References of "Poster"
     in
Bookmark and Share    
Full Text
See detailCharacterization of the magnetic flux propagation in a drilled YBCO single‐crystal during a pulsed‐field excitation
Lousberg, Grégory ULg

Poster (2009, September)

Article associé : Pulsed-field magnetization of drilled bulk high-temperature superconductors: flux front propagation in the volume and on the surface

Detailed reference viewed: 15 (6 ULg)
Full Text
See detailParameterization and initialization of a soil organic matter decomposition model in an agricultural soil.
Buysse, Pauline ULg; Le Dantec, Valérie; Mordelet, Patrick et al

Poster (2009, September)

Organic matter decomposition and associated heterotrophic respiration fluxes are widely studied, as these processes could be modified under global warming. Many models have been built at different ... [more ▼]

Organic matter decomposition and associated heterotrophic respiration fluxes are widely studied, as these processes could be modified under global warming. Many models have been built at different temporal and spatial scales to contribute to a better understanding of the mechanisms involved and to quantify soil carbon fluxes. Yet, agroecosystems have been less investigated so far, despite their considerable importance. In this study, a daily-time step ecosystem model derived from CENTURY is described, parameterized and initialized for the Carboeurope agricultural site of Lonzée in Belgium. At this stage, the model aims at describing soil heterotrophic respiration and carbon dynamics in the soil. Model parameterization was performed on the basis of a literature survey (biochemical parameters) and of data collected at the site itself (soil carbon content and soil texture). In order to set up the carbon repartition between the different pools of the model, an initialization phase was run until equilibrium was reached. For this phase, mean daily climatic data were used and the soil was cultivated with winter wheat, considering that all residues were brought to the soil at harvest. At the end, the repartition was found to be independent from the simulated soil carbon content. Simulations showed a very high sensitivity of the model to the amount of incorporated residues and allowed an estimation of the amount of residues that lead the soil to a stable state. It was compatible with field observations. The model was then run with 2007 climatic data and the above-mentioned carbon repartition to simulate heterotrophic respiration. A comparison between these simulated fluxes and automatic measurements of soil respiration, performed during a 3-month period in spring 2007 on a bare zone of the field, showed a reasonable good agreement. Most of the discrepancies between measured and simulated fluxes corresponded to dry events, attesting of a need to reconsider the relationship between soil heterotrophic respiration and soil moisture in the model. To go further with the assessment of the model reliability, a calibration on data from the French Carboeurope site of Lamasquère will be achieved. Other sites may also be used. This heterotrophic soil respiration model is intended to be part of a more complete soil respiration model focused on agroecosystems and developed at the annual and ecosystem scales. In the end, autotrophic respiration, nitrogen mineralization and crop management would also be included. [less ▲]

Detailed reference viewed: 93 (4 ULg)
See detailPepLook Scale-Up Prediction of protein structures
Crowet, Jean-Marc ULg; Lins, Laurence ULg; Brasseur, Robert ULg

Poster (2009, August 27)

Besides experimental approaches for peptide structures determination which results often differ with assay conditions, there is, to our knowledge, only three in silico methods available for the prediction ... [more ▼]

Besides experimental approaches for peptide structures determination which results often differ with assay conditions, there is, to our knowledge, only three in silico methods available for the prediction of peptide structures: Pepstruct, Rosetta and PepLook. The latter was developed by the CBMN (1, 2) based on the fact that any protein PDB model can be re-constructed in silico using a restricted subset of φψ couples of angles (3). As PepLook was able to predict conformation of peptides and protein fragments, like cell penetrating peptides (CPPs) (1) and the hydrophobic segment of DGKє (4) with good accuracy, we are testing whether PepLook could be used for the prediction of complete protein structures. To reach this goal, PepLook is used to predict the conformation of peptidic fragments along the protein sequences. The sequence is scanned with different sizes of windows shifted along the sequence from the first to the last residue. For each sequence window, the 99 PepLook models of structure are analysed and compared to the PDB model. PepLook scans are running for five proteins, α-synuclein (1XQ8), a Zinc endoprotease (1C7K), Ubiquitin (1UBQ), Cytochrome b562 (256B) and Lysozyme (3LZT, 1AM7), using different window lengths (7, 9, 11, 15, 17, 21, 23 and 27 residues) by sliding steps of 1 residue. Since this approach requires huge calculation time, we present here the preliminary results. [less ▲]

Detailed reference viewed: 15 (0 ULg)
Full Text
Peer Reviewed
See detailTriangle Inequality Violation Avoidance in Internet Coordinate Systems
Liao, Yongjun ULg; Leduc, Guy ULg

Poster (2009, August 24)

Detailed reference viewed: 90 (15 ULg)
See detailRecurrent Energization of Plasma in the Midnight-to-Dawn Quadrant of Saturn's Magnetosphere, and its Relationship to Auroral UV and Radio Emissions
Mitchell, D.; Krimigis, S.; Paranicas, C. et al

Poster (2009, August 11)

Detailed reference viewed: 7 (1 ULg)
Full Text
See detailBLUESEL - an INTERREG France-Wallonie-Vlaanderen project aiming at the conservation and the use of the genetic heritage of the dual-purpose Blue Breeds in Belgium and Northern France
Colinet, Frédéric ULg

Poster (2009, August)

Dual-purpose Belgian Blue and North Blue cattle are mainly located on both sides of the border between France and Belgium. Even if these Belgian and French Blue breeds are related because of their common ... [more ▼]

Dual-purpose Belgian Blue and North Blue cattle are mainly located on both sides of the border between France and Belgium. Even if these Belgian and French Blue breeds are related because of their common ancestors in the former Mid and High Belgium cattle, these breeds diverged slightly under differentiated selection objectives in both countries. Within the BLUESEL project, a first aim consists to create a working group cross-border which will develop common guidelines for selection of bull dams and elite-matings for this dual-purpose Blue Breeds. This working group will create and help to conserve a common pool of bulls available for breeding in both countries. The project will also develop tools to harmonize the collection of phenotypic data (milk production and morphology). A joint genetic evaluation for production traits will be developed, adapted to the specifities of these breeds and integrating data provided by both countries. Others objectives of BLUESEL are the implementation of a technical and economical guidance of these farms and the improvement of profitability of farms through advice on management and on improvement of livestock. The valorisation of these breeds through the development of new and specific products (e.g. cheese products) is another objective. In summary, the whole project should contribute maintaining biodiversity in this cross-border region through conservation and use of animals naturally adapted. The BLUESEL project was launched in July 2008. It is conceived for four years and is supported by the European Union, the Walloon Region, the Nord-Pas-de Calais Region and the General Council of Department of Nord. [less ▲]

