncontrolled. In this work, we used a new alkylcobalt(III) adduct to initiate and control the copolymerization of BuA with VAc. This achievement resulted in a significant improvement over the V-70/Co(acac)2 pair regarding the molecular weight control and the polydispersity indexes. Moreover, for the first time, the alkylcobalt(III) adduct was also efficient in controlling the homopolymerization of BuA and yielded low polydispersity PBuA even in the absence of VAc. These results indicate that Co(acac)2 is a versatile mediator for the CMRP of both unconjugated vinyl monomers (VAc, N-vinylpyrrolidone) and conjugated monomers such as acrylates. It gives access to copolymers that cannot be prepared by other controlled radical polymerization techniques. [less ▲]

Detailed reference viewed: 92 (19 ULg)
Full Text
See detailα-chloro-ε-caprolactone, a versatile precursor for grafting of aliphatic polyesters
Riva, Raphaël ULg; Lenoir, Sandrine ULg; Lecomte, Philippe ULg et al

Poster (2009, September 17)

Macromolecular engineering is one of the most powerful tool to synthesise many polymers of various architectures and with tailored properties. This contribution aims at reporting on a novel strategy for ... [more ▼]

Macromolecular engineering is one of the most powerful tool to synthesise many polymers of various architectures and with tailored properties. This contribution aims at reporting on a novel strategy for the macromolecular engineering of poly-ε-caprolactone (PCL) which is based on the use of a dual monomer / initiator compound, α-chloro-ε-caprolactone (αClεCL). Indeed, αClεCL is not only polymerizable by ring opening initiated by metal alkoxides, but it is also an initiator for the atom transfer radical polymerization (ATRP) of vinyl monomers, so leading easily to the synthesis of macromonomers. Polystyrene macromonomer has been prepared by this method and successfully copolymerized with ε-caprolactone (εCL) with formation of the corresponding grafted PCL. αClεCL is also a precursor of copolyesters with εCL that bear pendant chlorides. These (co)polyesters have been used as macroinitiators for the ATRP of methyl methacrylate in order to synthesise the corresponding graft copolymer. On the other hand, the pendant chlorides of poly(αClεCL-co-εCL) copolyesters were easily converted into azide with formation of the corresponding azide bearing copolyester. This copolyester was then reacted with an alkyne bearing an ATRP initiator by “Click chemistry”. The conversion of chlorides into more efficient ATRP initiators led to the improvement of the initiation efficiency of the macroinitiator. [less ▲]

Detailed reference viewed: 87 (17 ULg)
Peer Reviewed
See detailExploratory evaluation of the influence of honey bee colonies on Brassica napus L.
Nguyen, Bach Kim ULg; Quievy, Samuel; Mignon, Jacques ULg

Poster (2009, September 16)

Detailed reference viewed: 49 (13 ULg)
Full Text
See detailFoams of polyurethane/MWNT nanocomposites for efficient EMI reduction
Chen, Y. Y.; Urbanczyk, Laetitia ULg; Thomassin, Jean-Michel ULg et al

Poster (2009, September 16)

Detailed reference viewed: 56 (15 ULg)
Full Text
See detailLower Palaeozoic and Devonian carbonate facies in Nepal
Pas, Damien ULg; Boulvain, Frédéric ULg

Poster (2009, September 14)

Nepal is localized in the central part of the Himalayan arc. In uplift since the Cenozoic time, the Himalaya is traditionally divided into six lithotectonic zones extending in parallel belts. From north ... [more ▼]

Nepal is localized in the central part of the Himalayan arc. In uplift since the Cenozoic time, the Himalaya is traditionally divided into six lithotectonic zones extending in parallel belts. From north to south there are respectively: (1) the Trans-Himalayan batholith; (2) the Indus-Tsangpo suture zone; (3) the Tethyan (Tibetan) Himalaya; (4) the Higher (Greater) Himalaya; (5) the Lesser Himalaya; and (6) the Sub-Himalaya. This PhD thesis is focused on the Tethyan sedimentary rocks exposed in the Nepal Tethyan Himalaya belt and in the thrusting nappes belonging to the Lesser Himalaya. These nappes contain unmetamorphosed sedimentary rocks which might belong to the Tethyan sedimentary succession. The Tethyan Himalaya has preserved highly fossiliferous marine rocks deposited on the shelf and slope of the Indian continental margin from Late Proterozoic-Cambrian through early Eocene times. The main objective of this PhD thesis is to build a first sedimentological canvas for the Lower Paleozoic and Devonian carbonated rocks of Nepal which could be compared with the Belgian facies. This long distance comparison between the Belgian and the Nepalese basins will allow to have a better understanding of the phenomena that run the global carbonate sedimentation. The methods that will be used to achieve this work are: (1) bed by bed sampling; (2) petrographic analysis and facies modelling; (3) magnetic susceptibility analysis for correlations and eustatism and (4) paleontological datation. A first sedimentological campaign took place during the months of March and April 2009. It allowed to study three sections around Katmandu valley and two sections in the Annapurna range (Manang area). The sections studied around Katmandu (Pulchauki and Chandragiri Hill) belonged to the Formation of Chandragiri (Ordovician) and Godavari (Devonian) which are mainly constituted by carbonate rocks. The sections described in Manang area are mainly made-up by the terrigeneous rocks of the Dark Band, Tilicho Pass and Tilicho Lake Formation (Silurian to Lower Carboniferous). The diversity of facies observed in these five sections will be exposed. [less ▲]

Detailed reference viewed: 24 (5 ULg)
See detailGeology, hydrogeology, mining industry and real estate assets along the new RAVeL Hannut-Huy-Modave-Ciney
Declercq, Pierre-Yves; Goemaere, Eric; Ruthy, Ingrid ULg

Poster (2009, September 14)

Detailed reference viewed: 97 (20 ULg)
Peer Reviewed
See detailBee monitoring level 3
Nguyen, Bach Kim ULg; Mignon, Jacques ULg; Haubruge, Eric ULg

Poster (2009, September 14)

Detailed reference viewed: 35 (16 ULg)
Peer Reviewed
See detailMalignant catarrhal fever induced by alcelaphine herpesvirus 1 is associated with proliferation of CD8+ T cells supporting a latent infection
Dewals, Benjamin G ULg; Boudry, Christel; Farnir, Frédéric ULg et al

Poster (2009, September 11)

Alcelaphine herpesvirus 1 (AlHV 1), carried by wildebeest asymptomatically, causes malignant catarrhal fever (WD MCF) when cross species transmitted to a variety of susceptible species of the Artiodactyla ... [more ▼]