Detailed reference viewed: 14 (4 ULg)
Full Text
Peer Reviewed
See detailRefining the taxonomy of the Rattini tribe: a phylogeny-based delimitation of species boundaries
Pagès, Marie ULg; Chaval, Yannick; Waengsothorn, Surachit et al

Poster (2009, August)

Among mammals, rodents are recognized as the major hosts and vectors of zoonoses and represent a serious threat for human health. Because of global change, interactions between hosts and pathogens are ... [more ▼]

Among mammals, rodents are recognized as the major hosts and vectors of zoonoses and represent a serious threat for human health. Because of global change, interactions between hosts and pathogens are dramatically modified leading to new unexpected disease risks. To predict some of these, accurate identification of each rodent at specific level is needed. Among Muridae, the Rattini tribe encompasses 167 species inhabiting South East Asia, a hotspot of biodiversity facing with a growing economical development, affecting habitats, biodiversity and health but also a hot place of emerging and re-emerging diseases. Rat species were demonstrated as main hosts of pathogens but are difficult to recognize at a specific level using morphological criteria. DNA-barcoding methods appear as promising tools for accurate rat species identifications but their achievement is hampered by the need of reliable identifications as a departure. To provide a rigorous systematic framework for epidemiological surveys, we carried out a taxonomic revision of the Rattini tribe. As morphological characters are misleading, we decided to use the DNA sequence information itself as the primary information source to establish group membership and define species boundaries. We sequenced two mitochondrial and one nuclear genes from 122 rat samples to perform phylogenetic reconstructions and applied the method developed by Pons and colleagues (2006) that determines with no a priori the locations of ancestral nodes defining putative species. To name each cluster recognized as a valid species, we obtained sequence from museum holotype specimen, illustrating how huge opportunities ancient DNA analysis may offer to taxonomists. [less ▲]

Detailed reference viewed: 17 (3 ULg)
Full Text
Peer Reviewed
See detailInnovative development and validation of an HPLC/DAD method for the qualitative and quantitative determination of major cannabinoïds in cannabis plant material
De Backer, Benjamin ULg; Debrus, Benjamin ULg; Lebrun, Pierre ULg et al

Poster (2009, August)

GC is commonly used for the analysis of cannabis samples, e.g. in forensic chemistry. However, as this method is based on heating of the sample, acidic forms of cannabinoids are decarboxylated into their ... [more ▼]

GC is commonly used for the analysis of cannabis samples, e.g. in forensic chemistry. However, as this method is based on heating of the sample, acidic forms of cannabinoids are decarboxylated into their neutral counterparts. Converely, HPLC permits the determination of the original composition of plant cannabinoids by direct analysis. Several HPLC methods have been described in the literature, but most of them failed to separate efficiently all the cannabinoids or were not validated according to general guidelines. By use of an innovative methodology for modelling chromatographic responses, a simple and accurate HPLC/DAD method was develop [less ▲]

Detailed reference viewed: 198 (64 ULg)
Peer Reviewed
See detailMolecular detection of kobuviruses and recombinant noroviruses in cattle in continental europe
Mauroy, Axel ULg; Scipioni, Alexandra; Mathijs, Elisabeth et al

Poster (2009, August)

Introduction and Objectives Noroviruses (NoV) and Kobuviruses (KoV), belong to the family Caliciviridae genus Norovirus and to the family Picornaviridae genus Kobuvirus respectively. Both have a single ... [more ▼]

Introduction and Objectives Noroviruses (NoV) and Kobuviruses (KoV), belong to the family Caliciviridae genus Norovirus and to the family Picornaviridae genus Kobuvirus respectively. Both have a single stranded positive-sense RNA genome. They both infect the gastrointestinal tract of different animal species including human beings. Two NoV and one KoV prototype strains have been already identified in the bovine (Bo) species: Jena virus (JV) and Newbury 2 (NB2) for BoNoV; U1 for BoKoV. Genogroup (G) III gathers all BoNoV strains and is further subdivided into two genotypes where viruses genetically related to JV and NB2 are assigned to the genotype 1 and 2 respectively. Recombination is a common event in NoV and is usually reported near the overlapping region between open reading frame (ORF) 1 (end of the polymerase gene) and ORF2 (beginning of the single capsid protein gene). Two GIII.1/GIII.2 BoNoV recombinant strains have been described including the recombinant strain Bo/NoV/Thirsk10/00/UK (Thirsk10), identified in the year 2000 in Great Britain. To our knowledge, no other genetically related strains have been reported since [1]. Bovine KoV were detected by RT-PCR in stool samples of healthy calves from Japan, in samples from diarrhoeic calves from Thailand [2] and were also identified very recently in Hungary. Bovine NoV prevalence studies performed in different areas have shown the predominance of the GIII.2 genotype but this could reflect a GIII.1 specificity failure in the RT-PCR methods. The aim of this study was to screen cattle stool samples with two primer sets targeting the polymerase and the capsid region. The primer pair targeting the capsid region was designed based on a GIII.1 sequence in order to improve their detection. Materials and methods A stool bank (n=300) was created with calf and young stock diarrhoeic samples from five provinces in Belgium (Hainaut, Liège, Namur, Luxembourg, Walloon Brabant) and received from a Belgian diagnostic laboratory through the year 2008. Viral RNA extraction was performed and one step RT-PCR was carried out on 2 µl of each viral RNA extraction using the CBECu-F/R primers (nucleotidic position on JV: 4543-4565 and 5051-5074) and a primer pair, named AMG1-F/R, designed from the JV genomic sequence (F: tgtgggaaggtagtcgcgaca, nucleotidic position on JV: 5012-5032; R: cacatgggggaactgagtggc, 5462-5482). Combined approaches with the CBECu-F and AMG1-R primers, additional internal primers (F2: atgatgccagaggtttcca, position on JV: 4727-4745; R2: gcaaaaatccatgggtcaat, 5193-5211) or CBECu-F and a polyTVN-linker were also carried out on some positive samples. RT-PCR products were directly sequenced twice or cloned before sequencing. Sequencing was carried out at the GIGA facilities of the University of Liège with BigDye terminator kit. Nucleotidic sequences were analysed with the BioEdit software. Nucleotidic similarity with the NCBI genetic database was assessed using the BLAST tool. Phylogenetic inference was performed with the MEGA software. Phylogenetic tree was constructed by neighbour-joining analysis where evolutionary distances were computed using the Maximum Composite Likelihood method. The confidence values of the internal nodes were calculated by performing 1,000 replicate bootstrap values. Genetic recombination was analysed with the Simplot software and the Recombinant Detection Program. Results Twenty-eight positive samples were identified in the 300 samples: 24 and 23 BoNoV sequences with the CBECu and AMG1 primer pairs respectively, giving a combined apparent molecular prevalence of 9.33% (CI 95%: [9.27; 9.38%]). Using BLAST, three sequences amplified with CBECu-F/R (BV164, BV362, and BV416) were genetically more related to the GIII.1 JV and Aba Z5/02/HUN sequences and one (BV168) to the recombinant strain Thirsk10. The others were genetically related to GIII.2 BoNoV. All the sequences amplified with AMG1-F/R but one genetically matched with GIII.2 BoNoV. The AMG1-amplicon of the BV416 sample matched with the recombinant strain Thirsk10. A 2410 nucleotide (nt)-large genomic sequence was obtained from BV416 with CBECu-F/TVN linker, which was a recombinant sequence genetically related to the Thirsk10 strain. This result was confirmed by phylogenetic and by Simplot analysis. The potential recombination breakpoint of BV416 was located near or within the ORF1/ORF2 overlapping region depending on the bioinformatic program used. Comparison between its different genomic regions and the JV, Newbury2 and Thirsk10 genomic sequences showed that the polymerase region of BV416 was genetically more related to the GIII.1 than to the recombinant strain. F2/R2 amplicons from BV164 and BV362 were genetically related to GIII.2 and GIII.1 BoNoV respectively. Surprisingly, three amplicons obtained with the combined primer pair CBECu-F/AMG1-R on BoNoV positive samples at the expected molecular weight did not match genetically with BoNoV but did so with different genomic regions of the BoKoV U1 strain (86%, 92% and 93% of nucleotidic identity by BLAST for BV228, 250 and 253 respectively on sequences of about 500-700 nt). Discussion and conclusions In this study, very few genotype 1 BoNoV were identified (BV362 was the sole GIII.1 sequence obtained in the ORF1/2 overlapping region), confirming results reported in a previous study on BoNoV infection in the same area [3]. A recombinant status was clarified for BV416. Co-infection with GIII.1 and GIII.2 BoNoV was evidenced in the BV164 sample but could not be excluded in the BV168 sample because an overlapping sequence could not be obtained, although genetic analyses related its CBECu-F/R sequence to the Thirsk10 sequence. These results raise issues about the genetic characterization by primers targeting either the polymerase region or the capsid region. By exclusion of the potential recombination breakpoint, these primers can lead to the misclassification of strains and to the underestimation of circulation of recombinant strains. Multiple alignment and bioinformatic analysis performed with JV, Aba Z5, NB2, Thirk10 and BV416 sequences has suggested a recombination breakpoint for BV416 located near the ORF1/ORF2 overlapping region and one quite similar to those determined for the Thirsk10 strain. Nevertheless the greater similarity of BV416 with the Jena and Aba Z5 viruses in the polymerase region and the exact localization of the recombination breakpoint suggest another origin or genetic evolution than the Thirsk10 strain. The identification, in geographically and temporally different samples, of sequences that could be genetically related to the recombinant Thirsk10 strain suggests at least that Thirsk10-related strains circulate in the north European cattle population. Furthermore, the low detection rate of GIII.1 BoNoV could reflect an evolution of the viral population pattern to the benefit of the Thirsk10-related and genotype 2 strains in the studied region. To date, BoKoV-related sequences have been very rarely identified, and in only three countries (namely Japan, Thailand and Hungary). Their detection in another European country suggests their wider distribution, making them at least emerging bovine viruses in the studied region. In conclusion, prevalence studies on BoNoV using RT-PCR assays, even targeting relatively well conserved genomic regions, need to take into account in their protocols both their high genetic variability and their relative genetic proximity with other viruses, in order to maximize sensitivity and specificity. This study also showed that recombination events could lead to emerging strains in the BoNoV population, as already found for HuNoV. The molecular detection of bovine kobuvirus-related sequences in the studied area extends the distribution of these viruses in Europe. [less ▲]

Detailed reference viewed: 28 (0 ULg)
See detailA search for rotational and pulsational variability in three HgMn stars
Briquet, Maryline ULg; Gonzalez, F.; Korhonen, H. et al

Poster (2009, August)

Detailed reference viewed: 6 (1 ULg)
Full Text
See detailIntraspecific biodiversity in South East asian rodents: new insights for their conservation
Latinne, Alice ULg; Rivière, Taiana; Pagès, Marie ULg et al

Poster (2009, August)

Detailed reference viewed: 9 (1 ULg)
Full Text
Peer Reviewed
See detailLiquid load point measurement in a reactive distillation packing by x-ray tomography
Aferka, Saïd ULg; Viva, Aurora ULg; Brunazzi, Elisabetta et al

Poster (2009, August)

Detailed reference viewed: 54 (11 ULg)
Full Text
See detailHiggs Exclusive Production
Dechambre, Alice ULg

Poster (2009, August)

Detailed reference viewed: 10 (2 ULg)
See detailObservations of jovian polar auroral filaments
Nichols; Clarke; Gérard et al

Poster (2009, July 27)

Detailed reference viewed: 3 (0 ULg)
Full Text
See detailExploring the Holocene through fossil cyanobacterial sequences from Antarctic lake sediments.
Fernandez Carazo, Rafael ULg; Waleron, Krzysztof; Hodgson, Dominic et al

Poster (2009, July 27)

Detailed reference viewed: 9 (0 ULg)
Full Text
See detailBaseline data on cyanobacterial diversity near the new Princess Elizabeth Antarctic research station.
Fernandez Carazo, Rafael ULg; Namsaraev, Zorigto; Ertz, Damien et al

Poster (2009, July 27)

Detailed reference viewed: 14 (5 ULg)
Full Text
See detailEnzymatic modifications of sugar in supercritical carbon dioxide
Favrelle, Audrey ULg; Brognaux, Alison ULg; Debuigne, Antoine ULg et al

Poster (2009, July 07)

Carbohydrates esters are non-ionic surfactants that have a wide range of commercial applications in cosmetic, food and pharmaceutical industry. They are produced from renewable and inexpensive raw ... [more ▼]