Alcelaphine herpesvirus 1 (AlHV 1), carried by wildebeest asymptomatically, causes malignant catarrhal fever (WD MCF) when cross species transmitted to a variety of susceptible species of the Artiodactyla order. Experimentally, WD-MCF can be induced in rabbits. The lesions observed are very similar to those described in natural host species. Here, we used the rabbit model and in vivo 5-Bromo-2’-Deoxyuridine (BrdU) incorporation to study WD-MCF pathogenesis. The results obtained can be summarized as follows. (i) AlHV-1 infection induces CD8+ T cell proliferation detectable as early as 15 days post-inoculation. (ii) While the viral load in peripheral blood mononuclear cells remains below the detection level during most of the incubation period, it increases drastically few days before death. At that time, at least 10% of CD8+ cells carry the viral genome; while CD11b+, IgM+ and CD4+ cells do not. (iii) RT-PCR analyses of mononuclear cells isolated from the spleen and the popliteal lymph node of infected rabbits revealed no expression of ORF25 and ORF9, low or no expression of ORF50, and high or no expression of ORF73. Based on these data, we propose a new model for the pathogenesis of WD-MCF. This model relies on proliferation of infected CD8+ cells supporting a predominantly latent infection. [less ▲]

Detailed reference viewed: 23 (10 ULg)
Full Text
See detailIntegrated Research and Protected Spaces: a New Role for STS?
Thoreau, François ULg

Poster (2009, September 10)

Detailed reference viewed: 15 (0 ULg)
Full Text
Peer Reviewed
See detailReproducibility of dynamometric and non-dynamometric trunk extensor muscle tests in patients with chronic low back pain
Vanderthommen, Marc ULg; Grosdent, Stéphanie ULg; Crielaard, Jean-Michel ULg et al

Poster (2009, September 09)

Background and Aims: Literature describes several dynamometric and non-dynamometric tests to assess trunk extensor muscle performances. In patients with chronic low back pain (CLBP), reproducibility of ... [more ▼]

Background and Aims: Literature describes several dynamometric and non-dynamometric tests to assess trunk extensor muscle performances. In patients with chronic low back pain (CLBP), reproducibility of such assessments remains understudied. The purpose of this study was to compare reproducibility of two dynamometric tests and of the widely used Sorensen test. Methods: 44 patients (22 men, 22 women; age range: 30-60 years) with CLBP (mean Roland-Morris disability scores reaching 6 ± 3.4) were randomized into two groups attending two assessment sessions. Group 1 (12 men and 12 women) underwent two tests (i.e. a maximal strength test (figure 1) and a static endurance test requiring to maintain as long as possible a torque of 50 percent of maximal strength previously determined (figure 2)) performed on a specific trunk extensor dynamometer (David Back). Group 2 (10 men and 10 women) was submitted to the non-dynamometric Sorensen test (lifting the upper trunk and maintaining the horizontal position) (figure 3). For both groups, tests were performed twice (spaced by 15 minutes) during the first session (intra-session reproducibility) and once during the second session (inter-session reproducibility) happening 2 to 7 days later. Results: Mean torques reached 2.67 ± 0.63 Nm/Kg (women) and 3.66 ± 0.75 Nm/Kg (men) for the strength test. Mean maintaining times were 83 ± 34 s for the endurance test and 99 ± 28 s for the Sorensen test. The Table presents coefficient of variations (CV) and limits of agreement (LOA) related to the intra-session and inter-session reproducibility. Conclusions: Reproducibility appeared satisfactory for the strength test, moderate for the Sorensen test and low for the dynamometric endurance test in patients with moderate CLBP. [less ▲]

Detailed reference viewed: 75 (16 ULg)
Full Text
See detailConversion from Excel into Aleph sequential
Renaville, François ULg; Thirion, Paul ULg

Poster (2009, September 08)

Libraries must sometimes load records that are not available to them in a bibliographic format standard (Marc21, Unimarc...): integration of the book database of an academic research center, list of new e ... [more ▼]

Libraries must sometimes load records that are not available to them in a bibliographic format standard (Marc21, Unimarc...): integration of the book database of an academic research center, list of new e-journals bought by the library... This can make the conversion procedure of the data to the Aleph sequential format quite hard. Sometimes the records are only available in Excel. This poster explains how to convert easily in a few steps an Excel file into Aleph sequential in order to load records with manage-18. Next to this procedure, 'tab_fix' and 'fix_doc_do_file_08' are of course used to correct or complete the data. The strength of that method is that no extra programming is needed! Moreover, a basic knowledge of Excel is enough to understand and use that method. [less ▲]

Detailed reference viewed: 717 (60 ULg)
Full Text
See detailEvaluation subjective de l'efficacité à long terme du traitement logopédique chez 32 chanteurs
Morsomme, Dominique ULg; Kievitch, Kievitch

Poster (2009, September 04)

Cette étude vise à déterminer l’efficacité à long terme du traitement logopédique de 32 chanteurs (amateurs et professionnels) via un protocole subjectif. Ces patients ont terminé leur thérapie depuis 6 ... [more ▼]

Cette étude vise à déterminer l’efficacité à long terme du traitement logopédique de 32 chanteurs (amateurs et professionnels) via un protocole subjectif. Ces patients ont terminé leur thérapie depuis 6 mois au moins. Le protocole administré comprend un questionnaire d’appréciation de leur traitement, une auto évaluation des paramètres de raucité et de souffle de leur voix (EVA), le V.H.I (Jacobson et al)1 et le V.H.I.C. (Morsomme et al)2. Dans l’ensemble, les chanteurs sont satisfaits du traitement. Ils jugent que les effets sont toujours présents et ce en particulier pour les professionnels. Ils notent une amélioration de la qualité de leur voix et une diminution du degré de handicap lié à la voix chantée. Les sujets non satisfaits requerraient un autre type de traitement et un soutien plus régulier pour entretenir leurs acquis et un geste vocal adéquat. [less ▲]

Detailed reference viewed: 44 (2 ULg)
See detailRégulation de la sécrétion pulsatile de GnRH par les cellules gliales
Desroziers, Elodie ULg; Kolasa, Elise; Franceschini, Isabelle et al

Poster (2009, September)

Detailed reference viewed: 10 (2 ULg)
Full Text
See detailSensitivity of soil heterotrophic respiration to temperature: short-term impacts.
Buysse, Pauline ULg; Goffin, Stéphanie ULg; Carnol, Monique ULg et al

Poster (2009, September)

Soil respiration is mostly affected by temperature variations but there is still much debate regarding its temperature sensitivity. Especially the difference between short- and long-term responses driven ... [more ▼]

Soil respiration is mostly affected by temperature variations but there is still much debate regarding its temperature sensitivity. Especially the difference between short- and long-term responses driven by changes in microbial activity and population respectively is addressed here. To this end, an incubation experiment is set up with soil samples taken from the surface layer (0-25cm) of a bare area at the Carboeurope agricultural site of Lonzée in Belgium. After homogenization, they are placed into incubators at three different temperatures, namely 5, 15 and 25°C for 2 weeks. Temperature is regulated by Peltier systems that warm up or cool down a bath containing jars with soil samples. All jars are continuously aerated to prevent CO2 from accumulating inside. Moisture levels in the jars are regularly checked and adjusted to ensure that the soil moisture is optimal for soil respiration. Twice a week, short term temperature response is tested by changing incubation temperatures in the range 5 - 35°C. During these cycles, CO2 fluxes are measured at each temperature step with a closed dynamic chamber system. Microbial biomass and hot water-extractable carbon are determined two times during a temperature cycle, allowing a follow up of the evolution of these two variables through a cycle. A comparison between the respiration rates, microbial biomasses and extractable carbon will be presented and would allow a better understanding of the dynamics of the heterotrophic respiration response to temperature in agricultural soils. In the future, other experiments could be derived from this one to focus on substrate availability or soil moisture impacts on soil respiration. [less ▲]

Detailed reference viewed: 86 (5 ULg)
Full Text
Peer Reviewed
See detailStudy of polymorphisms in tir and eae genes of enterohemorrhagic and enteropathogenic Escherichia coli of serogroup O26
Bardiau, Marjorie ULg; Labrozzo, Sabrina; Mainil, Jacques

Poster (2009, September)

Detailed reference viewed: 6 (1 ULg)
Full Text
See detailThe self-schema stability in schizophrenia
Boulanger, Marie ULg; Dethier, Marie ULg; Jacob, Nathalie et al

Poster (2009, September)

Objective: The present study investigated the stability of the self-schema in patients with schizophrenia. Method: Twenty five patients with schizophrenia were compared to twenty healthy subjects. The ... [more ▼]

Objective: The present study investigated the stability of the self-schema in patients with schizophrenia. Method: Twenty five patients with schizophrenia were compared to twenty healthy subjects. The participants completed a questionnaire to describe themselves (a short version of Label from Gendre, 2008) at time 1 and one month later (time 2). Two parallel versions of the questionnaire were employed. Each version contained fifty adjectives which corresponded to personality traits. A comparison between the two versions allowed to investigate the stability of the self-schema. A stability score was computed. Further, participants’ neuropsychological functioning as well as the severity of the symptomatology was measured. Results: Schizophrenia patients displayed a lower score of stability (m = 0,61 ; sd= 0,33) compared to healthy subjects (m = 0,84 ; sd = 0,13) (t(43) = 2.94 ; p = .005). The BDI score was correlated to stability score (r(45) = -.44 ; p = .002). Conclusion: In schizophrenia patients the representation of the self is changing over time. This result is in line with a previous one (Nienszanski, 2003). However, to ours knowledges, the present study is the first to objectively measure this changing. [less ▲]

Detailed reference viewed: 119 (13 ULg)
Full Text
See detailThe mayonnaise droplet
Terwagne, Denis ULg; Gilet, Tristan ULg; Vandewalle, Nicolas ULg et al

Poster (2009, September)

Compound drops are made of a millimetric water drop encapsulated by an oil shell. They are laid on a high viscosity oil bath which is vertically vibrated. When the forcing acceleration is higher than a ... [more ▼]

Compound drops are made of a millimetric water drop encapsulated by an oil shell. They are laid on a high viscosity oil bath which is vertically vibrated. When the forcing acceleration is higher than a given threshold, compound drops can bounce on the surface. We show that above an another threshold a double emulsion occurs in the drop. We measured this emulsion threshold for various size and water/oil volume ratio of the compound drop. [less ▲]

Detailed reference viewed: 58 (3 ULg)
Peer Reviewed
See detailLa gliceraldehido-3-fosfato deshidrogenasa plastidial es esencial para el desarrollo de polen maduro en Arabidopsis thaliana
Muñoz-Bertomeu, Jesús; Cascales - Miñana, Borja ULg; Flores-Tornero, Maria et al

Poster (2009, September)

Detailed reference viewed: 12 (0 ULg)
Full Text
See detailAutobiographical memory and problem solving in bipolar disorder
Boulanger, Marie ULg; Lejeune, Aurélie; Blairy, Sylvie ULg

Poster (2009, September)

Objective: The aim of the present study was to investigate the abilities to remember specific past personal events as well as the abilities to generate specific future events in patients with bipolar ... [more ▼]

Objective: The aim of the present study was to investigate the abilities to remember specific past personal events as well as the abilities to generate specific future events in patients with bipolar disorders (BD). Moreover, the study investigated whether the abilities to generate specific events is related to the abilities to solve interpersonal problems which was measured using the Optional Thinking Test (OTT) (Platt & Spivack, 1977). Method: Nineteen patients with bipolar disorders and 17 healthy subjects completed validated French versions (Neumann & Philippot, 2006) of the AMT Williams & Broadbent (1986). Participants were instructed to generate specific past and future memories in response to cues words. For the OTT, they were asked to yield the most solutions as possible to daily problems. Results: For the past events task, the analysis revealed a significant group by memory interaction (F(2,68) = 4.0 ; p=.023) which indicates that the patients with BD recollected less specific events and more overgeneral events than controls. For the future events task, a significant group by memory interaction emerged (F(2,68) = 7.85 ; p<.001) which indicates that the patients with BD were less specific and yielded more overgeneral memories than the control group. Further, the numbers of specific past and future events were correlated to the numbers of solutions to interpersonal problems (r(36) = .57 ; p<.001, r(36) = .43 ; p=.009, respectively). Conclusion: the results are consistent with previous studies that have examined autobiographical memory (AM) specificity in patients with BD (Scott et al., 2000; Mansell & Lam, 2004). These results support the notion of impairments in imagining specific past and future events BD patients. The difficulty in imagining the future may contribute to relapse. Thus, AM remediation program could be an additional useful tool to develop in CBT for bipolar patients. [less ▲]

Detailed reference viewed: 112 (7 ULg)
Peer Reviewed
See detailVarious fatigue measures during neuropsychological testing
DELRUE, Gaël ULg; DENIS, Loraine; HODY, Elisabeth et al

Poster (2009, September)

MS patients with subjective mild to moderate fatigue, taken as a whole group, are not more exposed to cognitive fatigability during neuropsychological testing than controls. Subjective fatigue, objective ... [more ▼]

MS patients with subjective mild to moderate fatigue, taken as a whole group, are not more exposed to cognitive fatigability during neuropsychological testing than controls. Subjective fatigue, objective fatigue, depression and anxiety seems quite independent to each others among minimally disabled MS patients. Subjective cognitive complaints among minimally disabled MS patients must lead to specific cognitive evaluation without regards to self reported fatigue. [less ▲]

Detailed reference viewed: 13 (3 ULg)
Peer Reviewed
See detailThe influence of encoding style on false memories
Dehon, Hedwige ULg; Laroi, Frank ULg; van der Linden, Martial

Poster (2009, September)

Detailed reference viewed: 20 (4 ULg)
Peer Reviewed
See detailRespuesta fenotípica de los mutantes tos de Arabidopsis thaliana
Cascales - Miñana, Borja ULg; Muñoz-Bertomeu, Jesús; Segura, Juan et al

Poster (2009, September)

Detailed reference viewed: 15 (0 ULg)
Peer Reviewed
See detailIL-4Ralpha responsive CD4+CD25−CD103+FoxP3− cells control Schistosoma mansoni egg-induced inflammation by secreted IL-10
Dewals, Benjamin G ULg; Hoving, Jennifer C.; Leeto, Mosiuoa et al