Carbohydrates esters are non-ionic surfactants that have a wide range of commercial applications in cosmetic, food and pharmaceutical industry. They are produced from renewable and inexpensive raw materials, are bio-degradable and non-toxic. Chemical synthesis of sugar esters is generally performed at a high temperature in the presence of an alkaline catalyst lead-ing to a mixture of products. In this respect, the corresponding enzyme-catalyzed processes in non-conventional media are more selective. For this purpose, lipases are the most useful enzymes. Moreover, supercritical carbon dioxide (SC-CO2) constitutes an interesting alternative to the organic solvents used in the domain as it is considered to be environmentally frien-dlier and safer. For example, its use reduces the contamination of the final products with residual solvents. This property is particularly valued in food, cosmetic and pharmaceutical industry. Our work consists to carry out lipase catalyzed sugar modifications in SC-CO2 and to compare the results with those obtained in organic solvents. The effect of these two different media on the enzyme stability and the yield will be described here. Moreover, the impact of various factors such as pressure, temperature, enzyme form (free or immobilized), use of co-solvent, on the course of the sugar esterification will be discussed. [less ▲]

Detailed reference viewed: 136 (36 ULg)
Full Text
See detailTemperature Adaptation of Proteins: Stability, Folding and Flexibility in Mesophilic-like Engineered Alpha-Amylases
Cipolla, Alexandre ULg; D'Amico, Salvino ULg; Feller, Georges ULg

Poster (2009, July 02)

Habitats of permanently cold temperature, like polar regions for example, have been colonized by a great variety of psychrophilic organisms producing enzymes adapted to function efficiently in these cold ... [more ▼]

Habitats of permanently cold temperature, like polar regions for example, have been colonized by a great variety of psychrophilic organisms producing enzymes adapted to function efficiently in these cold environments. According to the hypothesis developed in our laboratory, the adaptation to cold temperature involves relationships between activity, flexibility and stability. Even if activity and stability are not physically linked in proteins 1, the consensus for the adaptive strategy is to take advantage of the lack of selective pressure for stable proteins to lose stability, therefore increasing the flexibility or mobility of the enzyme at low temperatures that restrict molecular motions. 2 Working on alpha-amylase, we have investigated the role of weak interactions in thermal adaptation of proteins by site-directed mutagenesis. We have built two multiple-mutants (Mut5 and Mut5CC) of the psychrophilc alpha-amylase (AHA) from the Antarctic bacterium, Pseudoalteromonas haloplanktis. The single mutations were selected by comparison of the presence of weak interactions in a mesophilic chloride-dependant homolog from pig pancreas, PPA. The study of selected single mutations prompt us to construct two multiple-mutants, Mut5 and Mut5CC, carrying 5 and 6 additional weak interactions found in PPA, that showed an increased stability and a lower activity at 25 °C.3 We have compared AHA, Mut5 and Mut5CC with additional methods like differential scanning calorimetry, thermal and chemical unfolding and circular dichroism in order to determine the gain in stability. We also studied the flexibility or breathing of the enzymes by acrylamide-induced fluorescence quenching. The newly introduced weak interactions stabilized the proteins, protected them against heat and chemical unfolding and also induced an effective loss of flexibility. These results and those of the previous work 3, unambiguously support the capital role of weak interactions in the balance between activity, flexibility and stability and provide a better knowledge of the adaptation of enzymes to cold temperatures. [less ▲]

Detailed reference viewed: 24 (3 ULg)
Full Text
Peer Reviewed
See detailBehavior of omega-3 fatty acids in eggs during cooking
Douny, Caroline ULg; El Khoury, Rawad ULg; Degand et al

Poster (2009, July 01)

Detailed reference viewed: 38 (11 ULg)
Peer Reviewed
See detailPerceived logistics service quality driven store Loyalty
Hammedi, Wafa ULg; Van Riel, Allard ULg; Semeijn, Janjaap

Poster (2009, July)

Detailed reference viewed: 95 (12 ULg)
Full Text
Peer Reviewed
See detailBedload progression in gravel bed rivers using iron slag as a tracer
Houbrechts, Geoffrey ULg; Levecq, Yannick; Mols, Julien et al

Poster (2009, July)

In fluvial dynamics studies, different methods are used to evaluate bedload transport and particle travel lengths. However, results are mostly based on a few transported elements and on a relatively short ... [more ▼]

In fluvial dynamics studies, different methods are used to evaluate bedload transport and particle travel lengths. However, results are mostly based on a few transported elements and on a relatively short time scale. Consequently, it is difficult to extrapolate these results to whole bedload, because of the burying of particles into the subsurface layer or the trapping of elements in fluvial forms (point bars, riffles, …), which can immobilise elements during long periods. Bedload progression has been evaluated in Ardenne rivers using slag elements produced by the past factories established along rivers between the 14th and the 19th centuries. Important quantities of slag were dumped close to rivers or even directly into channels. For several centuries, slag elements were dispersed in the bedload and transported by floods of varying importance. Consequently, slag can be considered as a tracer to analyze bedload progression over several centuries. The size of slag elements has been studied in many Ardenne rivers. The longitudinal size trend of the largest slag particles allows us to determine the effective competence of rivers and to analyze the hydraulic sorting. Moreover, downstream of some metallurgic sites, we have constrained the presence of slag elements to the most downstream riffles. Because we know from historical studies the periods of activities of these sites, we may estimate the speed of bedload progression in several gravel bed rivers from the Ardenne Massif (2-3 km/century). [less ▲]

Detailed reference viewed: 7 (0 ULg)
See detailPyropheophorbide-a-methyl ester: DMPC liposome vectorization and biophysical properties for PDT
Guelluy, Pierre-Henri ULg; Fontaine-Aupart, Marie-Pierre; Grammenos, Angeliki ULg et al

Poster (2009, July)

Detailed reference viewed: 20 (4 ULg)
Full Text
See detailMeasure of nursing time interventions for hospitalized elderly patients
THONON, Olivier ULg; GILLAIN, Daniel ULg; SERMEUS, Walter et al

Poster (2009, July)

Detailed reference viewed: 12 (2 ULg)
Peer Reviewed
See detailFinding miRNAs able to regulate angiogenesis
Pendeville, Helene; Nivelles, Olivier ULg; Malvaux, L. et al

Poster (2009, July)

Detailed reference viewed: 4 (0 ULg)
Full Text
See detailVHHs as model proteins to investigate amyloid fibril formation
Chavignon, Chloé ULg; Pardon, Els; Wyns, Lode et al

Poster (2009, July)

The term "amyloidosis" covers up a group of diseases associated with deposition in different organs of protein aggregates organized into amyloid fibrils. About twenty-five amyloidosis are known so far ... [more ▼]

The term "amyloidosis" covers up a group of diseases associated with deposition in different organs of protein aggregates organized into amyloid fibrils. About twenty-five amyloidosis are known so far, amongst which Alzheimer's disease, type II diabetes and immunoglobulin amyloidosis [1]. Although the mechanism of amyloid fibrils formation at the molecular level is not yet completely understood, it has been shown that the capacity to form amyloid fibrils in vitro is an intrinsic property of all polypeptide chains [1]. The choice of model proteins to investigate the aggregation process in vitro is therefore no more restrained to proteins involved in amyloidosis but can be settled on a wide variety of proteins. In this study, we have chosen two variable domains of camelid heavy-chain antibodies (referred to as VHHs or nanobodies), cAb-HuL6 and cAb-BcII10, and this choice was motivated by the following reasons: - First, they are small monomeric domains (~14 kDa) presenting high stability and high solubility [2], which permits their expression with a high yield (20-40 mg.L-1). - Second, a wide range of stable mutants of these two VHHs is available. Mutations located at the disulfide bond [3,4], the CDRs [3] and the framework have been introduced. Characterisation of the aggregating properties of these mutants will allow the investigation of the impact of these structural elements on the process of fibril formation. In order to determine conditions in which cAb-HuL6 and cAb-BcII10 are more susceptible to form intermediates and thus amyloid fibrils, heat induced infolding experiments at pHs comprised in a range from 2,5 to 9,5 have been monitored by intrinsic fluorescence, ANS binding and circular dichroism. Then, aggregation experiments have been performed in the selected conditions and the presence of amyloid fibrils has been acknowledged by thioflavineT fluorescence experiments and electronic microscopy. [1] Chiti, F. and Dobson, C. M., Protein misfolding, functional amyloid, and human disease, Annu. Rev. Biochem., 75, 2006, 333-366. [2] Dumoulin, M., Conrath, K., Van Meirhaeghe, A., Meersman, F., Heremans, K., Frenken, L. G., Muyldermans, S., Wyns, L. & Matagne, A., Single-domain antibody fragments with high conformational stability, Protein Sci., 11, 2002, 500-515. [3] Saerens, D., Pellis, M., Loris, R., Pardon, E., Dumoulin, M., Matagne, A., Wyns, L., Muyldermans, S., Conrath, K., Identification of a universal VHH framework to graft non-canonical antigen-binding loops of camel single-domain antibodies, J. Mol. Biol., 352, 2005, 597-607. [4] Saerens D., Conrath K., Govaert J., Muyldermans S., Disulfide bond introduction for general stabilization of immunoglobulin heavy-chain variable domains, J Mol Biol., 377, 2008, 478-488. [less ▲]

Detailed reference viewed: 33 (6 ULg)
Full Text
Peer Reviewed
See detailEvolution of floodplain sedimentation during the last millennia in the Ardenne Massif (Belgium)
Houbrechts, Geoffrey ULg; Notebaert, Bastiaan; Verstraeten, Gert et al

Poster (2009, July)

In the Ardenne massif, several periods of increased sediment deposition have been identified during the last millennia. They can be correlated to increasing anthropogenic land use pressure. The majority ... [more ▼]

In the Ardenne massif, several periods of increased sediment deposition have been identified during the last millennia. They can be correlated to increasing anthropogenic land use pressure. The majority of the sediments found in floodplains were deposited in the last 4000 years, and in many cases even in the last 1000 years. In the Amblève catchment, the first increase in sediment deposition of the Holocene occurred during the Bronze Age (3200 BP), related to first deforestations and crop cultures in the area. Several organic depositions have occurred between 2700 BP and 1000 BP and probably indicate low anthropogenic pressures or more humid periods. From the 11th century onwards, there was an increase in sedimentation, and alluvial deposits contain more charcoal. A second important increase in sedimentation is observed in headwater catchments at the end of the 14th century, which can be related to the development of many iron factories. In the Ardenne massif, more than 300 iron factories existed between the 14th and the 19th century and about 20 ha of forest were cleared each year for the consumption of a refining forge or a blast furnace. Analysis of slag concentration produced in former factories and redistributed in the floodplain allows us to reconstruct the evolution of floodplains since the inception of the iron industries. The results show that not all floodplains in the Amblève catchment are equally sensitive to catchment disturbances. In the headwater stream (Chavanne river, 10-20 km²), about 80 cm of sediment has been deposited since the inception of the iron industries (towards 1540 AD). In the lower Lienne valley (100-150 km²), almost no sediment accumulation occurred in the floodplains after the beginning of iron melting (towards 1400 AD). This difference could be explained by the larger stream power of the Lienne river (100-120 W/m2 for Qb). [less ▲]

Detailed reference viewed: 5 (0 ULg)
Peer Reviewed
See detailEvolution of blood myeloperoxidase in the perioperative period of horses undergoing emergency celiotomy.
Salciccia, Alexandra ULg; Grulke, Sigrid ULg; de la Rebière de Pouyade, Geoffroy ULg et al

Poster (2009, July)

Colic can cause an activation of neutrophils with release in the blood flow of myeloperoxidase (MPO), a specific enzyme with strong oxidative activity. The aim of this study was to describe the evolution ... [more ▼]

Colic can cause an activation of neutrophils with release in the blood flow of myeloperoxidase (MPO), a specific enzyme with strong oxidative activity. The aim of this study was to describe the evolution of plasma MPO after colic surgery. Materials included 13 adult horses that underwent an emergency celiotomy for acute intestinal obstruction. Venous blood samples were collected into EDTA anticoagulated tubes before surgery, during surgery after correction of the intestinal lesion and during the recovery of anaesthesia. In the postoperative period samples were taken every 4 hours during the first 4 days (from day 0 until day 4), every 12 hours during the days 4 and 5 and every 24 hours until day 10. MPO was assayed with a specific enzyme-linked immunosorbent assay. Statistical analysis was performed by one way Anova with student- Newman-Keuls post test on data obtained for each time point. Significance was set at p < 0.05. The horses were operated for an obstruction strangulated or not of the small or the large intestine. In six cases the postoperative period was uneventful, the 7 remaining developed one or 2 severe complications. Eight horses were discharged and 5 died during the hospitalization.The general aspect of the curve of mean plasmatic MPO can be described as follow: An increase was observed from the admission on until a peak of concentration occurring generally during the time of recovery from the anaesthesia with the highest mean value reaching 740.84 +/- 507.61ng/ml. This was followed by a progressive decrease until the lowest value, usually near to day 2 after the recovery from anaesthesia corresponding to 171.79 +/- 76.21 ng/ml of MPO. Afterwards, the mean concentrations increased slowly until postoperative day 10. In the majority of cases a stable and low MPO value (plateau) was observed during approximately 2 days (from day 1 to day 3 postoperatively).The initial peak of MPO after surgery could be associated to the neutrophil activation consequent to the intestinal disorder and the intense stimulation of the coeliotomy. The following significant reduction in concentration could be attributed to MPO infiltration into the tissues with a critical point at approximately 2 days after surgery. This study may contribute to a better understanding of the role of the MPO and neutrophils in the pathophysiology of horses in the postoperative period after colic surgery. [less ▲]