Poster (2009, September)

IL-4Ralpha signalling drives Th2-type responses that mediate resistance to parasitic helminth infections. We generated a novel mouse model lacking IL-4Ralpha expression specifically on all T cells ... [more ▼]

IL-4Ralpha signalling drives Th2-type responses that mediate resistance to parasitic helminth infections. We generated a novel mouse model lacking IL-4Ralpha expression specifically on all T cells (iLckcreIl4ra−/lox) to investigate IL-4Ralpha-dependent T cell responses during Schistosoma mansoni egg-driven inflammation. These mice showed higher mortality during acute schistosomiasis compared with Il4ra−/lox controls and previously established CD4+ T cell specific IL-4Ralpha deficient mice (LckcreIl4ra−/lox). iLckcreIl4ra−/lox mice developed a liver restricted pathology associated with drastic reductions of both Th2/type 2 responses and alternative macrophage activation within the granulomas. Additionally, iLckcreIl4ra−/lox mice had (i) increased FoxP3+ Treg cell responses in the granulomas, which was explained by IL-4 mediated inhibition of FoxP3 induction, and (ii) reduction of antigen-specific production of IL-10 by CD4+CD103+FoxP3− cells. In a footpad model of S. mansoni egg-induced inflammation with subsequent IL-10 neutralisation and adoptive cell transfer experiments we found evidence that the increased inflammation in iLckcreIl4ra−/lox mice was due to the impaired development of IL-10-secreting CD4+CD25−CD103+FoxP3− cells. Together, these data demonstrate that IL-4Ralpha responsiveness by T cells promote IL-10-secreting CD4+CD25−CD103+FoxP3− cells and alternatively activated macrophages, which act in concert to control egg-induced inflammation. [less ▲]

Detailed reference viewed: 53 (4 ULg)
Full Text
See detailCharacterization of the magnetic flux propagation in a drilled YBCO single‐crystal during a pulsed‐field excitation
Lousberg, Grégory ULg

Poster (2009, September)

Article associé : Pulsed-field magnetization of drilled bulk high-temperature superconductors: flux front propagation in the volume and on the surface

Detailed reference viewed: 16 (6 ULg)
Full Text
See detailParameterization and initialization of a soil organic matter decomposition model in an agricultural soil.
Buysse, Pauline ULg; Le Dantec, Valérie; Mordelet, Patrick et al

Poster (2009, September)

Organic matter decomposition and associated heterotrophic respiration fluxes are widely studied, as these processes could be modified under global warming. Many models have been built at different ... [more ▼]

Organic matter decomposition and associated heterotrophic respiration fluxes are widely studied, as these processes could be modified under global warming. Many models have been built at different temporal and spatial scales to contribute to a better understanding of the mechanisms involved and to quantify soil carbon fluxes. Yet, agroecosystems have been less investigated so far, despite their considerable importance. In this study, a daily-time step ecosystem model derived from CENTURY is described, parameterized and initialized for the Carboeurope agricultural site of Lonzée in Belgium. At this stage, the model aims at describing soil heterotrophic respiration and carbon dynamics in the soil. Model parameterization was performed on the basis of a literature survey (biochemical parameters) and of data collected at the site itself (soil carbon content and soil texture). In order to set up the carbon repartition between the different pools of the model, an initialization phase was run until equilibrium was reached. For this phase, mean daily climatic data were used and the soil was cultivated with winter wheat, considering that all residues were brought to the soil at harvest. At the end, the repartition was found to be independent from the simulated soil carbon content. Simulations showed a very high sensitivity of the model to the amount of incorporated residues and allowed an estimation of the amount of residues that lead the soil to a stable state. It was compatible with field observations. The model was then run with 2007 climatic data and the above-mentioned carbon repartition to simulate heterotrophic respiration. A comparison between these simulated fluxes and automatic measurements of soil respiration, performed during a 3-month period in spring 2007 on a bare zone of the field, showed a reasonable good agreement. Most of the discrepancies between measured and simulated fluxes corresponded to dry events, attesting of a need to reconsider the relationship between soil heterotrophic respiration and soil moisture in the model. To go further with the assessment of the model reliability, a calibration on data from the French Carboeurope site of Lamasquère will be achieved. Other sites may also be used. This heterotrophic soil respiration model is intended to be part of a more complete soil respiration model focused on agroecosystems and developed at the annual and ecosystem scales. In the end, autotrophic respiration, nitrogen mineralization and crop management would also be included. [less ▲]

Detailed reference viewed: 93 (4 ULg)
See detailPepLook Scale-Up Prediction of protein structures
Crowet, Jean-Marc ULg; Lins, Laurence ULg; Brasseur, Robert ULg

Poster (2009, August 27)

Besides experimental approaches for peptide structures determination which results often differ with assay conditions, there is, to our knowledge, only three in silico methods available for the prediction ... [more ▼]

Besides experimental approaches for peptide structures determination which results often differ with assay conditions, there is, to our knowledge, only three in silico methods available for the prediction of peptide structures: Pepstruct, Rosetta and PepLook. The latter was developed by the CBMN (1, 2) based on the fact that any protein PDB model can be re-constructed in silico using a restricted subset of φψ couples of angles (3). As PepLook was able to predict conformation of peptides and protein fragments, like cell penetrating peptides (CPPs) (1) and the hydrophobic segment of DGKє (4) with good accuracy, we are testing whether PepLook could be used for the prediction of complete protein structures. To reach this goal, PepLook is used to predict the conformation of peptidic fragments along the protein sequences. The sequence is scanned with different sizes of windows shifted along the sequence from the first to the last residue. For each sequence window, the 99 PepLook models of structure are analysed and compared to the PDB model. PepLook scans are running for five proteins, α-synuclein (1XQ8), a Zinc endoprotease (1C7K), Ubiquitin (1UBQ), Cytochrome b562 (256B) and Lysozyme (3LZT, 1AM7), using different window lengths (7, 9, 11, 15, 17, 21, 23 and 27 residues) by sliding steps of 1 residue. Since this approach requires huge calculation time, we present here the preliminary results. [less ▲]

Detailed reference viewed: 16 (0 ULg)
Full Text
Peer Reviewed
See detailTriangle Inequality Violation Avoidance in Internet Coordinate Systems
Liao, Yongjun ULg; Leduc, Guy ULg

Poster (2009, August 24)

Detailed reference viewed: 90 (15 ULg)
See detailRecurrent Energization of Plasma in the Midnight-to-Dawn Quadrant of Saturn's Magnetosphere, and its Relationship to Auroral UV and Radio Emissions
Mitchell, D.; Krimigis, S.; Paranicas, C. et al

Poster (2009, August 11)

Detailed reference viewed: 8 (1 ULg)
Full Text
See detailBLUESEL - an INTERREG France-Wallonie-Vlaanderen project aiming at the conservation and the use of the genetic heritage of the dual-purpose Blue Breeds in Belgium and Northern France
Colinet, Frédéric ULg

Poster (2009, August)

Dual-purpose Belgian Blue and North Blue cattle are mainly located on both sides of the border between France and Belgium. Even if these Belgian and French Blue breeds are related because of their common ... [more ▼]

Dual-purpose Belgian Blue and North Blue cattle are mainly located on both sides of the border between France and Belgium. Even if these Belgian and French Blue breeds are related because of their common ancestors in the former Mid and High Belgium cattle, these breeds diverged slightly under differentiated selection objectives in both countries. Within the BLUESEL project, a first aim consists to create a working group cross-border which will develop common guidelines for selection of bull dams and elite-matings for this dual-purpose Blue Breeds. This working group will create and help to conserve a common pool of bulls available for breeding in both countries. The project will also develop tools to harmonize the collection of phenotypic data (milk production and morphology). A joint genetic evaluation for production traits will be developed, adapted to the specifities of these breeds and integrating data provided by both countries. Others objectives of BLUESEL are the implementation of a technical and economical guidance of these farms and the improvement of profitability of farms through advice on management and on improvement of livestock. The valorisation of these breeds through the development of new and specific products (e.g. cheese products) is another objective. In summary, the whole project should contribute maintaining biodiversity in this cross-border region through conservation and use of animals naturally adapted. The BLUESEL project was launched in July 2008. It is conceived for four years and is supported by the European Union, the Walloon Region, the Nord-Pas-de Calais Region and the General Council of Department of Nord. [less ▲]

Detailed reference viewed: 17 (5 ULg)
Full Text
Peer Reviewed
See detailRefining the taxonomy of the Rattini tribe: a phylogeny-based delimitation of species boundaries
Pagès, Marie ULg; Chaval, Yannick; Waengsothorn, Surachit et al

Poster (2009, August)

Among mammals, rodents are recognized as the major hosts and vectors of zoonoses and represent a serious threat for human health. Because of global change, interactions between hosts and pathogens are ... [more ▼]

Among mammals, rodents are recognized as the major hosts and vectors of zoonoses and represent a serious threat for human health. Because of global change, interactions between hosts and pathogens are dramatically modified leading to new unexpected disease risks. To predict some of these, accurate identification of each rodent at specific level is needed. Among Muridae, the Rattini tribe encompasses 167 species inhabiting South East Asia, a hotspot of biodiversity facing with a growing economical development, affecting habitats, biodiversity and health but also a hot place of emerging and re-emerging diseases. Rat species were demonstrated as main hosts of pathogens but are difficult to recognize at a specific level using morphological criteria. DNA-barcoding methods appear as promising tools for accurate rat species identifications but their achievement is hampered by the need of reliable identifications as a departure. To provide a rigorous systematic framework for epidemiological surveys, we carried out a taxonomic revision of the Rattini tribe. As morphological characters are misleading, we decided to use the DNA sequence information itself as the primary information source to establish group membership and define species boundaries. We sequenced two mitochondrial and one nuclear genes from 122 rat samples to perform phylogenetic reconstructions and applied the method developed by Pons and colleagues (2006) that determines with no a priori the locations of ancestral nodes defining putative species. To name each cluster recognized as a valid species, we obtained sequence from museum holotype specimen, illustrating how huge opportunities ancient DNA analysis may offer to taxonomists. [less ▲]

Detailed reference viewed: 17 (3 ULg)
Full Text
Peer Reviewed
See detailInnovative development and validation of an HPLC/DAD method for the qualitative and quantitative determination of major cannabinoïds in cannabis plant material
De Backer, Benjamin ULg; Debrus, Benjamin ULg; Lebrun, Pierre ULg et al

Poster (2009, August)

GC is commonly used for the analysis of cannabis samples, e.g. in forensic chemistry. However, as this method is based on heating of the sample, acidic forms of cannabinoids are decarboxylated into their ... [more ▼]

GC is commonly used for the analysis of cannabis samples, e.g. in forensic chemistry. However, as this method is based on heating of the sample, acidic forms of cannabinoids are decarboxylated into their neutral counterparts. Converely, HPLC permits the determination of the original composition of plant cannabinoids by direct analysis. Several HPLC methods have been described in the literature, but most of them failed to separate efficiently all the cannabinoids or were not validated according to general guidelines. By use of an innovative methodology for modelling chromatographic responses, a simple and accurate HPLC/DAD method was develop [less ▲]

Detailed reference viewed: 214 (64 ULg)
Peer Reviewed
See detailMolecular detection of kobuviruses and recombinant noroviruses in cattle in continental europe
Mauroy, Axel ULg; Scipioni, Alexandra; Mathijs, Elisabeth et al

Poster (2009, August)

Introduction and Objectives Noroviruses (NoV) and Kobuviruses (KoV), belong to the family Caliciviridae genus Norovirus and to the family Picornaviridae genus Kobuvirus respectively. Both have a single ... [more ▼]