Detailed reference viewed: 21 (1 ULg)
Full Text
Peer Reviewed
See detailInsights into the plant defense mechanisms induced by Bacillus lipopeptides.
Ongena, Marc ULg; Henry, Guillaume ULg; Adam, Akram et al

Poster (2009, July)

Detailed reference viewed: 48 (7 ULg)
See detailTime reversal of Bose-Einstein condensates
Martin, John ULg; Georgeot, Bertrand; Shepelyansky, Dima

Poster (2009, July)

Detailed reference viewed: 11 (1 ULg)
Full Text
See detailUn outil d’aide à la décision pour la gestion des chablis en Région wallonne (Belgique)
Riguelle, Simon ULg; Hebert, Jacques ULg; Jourez, Benoît ULg

Poster (2009, June 30)

The poster highlights the main steps leading to the development of a decision-support tool for storm damage management by the forest sector at a regional scale.

Detailed reference viewed: 12 (3 ULg)
Full Text
See detailQuelles sont les espèces d’oiseaux indicatrices de la qualité des forêts feuillues ardennaises ?
Delahaye, Laurence; Rondeux, Jacques ULg

Poster (2009, June 29)

Detailed reference viewed: 86 (6 ULg)
Full Text
See detailEvaluation de la fonction récréative des massifs forestiers wallons
Colson, Vincent ULg; Lejeune, Philippe ULg; Rondeux, Jacques ULg

Poster (2009, June 29)

Estimer la valeur économique des visites effectuées à des fins récréatives en forêt wallonne.

Detailed reference viewed: 49 (10 ULg)
Full Text
Peer Reviewed
See detailScabies in a llama (Lama glama): control with moxidectin long acting (Cydectin®LA)
Caron, Yannick ULg; Cavadino, Céline; Losson, Bertrand ULg

Poster (2009, June 29)

An adult neutered male llama (Lama glama) was presented for examination with a history of a severe long lasting (3 years) and recurrent itch and crust formation. Three years ago, scabies had been ... [more ▼]

An adult neutered male llama (Lama glama) was presented for examination with a history of a severe long lasting (3 years) and recurrent itch and crust formation. Three years ago, scabies had been diagnosed by a local vet on the basis of clinical signs; the animal was treated several times with ivermectin (Ivomec®) injectable and phoxim (Sarnacuran®). After each treatment there was a marked clinical improvement but relapse was the rule within 1 to 2 months. During the two years preceeding our first visit the animal had received local applications of Sarnacuran every two to three weeks wich resulted in incomplete control. None of the owners had reported skin lesions compatible with scabies. On February 27th 2009 the animal showed a marked pruritus accompanied by very thick scabs and alopecia on the face (around the mouth and ears), shoulders, forelegs, hindlegs, abdomen, flanks and the tail. Clinical examination revealed a fairly good general condition. Abnormalities were limited to the skin. Skin scrapings were taken and numerous Sarcoptes scabiei mites were subsequently detected microscopically. Sedation and analgesia were performed via the intramuscular administration of xylazine (Vexylan®) at 0.5 mg/kg. The scabs were humidified with a camomile infusion and a maximum of material was removed and destroyed. Then the llama was treated with 10% moxidectin (Cydectin LA®) at 1 mg/kg by subcutaneous injection at the basis of the ear. On April 6th 2009, a very marked clinical improvement was observed: most of the scabs had dissapeared and hair regrowth in previously alopecic area was observed. Skin scrapings were negative. However, some pruritus was still observed and a second treatment with Cydectin LA was given. According to the owner who was contacted by phone in early May the clinical condition of the animal has further improved. A final visit is planned to assess the clinical and parasitological cure in this S. scabiei infected llama. At our knowledge, this is the first time Cydecin LA is used in llama for the treatment of scabies. [less ▲]

Detailed reference viewed: 206 (8 ULg)
Full Text
See detailProduction of polymer/clay nanocomposite foams with improved fire behaviour using supercritical fluid technology
Urbanczyk, Laetitia ULg; Calberg, Cédric ULg; Detrembleur, Christophe ULg et al

Poster (2009, June 19)

In this study, supercritical CO2 is successfully used as foaming agent to prepare poly(styrene-co-acrylonitrile) (SAN) foams containing a low amount of well-dispersed nanoclay (5wt%). This kind of ... [more ▼]

In this study, supercritical CO2 is successfully used as foaming agent to prepare poly(styrene-co-acrylonitrile) (SAN) foams containing a low amount of well-dispersed nanoclay (5wt%). This kind of nanofiller has an influence both on material cellular morphology and fire property. In fact, SAN foam filled with nanoclay has smaller cells and higher density compared to unfilled foam. Moreover, the nanocomposite foam burns more slowly and without producing any burning droplets, which is highly desirable when considering housing applications. [less ▲]

Detailed reference viewed: 91 (6 ULg)
See detailThe diversity of Clostridial hydrogenases and biohydrogen production
Calusinska, Magdalena ULg; Savichtcheva, Olga; Masset, Julien ULg et al

Poster (2009, June 18)

Molecular hydrogen is a key intermediate in metabolomic interactions of a wide range of microorganisms. Hydrogen is also regarded as a key component in future energy systems as it is a sustainable, clean ... [more ▼]

Molecular hydrogen is a key intermediate in metabolomic interactions of a wide range of microorganisms. Hydrogen is also regarded as a key component in future energy systems as it is a sustainable, clean, and transportable energy carrier. Some microorganisms can produce hydrogen during a reversible reduction of protons to dihydrogen, a reaction which is catalyzed by hydrogenases [1]. Hydrogenases belong to an iron – sulphur protein family, that contains active sites consisting of inorganic sulfide and iron atoms bound to the polypeptide chain. On the basis of their bimetallocenter composition hydrogenases are divided into three main groups, phylogenetically not related: [NiFe] hydrogenases, [Fe] only hydrogenases and ‘metal – free hydrogenases’ which were described in methanogenic Archaea only. [NiFe] hydrogenases, composed of at least two subunits are well characterized and widely distributed between Archaea and Bacteria but only a few representatives of Clostridium possess this type of enzyme. On the other hand, [Fe] only hydrogenases, being usually monomeric enzymes and restricted to Bacteria and a few eukaryotic species are far less described. These proteins, being omnipresent catalysts of many biological reactions, are especially abundant in Clostridia. The physiological function of Clostridial [Fe] only hydrogenases is to dispose under the form of hydrogen, of the excess of reducing power generated during the fermentation of carbohydrates. The unusual diversity of forms of [Fe] only hydrogenases within Clostridia seems to support the central role of this enzyme in cell metabolism and to facilitate the quick adaptation of the host to changing environmental conditions. Moreover, the presence of multiple putative operons encoding for multisubunit [Fe] only hydrogenases in the genomes of sequenced Clostridium spp. is highlighting the need to study the new, not yet described function of these ostensibly simple proteins. In this project, we have focused our effort on the molecular characterization of key enzymes involved in the process of biohydrogen production with a special interest in Clostridium species. By applying molecular techniques on samples from different kinds of bioreactors, we want to select highly productive species in terms of hydrogen generation. We also believe that gene expression profiling will provide new data on the possible function and activity of different hydrogenases involved in the process. The better understanding of hydrogen metabolism is essential for its sustainable production. [less ▲]