Introduction and Objectives Noroviruses (NoV) and Kobuviruses (KoV), belong to the family Caliciviridae genus Norovirus and to the family Picornaviridae genus Kobuvirus respectively. Both have a single stranded positive-sense RNA genome. They both infect the gastrointestinal tract of different animal species including human beings. Two NoV and one KoV prototype strains have been already identified in the bovine (Bo) species: Jena virus (JV) and Newbury 2 (NB2) for BoNoV; U1 for BoKoV. Genogroup (G) III gathers all BoNoV strains and is further subdivided into two genotypes where viruses genetically related to JV and NB2 are assigned to the genotype 1 and 2 respectively. Recombination is a common event in NoV and is usually reported near the overlapping region between open reading frame (ORF) 1 (end of the polymerase gene) and ORF2 (beginning of the single capsid protein gene). Two GIII.1/GIII.2 BoNoV recombinant strains have been described including the recombinant strain Bo/NoV/Thirsk10/00/UK (Thirsk10), identified in the year 2000 in Great Britain. To our knowledge, no other genetically related strains have been reported since [1]. Bovine KoV were detected by RT-PCR in stool samples of healthy calves from Japan, in samples from diarrhoeic calves from Thailand [2] and were also identified very recently in Hungary. Bovine NoV prevalence studies performed in different areas have shown the predominance of the GIII.2 genotype but this could reflect a GIII.1 specificity failure in the RT-PCR methods. The aim of this study was to screen cattle stool samples with two primer sets targeting the polymerase and the capsid region. The primer pair targeting the capsid region was designed based on a GIII.1 sequence in order to improve their detection. Materials and methods A stool bank (n=300) was created with calf and young stock diarrhoeic samples from five provinces in Belgium (Hainaut, Liège, Namur, Luxembourg, Walloon Brabant) and received from a Belgian diagnostic laboratory through the year 2008. Viral RNA extraction was performed and one step RT-PCR was carried out on 2 µl of each viral RNA extraction using the CBECu-F/R primers (nucleotidic position on JV: 4543-4565 and 5051-5074) and a primer pair, named AMG1-F/R, designed from the JV genomic sequence (F: tgtgggaaggtagtcgcgaca, nucleotidic position on JV: 5012-5032; R: cacatgggggaactgagtggc, 5462-5482). Combined approaches with the CBECu-F and AMG1-R primers, additional internal primers (F2: atgatgccagaggtttcca, position on JV: 4727-4745; R2: gcaaaaatccatgggtcaat, 5193-5211) or CBECu-F and a polyTVN-linker were also carried out on some positive samples. RT-PCR products were directly sequenced twice or cloned before sequencing. Sequencing was carried out at the GIGA facilities of the University of Liège with BigDye terminator kit. Nucleotidic sequences were analysed with the BioEdit software. Nucleotidic similarity with the NCBI genetic database was assessed using the BLAST tool. Phylogenetic inference was performed with the MEGA software. Phylogenetic tree was constructed by neighbour-joining analysis where evolutionary distances were computed using the Maximum Composite Likelihood method. The confidence values of the internal nodes were calculated by performing 1,000 replicate bootstrap values. Genetic recombination was analysed with the Simplot software and the Recombinant Detection Program. Results Twenty-eight positive samples were identified in the 300 samples: 24 and 23 BoNoV sequences with the CBECu and AMG1 primer pairs respectively, giving a combined apparent molecular prevalence of 9.33% (CI 95%: [9.27; 9.38%]). Using BLAST, three sequences amplified with CBECu-F/R (BV164, BV362, and BV416) were genetically more related to the GIII.1 JV and Aba Z5/02/HUN sequences and one (BV168) to the recombinant strain Thirsk10. The others were genetically related to GIII.2 BoNoV. All the sequences amplified with AMG1-F/R but one genetically matched with GIII.2 BoNoV. The AMG1-amplicon of the BV416 sample matched with the recombinant strain Thirsk10. A 2410 nucleotide (nt)-large genomic sequence was obtained from BV416 with CBECu-F/TVN linker, which was a recombinant sequence genetically related to the Thirsk10 strain. This result was confirmed by phylogenetic and by Simplot analysis. The potential recombination breakpoint of BV416 was located near or within the ORF1/ORF2 overlapping region depending on the bioinformatic program used. Comparison between its different genomic regions and the JV, Newbury2 and Thirsk10 genomic sequences showed that the polymerase region of BV416 was genetically more related to the GIII.1 than to the recombinant strain. F2/R2 amplicons from BV164 and BV362 were genetically related to GIII.2 and GIII.1 BoNoV respectively. Surprisingly, three amplicons obtained with the combined primer pair CBECu-F/AMG1-R on BoNoV positive samples at the expected molecular weight did not match genetically with BoNoV but did so with different genomic regions of the BoKoV U1 strain (86%, 92% and 93% of nucleotidic identity by BLAST for BV228, 250 and 253 respectively on sequences of about 500-700 nt). Discussion and conclusions In this study, very few genotype 1 BoNoV were identified (BV362 was the sole GIII.1 sequence obtained in the ORF1/2 overlapping region), confirming results reported in a previous study on BoNoV infection in the same area [3]. A recombinant status was clarified for BV416. Co-infection with GIII.1 and GIII.2 BoNoV was evidenced in the BV164 sample but could not be excluded in the BV168 sample because an overlapping sequence could not be obtained, although genetic analyses related its CBECu-F/R sequence to the Thirsk10 sequence. These results raise issues about the genetic characterization by primers targeting either the polymerase region or the capsid region. By exclusion of the potential recombination breakpoint, these primers can lead to the misclassification of strains and to the underestimation of circulation of recombinant strains. Multiple alignment and bioinformatic analysis performed with JV, Aba Z5, NB2, Thirk10 and BV416 sequences has suggested a recombination breakpoint for BV416 located near the ORF1/ORF2 overlapping region and one quite similar to those determined for the Thirsk10 strain. Nevertheless the greater similarity of BV416 with the Jena and Aba Z5 viruses in the polymerase region and the exact localization of the recombination breakpoint suggest another origin or genetic evolution than the Thirsk10 strain. The identification, in geographically and temporally different samples, of sequences that could be genetically related to the recombinant Thirsk10 strain suggests at least that Thirsk10-related strains circulate in the north European cattle population. Furthermore, the low detection rate of GIII.1 BoNoV could reflect an evolution of the viral population pattern to the benefit of the Thirsk10-related and genotype 2 strains in the studied region. To date, BoKoV-related sequences have been very rarely identified, and in only three countries (namely Japan, Thailand and Hungary). Their detection in another European country suggests their wider distribution, making them at least emerging bovine viruses in the studied region. In conclusion, prevalence studies on BoNoV using RT-PCR assays, even targeting relatively well conserved genomic regions, need to take into account in their protocols both their high genetic variability and their relative genetic proximity with other viruses, in order to maximize sensitivity and specificity. This study also showed that recombination events could lead to emerging strains in the BoNoV population, as already found for HuNoV. The molecular detection of bovine kobuvirus-related sequences in the studied area extends the distribution of these viruses in Europe. [less ▲]

Detailed reference viewed: 42 (0 ULg)
See detailA search for rotational and pulsational variability in three HgMn stars
Briquet, Maryline ULg; Gonzalez, F.; Korhonen, H. et al

Poster (2009, August)

Detailed reference viewed: 6 (1 ULg)
Full Text
See detailIntraspecific biodiversity in South East asian rodents: new insights for their conservation
Latinne, Alice ULg; Rivière, Taiana; Pagès, Marie ULg et al

Poster (2009, August)

Detailed reference viewed: 11 (1 ULg)
Full Text
Peer Reviewed
See detailLiquid load point measurement in a reactive distillation packing by x-ray tomography
Aferka, Saïd ULg; Viva, Aurora ULg; Brunazzi, Elisabetta et al

Poster (2009, August)

Detailed reference viewed: 56 (11 ULg)
Full Text
See detailHiggs Exclusive Production
Dechambre, Alice ULg

Poster (2009, August)

Detailed reference viewed: 14 (2 ULg)
See detailObservations of jovian polar auroral filaments
Nichols; Clarke; Gérard et al

Poster (2009, July 27)

Detailed reference viewed: 3 (0 ULg)
Full Text
See detailExploring the Holocene through fossil cyanobacterial sequences from Antarctic lake sediments.
Fernandez Carazo, Rafael ULg; Waleron, Krzysztof; Hodgson, Dominic et al

Poster (2009, July 27)

Detailed reference viewed: 9 (0 ULg)
Full Text
See detailBaseline data on cyanobacterial diversity near the new Princess Elizabeth Antarctic research station.
Fernandez Carazo, Rafael ULg; Namsaraev, Zorigto; Ertz, Damien et al

Poster (2009, July 27)

Detailed reference viewed: 14 (5 ULg)
Full Text
See detailEnzymatic modifications of sugar in supercritical carbon dioxide
Favrelle, Audrey ULg; Brognaux, Alison ULg; Debuigne, Antoine ULg et al

Poster (2009, July 07)

Carbohydrates esters are non-ionic surfactants that have a wide range of commercial applications in cosmetic, food and pharmaceutical industry. They are produced from renewable and inexpensive raw ... [more ▼]

Carbohydrates esters are non-ionic surfactants that have a wide range of commercial applications in cosmetic, food and pharmaceutical industry. They are produced from renewable and inexpensive raw materials, are bio-degradable and non-toxic. Chemical synthesis of sugar esters is generally performed at a high temperature in the presence of an alkaline catalyst lead-ing to a mixture of products. In this respect, the corresponding enzyme-catalyzed processes in non-conventional media are more selective. For this purpose, lipases are the most useful enzymes. Moreover, supercritical carbon dioxide (SC-CO2) constitutes an interesting alternative to the organic solvents used in the domain as it is considered to be environmentally frien-dlier and safer. For example, its use reduces the contamination of the final products with residual solvents. This property is particularly valued in food, cosmetic and pharmaceutical industry. Our work consists to carry out lipase catalyzed sugar modifications in SC-CO2 and to compare the results with those obtained in organic solvents. The effect of these two different media on the enzyme stability and the yield will be described here. Moreover, the impact of various factors such as pressure, temperature, enzyme form (free or immobilized), use of co-solvent, on the course of the sugar esterification will be discussed. [less ▲]

Detailed reference viewed: 161 (36 ULg)
Full Text
See detailTemperature Adaptation of Proteins: Stability, Folding and Flexibility in Mesophilic-like Engineered Alpha-Amylases
Cipolla, Alexandre ULg; D'Amico, Salvino ULg; Feller, Georges ULg

Poster (2009, July 02)

Habitats of permanently cold temperature, like polar regions for example, have been colonized by a great variety of psychrophilic organisms producing enzymes adapted to function efficiently in these cold ... [more ▼]

Habitats of permanently cold temperature, like polar regions for example, have been colonized by a great variety of psychrophilic organisms producing enzymes adapted to function efficiently in these cold environments. According to the hypothesis developed in our laboratory, the adaptation to cold temperature involves relationships between activity, flexibility and stability. Even if activity and stability are not physically linked in proteins 1, the consensus for the adaptive strategy is to take advantage of the lack of selective pressure for stable proteins to lose stability, therefore increasing the flexibility or mobility of the enzyme at low temperatures that restrict molecular motions. 2 Working on alpha-amylase, we have investigated the role of weak interactions in thermal adaptation of proteins by site-directed mutagenesis. We have built two multiple-mutants (Mut5 and Mut5CC) of the psychrophilc alpha-amylase (AHA) from the Antarctic bacterium, Pseudoalteromonas haloplanktis. The single mutations were selected by comparison of the presence of weak interactions in a mesophilic chloride-dependant homolog from pig pancreas, PPA. The study of selected single mutations prompt us to construct two multiple-mutants, Mut5 and Mut5CC, carrying 5 and 6 additional weak interactions found in PPA, that showed an increased stability and a lower activity at 25 °C.3 We have compared AHA, Mut5 and Mut5CC with additional methods like differential scanning calorimetry, thermal and chemical unfolding and circular dichroism in order to determine the gain in stability. We also studied the flexibility or breathing of the enzymes by acrylamide-induced fluorescence quenching. The newly introduced weak interactions stabilized the proteins, protected them against heat and chemical unfolding and also induced an effective loss of flexibility. These results and those of the previous work 3, unambiguously support the capital role of weak interactions in the balance between activity, flexibility and stability and provide a better knowledge of the adaptation of enzymes to cold temperatures. [less ▲]

Detailed reference viewed: 28 (3 ULg)
Full Text
Peer Reviewed
See detailBehavior of omega-3 fatty acids in eggs during cooking
Douny, Caroline ULg; El Khoury, Rawad ULg; Degand et al

Poster (2009, July 01)

Detailed reference viewed: 38 (11 ULg)
Full Text
See detailVHHs as model proteins to investigate amyloid fibril formation
Chavignon, Chloé ULg; Pardon, Els; Wyns, Lode et al

Poster (2009, July)

The term "amyloidosis" covers up a group of diseases associated with deposition in different organs of protein aggregates organized into amyloid fibrils. About twenty-five amyloidosis are known so far ... [more ▼]

The term "amyloidosis" covers up a group of diseases associated with deposition in different organs of protein aggregates organized into amyloid fibrils. About twenty-five amyloidosis are known so far, amongst which Alzheimer's disease, type II diabetes and immunoglobulin amyloidosis [1]. Although the mechanism of amyloid fibrils formation at the molecular level is not yet completely understood, it has been shown that the capacity to form amyloid fibrils in vitro is an intrinsic property of all polypeptide chains [1]. The choice of model proteins to investigate the aggregation process in vitro is therefore no more restrained to proteins involved in amyloidosis but can be settled on a wide variety of proteins. In this study, we have chosen two variable domains of camelid heavy-chain antibodies (referred to as VHHs or nanobodies), cAb-HuL6 and cAb-BcII10, and this choice was motivated by the following reasons: - First, they are small monomeric domains (~14 kDa) presenting high stability and high solubility [2], which permits their expression with a high yield (20-40 mg.L-1). - Second, a wide range of stable mutants of these two VHHs is available. Mutations located at the disulfide bond [3,4], the CDRs [3] and the framework have been introduced. Characterisation of the aggregating properties of these mutants will allow the investigation of the impact of these structural elements on the process of fibril formation. In order to determine conditions in which cAb-HuL6 and cAb-BcII10 are more susceptible to form intermediates and thus amyloid fibrils, heat induced infolding experiments at pHs comprised in a range from 2,5 to 9,5 have been monitored by intrinsic fluorescence, ANS binding and circular dichroism. Then, aggregation experiments have been performed in the selected conditions and the presence of amyloid fibrils has been acknowledged by thioflavineT fluorescence experiments and electronic microscopy. [1] Chiti, F. and Dobson, C. M., Protein misfolding, functional amyloid, and human disease, Annu. Rev. Biochem., 75, 2006, 333-366. [2] Dumoulin, M., Conrath, K., Van Meirhaeghe, A., Meersman, F., Heremans, K., Frenken, L. G., Muyldermans, S., Wyns, L. & Matagne, A., Single-domain antibody fragments with high conformational stability, Protein Sci., 11, 2002, 500-515. [3] Saerens, D., Pellis, M., Loris, R., Pardon, E., Dumoulin, M., Matagne, A., Wyns, L., Muyldermans, S., Conrath, K., Identification of a universal VHH framework to graft non-canonical antigen-binding loops of camel single-domain antibodies, J. Mol. Biol., 352, 2005, 597-607. [4] Saerens D., Conrath K., Govaert J., Muyldermans S., Disulfide bond introduction for general stabilization of immunoglobulin heavy-chain variable domains, J Mol Biol., 377, 2008, 478-488. [less ▲]

Detailed reference viewed: 33 (6 ULg)
Peer Reviewed
See detailFinding miRNAs able to regulate angiogenesis
Pendeville, Helene; Nivelles, Olivier ULg; Malvaux, L. et al

Poster (2009, July)