Detailed reference viewed: 29 (5 ULg)
See detailEDLC electrodes from cellulose-based carbon aerogels : influence of the carbon's surface chemistry
Hildenbrand, Claudia; Grzyb, B.; Berthon-Fabry, S. et al

Poster (2009, June 14)

Detailed reference viewed: 9 (1 ULg)
Peer Reviewed
See detailEvolution of the surface chemistry of carbon xerogels with very different textural properties by chemical activation and oxidation
Zubizarreta, Leire; Arenillas, A.; Pirard, Jean-Paul ULg et al

Poster (2009, June 14)

Detailed reference viewed: 19 (1 ULg)
Full Text
See detailDevelopment of multilayered chitosan-based nanofibers
Croisier, Florence ULg; Aqil, Abdelhafid ULg; Detrembleur, Christophe ULg et al

Poster (2009, June 14)

By combining electrospinning and layer-by-layer deposition techniques, new porous material scaffolds of multilayered, chitosan-based nanofibers were produced. Layer-by-layer (LBL) is a well-known method ... [more ▼]

By combining electrospinning and layer-by-layer deposition techniques, new porous material scaffolds of multilayered, chitosan-based nanofibers were produced. Layer-by-layer (LBL) is a well-known method for surface coating, based on electrostatic interactions. It enables the controllable deposition of a variety of polyelectrolytes including synthetic and natural materials, with designable layer structure, defined layer thickness and size. Electrospinning (ESP) allows the fabrication of polymer fibers ranging from nanometers to a few microns in diameter, depending on the polymer characteristics (a.o. molecular weight, solution viscosity and conductivity) and processing conditions (electric potential, distance between syringe-capillary and collection plate, concentration, flow rate). Mats of nanofibers produced by ESP display a very large surface area-to-volume ratio and high porosity with very small pore size. The nanometric scale of electrospun fibers also proves a positive effect on cellular growth, as fiber mats mimic extracellular matrix structure. The association of these two techniques with the use of biocompatible and biodegradable polymers such as chitosan, gives outstanding prospects in the field of biomedical applications, especially for the preparation of wound dressings, artificial skin or tissue engineering scaffolds. In the present study, a charged copolymer, poly(methylmethacrylate-block-methacrylic acid), was added to a poly(ε-caprolactone) or poly(D,L-lactide) solution before electrospinning in order to prepare surface charged nanofibers. Oppositely charged polyelectrolytes – chitosan and poly(styrene sulfonate) or hyaluronic acid – were then alternately deposited on these aliphatic polyester fiber “cores” using LBL method. The aliphatic polyester core was also removed selectively to confirm the growth of a multilayered shell, obtaining hollow fibers. [less ▲]

Detailed reference viewed: 92 (32 ULg)
Full Text
See detailNovel Amphiphilic copolymers and design of smart nanoparticule for triggered drug delivery systems
Cajot, Sébastien ULg; Jérôme, Christine ULg

Poster (2009, June 14)

Over the last decade, polymer micelles attracted an increasing interest in drug pharmaceutical research because they could be used as efficient drug delivery systems. Micelles of amphiphilic block ... [more ▼]

Over the last decade, polymer micelles attracted an increasing interest in drug pharmaceutical research because they could be used as efficient drug delivery systems. Micelles of amphiphilic block copolymers are supramolecular core-shell type assemblies of tens of nanometers in diameter. In principle, the micelles core is usually constructed with biodegradable hydrophobic polymers such as aliphatic polyesters, e.g. poly(epsilon-caprolactone) (PCL), which serves as a reservoir for the incorporation of various lipophilic drugs. Water soluble poly(ethylene oxide) (PEO) is most frequently used to build the micelle corona because it is very efficient in preventing protein adsorption at surfaces and in stabilizing the micelles in the blood compartment, giving rise to particles invisible to the body defence system (so-called stealthy or long circulating particles). Improvements of such simple systems however, rely on the development of novel chemistries and materials by advanced macromolecular engineering techniques. The tumour targeting of a cytotoxic agent refers to the passive accumulation of polymer nanocarriers to solid tumours (EPR effect) followed by active internalization in tumor cells. The internalization of the drug is required for cell death because most cytotoxic drugs act intracellularly. Accordingly, polymer micelles are usually modified by specific ligands. However, these ligands can decrease the micelles stealthiness and stability. No-specific ligands can be used if their exposition is modulated by the pH decrease typical of tumour tissues. Lipophilic drugs are generally incorporated in the hydrophobic core of the micelles. The release of the drug is ruled by diffusion and degradation of the biodegradable polymer used as reservoir. Even if micelles get a high stability in aqueous media thanks to their low critical micellar concentration, the dissociation of micelles is not always preserved when they are injected in the blood compartment. The cross-linking of the core of micelles by disulfide bridges will provide the stability of micelles after the administration and will release the drugs intracellularly by enzymatic breaking of disulfide bridges. This work consists in the development of new macromolecular architectures for the targeting of tumour cells. pH sensitive copolymers able to micellize so as non-specific ligand like biotin is exposed on their surface in response to pH decrease typical for tumour tissues will be synthesized by the incorporation of pH-sensitive linkers like hydrazone or imine benzoïc linkers. In addition, the core of these new micelles will be cross-linked by disulfide bridges to prevent dissociation around healthy cells and trigger the drug release inside tumour cells. [less ▲]

Detailed reference viewed: 44 (12 ULg)
Full Text
See detailDesign of thermoresponsive magnetic nanoparticles for hyperthermia
Sibret, Pierre ULg; Aqil, Abdelhafid; Jérôme, Christine ULg

Poster (2009, June 14)

Detailed reference viewed: 10 (0 ULg)
Full Text
See detailIN VITRO CLONAL PROPAGATION OF A PROMISING AGROFUEL PRODUCING-PLANT : JATROPHA CURCAS L.
Medza Mve, Samson Daudet ULg; Mergeai, Guy ULg; Baudoin, Jean-Pierre ULg et al