Detailed reference viewed: 5 (0 ULg)
Peer Reviewed
See detailPerceived logistics service quality driven store Loyalty
Hammedi, Wafa ULg; Van Riel, Allard ULg; Semeijn, Janjaap

Poster (2009, July)

Detailed reference viewed: 98 (12 ULg)
See detailPyropheophorbide-a-methyl ester: DMPC liposome vectorization and biophysical properties for PDT
Guelluy, Pierre-Henri ULg; Fontaine-Aupart, Marie-Pierre; Grammenos, Angeliki ULg et al

Poster (2009, July)

Detailed reference viewed: 20 (4 ULg)
Full Text
Peer Reviewed
See detailBedload progression in gravel bed rivers using iron slag as a tracer
Houbrechts, Geoffrey ULg; Levecq, Yannick; Mols, Julien et al

Poster (2009, July)

In fluvial dynamics studies, different methods are used to evaluate bedload transport and particle travel lengths. However, results are mostly based on a few transported elements and on a relatively short ... [more ▼]

In fluvial dynamics studies, different methods are used to evaluate bedload transport and particle travel lengths. However, results are mostly based on a few transported elements and on a relatively short time scale. Consequently, it is difficult to extrapolate these results to whole bedload, because of the burying of particles into the subsurface layer or the trapping of elements in fluvial forms (point bars, riffles, …), which can immobilise elements during long periods. Bedload progression has been evaluated in Ardenne rivers using slag elements produced by the past factories established along rivers between the 14th and the 19th centuries. Important quantities of slag were dumped close to rivers or even directly into channels. For several centuries, slag elements were dispersed in the bedload and transported by floods of varying importance. Consequently, slag can be considered as a tracer to analyze bedload progression over several centuries. The size of slag elements has been studied in many Ardenne rivers. The longitudinal size trend of the largest slag particles allows us to determine the effective competence of rivers and to analyze the hydraulic sorting. Moreover, downstream of some metallurgic sites, we have constrained the presence of slag elements to the most downstream riffles. Because we know from historical studies the periods of activities of these sites, we may estimate the speed of bedload progression in several gravel bed rivers from the Ardenne Massif (2-3 km/century). [less ▲]

Detailed reference viewed: 8 (0 ULg)
Full Text
Peer Reviewed
See detailEvolution of floodplain sedimentation during the last millennia in the Ardenne Massif (Belgium)
Houbrechts, Geoffrey ULg; Notebaert, Bastiaan; Verstraeten, Gert et al

Poster (2009, July)

In the Ardenne massif, several periods of increased sediment deposition have been identified during the last millennia. They can be correlated to increasing anthropogenic land use pressure. The majority ... [more ▼]

In the Ardenne massif, several periods of increased sediment deposition have been identified during the last millennia. They can be correlated to increasing anthropogenic land use pressure. The majority of the sediments found in floodplains were deposited in the last 4000 years, and in many cases even in the last 1000 years. In the Amblève catchment, the first increase in sediment deposition of the Holocene occurred during the Bronze Age (3200 BP), related to first deforestations and crop cultures in the area. Several organic depositions have occurred between 2700 BP and 1000 BP and probably indicate low anthropogenic pressures or more humid periods. From the 11th century onwards, there was an increase in sedimentation, and alluvial deposits contain more charcoal. A second important increase in sedimentation is observed in headwater catchments at the end of the 14th century, which can be related to the development of many iron factories. In the Ardenne massif, more than 300 iron factories existed between the 14th and the 19th century and about 20 ha of forest were cleared each year for the consumption of a refining forge or a blast furnace. Analysis of slag concentration produced in former factories and redistributed in the floodplain allows us to reconstruct the evolution of floodplains since the inception of the iron industries. The results show that not all floodplains in the Amblève catchment are equally sensitive to catchment disturbances. In the headwater stream (Chavanne river, 10-20 km²), about 80 cm of sediment has been deposited since the inception of the iron industries (towards 1540 AD). In the lower Lienne valley (100-150 km²), almost no sediment accumulation occurred in the floodplains after the beginning of iron melting (towards 1400 AD). This difference could be explained by the larger stream power of the Lienne river (100-120 W/m2 for Qb). [less ▲]

Detailed reference viewed: 7 (1 ULg)
Full Text
See detailMeasure of nursing time interventions for hospitalized elderly patients
THONON, Olivier ULg; GILLAIN, Daniel ULg; SERMEUS, Walter et al

Poster (2009, July)

Detailed reference viewed: 16 (2 ULg)
Peer Reviewed
See detailEvolution of blood myeloperoxidase in the perioperative period of horses undergoing emergency celiotomy.
Salciccia, Alexandra ULg; Grulke, Sigrid ULg; de la Rebière de Pouyade, Geoffroy ULg et al

Poster (2009, July)

Colic can cause an activation of neutrophils with release in the blood flow of myeloperoxidase (MPO), a specific enzyme with strong oxidative activity. The aim of this study was to describe the evolution ... [more ▼]

Colic can cause an activation of neutrophils with release in the blood flow of myeloperoxidase (MPO), a specific enzyme with strong oxidative activity. The aim of this study was to describe the evolution of plasma MPO after colic surgery. Materials included 13 adult horses that underwent an emergency celiotomy for acute intestinal obstruction. Venous blood samples were collected into EDTA anticoagulated tubes before surgery, during surgery after correction of the intestinal lesion and during the recovery of anaesthesia. In the postoperative period samples were taken every 4 hours during the first 4 days (from day 0 until day 4), every 12 hours during the days 4 and 5 and every 24 hours until day 10. MPO was assayed with a specific enzyme-linked immunosorbent assay. Statistical analysis was performed by one way Anova with student- Newman-Keuls post test on data obtained for each time point. Significance was set at p < 0.05. The horses were operated for an obstruction strangulated or not of the small or the large intestine. In six cases the postoperative period was uneventful, the 7 remaining developed one or 2 severe complications. Eight horses were discharged and 5 died during the hospitalization.The general aspect of the curve of mean plasmatic MPO can be described as follow: An increase was observed from the admission on until a peak of concentration occurring generally during the time of recovery from the anaesthesia with the highest mean value reaching 740.84 +/- 507.61ng/ml. This was followed by a progressive decrease until the lowest value, usually near to day 2 after the recovery from anaesthesia corresponding to 171.79 +/- 76.21 ng/ml of MPO. Afterwards, the mean concentrations increased slowly until postoperative day 10. In the majority of cases a stable and low MPO value (plateau) was observed during approximately 2 days (from day 1 to day 3 postoperatively).The initial peak of MPO after surgery could be associated to the neutrophil activation consequent to the intestinal disorder and the intense stimulation of the coeliotomy. The following significant reduction in concentration could be attributed to MPO infiltration into the tissues with a critical point at approximately 2 days after surgery. This study may contribute to a better understanding of the role of the MPO and neutrophils in the pathophysiology of horses in the postoperative period after colic surgery. [less ▲]

Detailed reference viewed: 25 (3 ULg)