Poster (2009, June 13)

In the present investigation, in vitro clonal propagation of two-month-old Jatropha curcas L. was achieved employing nodal explants. Axillary shoot bud proliferation was best initiated on Murashige and ... [more ▼]

In the present investigation, in vitro clonal propagation of two-month-old Jatropha curcas L. was achieved employing nodal explants. Axillary shoot bud proliferation was best initiated on Murashige and Skoog’s (MS) basal medium supplemented with N6-benzyladenine (BA) and adenine sulphate. This medium allowed the production of 3.1 ± 0.5 shoots per nodal explant with 3.5 ± 0.8 cm average length after 3-4 weeks. [less ▲]

Detailed reference viewed: 15 (1 ULg)
Full Text
See detailA risk-based approach for designing climate-proof flood protection
Ernst, Julien ULg; Dewals, Benjamin ULg; Detrembleur, Sylvain ULg et al

Poster (2009, June 12)

In the framework of the Belgian national research project “ADAPT - Towards an integrated decision tool for adaptation measures”, a risk-based decision-support system (DSS) is developed with the aim of ... [more ▼]

In the framework of the Belgian national research project “ADAPT - Towards an integrated decision tool for adaptation measures”, a risk-based decision-support system (DSS) is developed with the aim of selecting the most cost-effective flood protection strategies. Based on detailed 2D hydraulic modelling combined with high resolution and high accuracy land use database as well as socio-economic datasets, integrated risk analysis is conducted to evaluate the benefits of different flood protection measures. The tool is dedicated to the integrated evaluation of flood management strategies in the context of increased flood risk as a result of climate change, considering hydraulic, economic, social as well as environmental parameters to quantify both the benefits (in terms of avoided risk) and the cost of each strategy. While such risk analyses are mostly undertaken at a macro- or meso-scale, the present approach is performed at a micro-scale, meaning that the considered assets are the individual buildings or facilities. The methodology relies on a consistent approach in terms of accuracy of input data, hydraulic modelling and expected results. Indeed, besides detailed hydraulic modelling conducted on computational grids as fine as 2m by 2m, exploited data include laser altimetry (LIDAR), high resolution and high quality land use maps as well as other complementary vector geographic datasets providing socioeconomic information at a micro-scale. Next to the flow modelling and the exposure analysis conducted for each building or facility individually, the procedure involves social impact analysis (accounting for social vulnerability and adaptive capacity of communities) and the evaluation of direct economic damage based on different relative damage functions. The outcomes of this risk analysis are subsequently exploited in the DSS to evaluate the effectiveness of individual flood protection measures. Finally all costs and benefits (avoided risk) are combined to enable the evaluation of flood protection strategies. Every scenario for which benefits outweigh costs potentially adds to welfare. The scenario with the highest contribution per Euro invested should ideally be realised first. The extended cost-benefit analysis is complemented by uncertainty and sensitivity analyses of the results. The applicability of the overall automatic procedure is demonstrated by the evaluation of inundation hazard, exposure and flood risk for a case study along river Ourthe in the Meuse basin (Belgium). For validation purpose, recent flood events are first simulated and a base scenario is considered. Next, the effectiveness of a number of flood protection measures is evaluated. [less ▲]

Detailed reference viewed: 35 (1 ULg)
Peer Reviewed
See detailTargeted proteomics of nascent RNP particles: A role for DBC1 and ZNF326 in linking mRNA splicing to RNAPII
Close, Pierre ULg; East, P; Svejstrup, J. Q.

Poster (2009, June 12)

Detailed reference viewed: 8 (3 ULg)
Full Text
Peer Reviewed
See detailMethylmercury in vitro exposure of harbor seal (Phoca vitulina) lymphocytes: a multidisciplinary approach
Dupont, Aurélie ULg; Siebert, Ursula; Rosenberger, Tanja et al

Poster (2009, June 08)

Detailed reference viewed: 23 (2 ULg)
Full Text
Peer Reviewed
See detailDISLOCATIONS AS DEVELOPMENTAL MARKERS IN THE FRENCH LANGUAGE : DEVELOPMENTAL AND PATHOLOGICAL STUDIES
Maillart, Christelle ULg; Parisse, Christophe; Gay-Perret, Nathalie

Poster (2009, June 06)

Detailed reference viewed: 33 (4 ULg)
See detailOxylipin profiles of Solanum esculentum and Solanum pennellii under salt stress conditions
Ghars, Mohamed Ali ULg; Frettinger, P.; Ghanem, M. E. et al

Poster (2009, June 05)

Detailed reference viewed: 38 (0 ULg)
Full Text
Peer Reviewed
See detailChildren with specific language impairment are impaired on implicit higher-order sequence learning, but not on implicit spatial context learning.
Gabriel, Audrey ULg; Schmitz, Xavier; Maillart, Christelle ULg et al

Poster (2009, June 05)

In a recent review of the SLI literature it has been suggested that low language and grammatical abilities would be directly associated with poor learning abilities of nonverbal sequences (Ullman ... [more ▼]

In a recent review of the SLI literature it has been suggested that low language and grammatical abilities would be directly associated with poor learning abilities of nonverbal sequences (Ullman & Pierpont, 2005; Tomblin et al., 2007). Therefore, one could hypothesize that a general purpose sequential pattern tracker could determine some aspects of language and grammar learning. In the present study, 15 children with SLI and 15 matched control children were compared on two implicit learning tasks: an alternating serial response time task in which sequential dependencies exist across non-adjacent elements, and a spatial context learning task in which the global configuration of a display cues the location of a searched target (Chun & Jiang, 1998). We predict that children with SLI will show impaired sequence learning and normal spatial context learning. By confirming the presence of a specific deficit in sequential learning processes, the present study should contribute to better understand the language abilities, and in particular the grammatical difficulties, of individuals with specific language impairment. [less ▲]

Detailed reference viewed: 168 (33 ULg)
Peer Reviewed
See detailEffects of time of day on age-related differences in cognitive tests.
Schmitz, Xavier ULg; Willems, Sylvie ULg; Meulemans, Thierry ULg

Poster (2009, June 03)

Previous studies have shown a shift in the circadian rhythm – and more particularly in the optimal time of day (OTD) – across the adult life span (May et al., 1993). The aim of this study was to ... [more ▼]

Previous studies have shown a shift in the circadian rhythm – and more particularly in the optimal time of day (OTD) – across the adult life span (May et al., 1993). The aim of this study was to investigate the relationship between cognitive efficiency and OTD in 113 healthy old adults (Age: M = 69, SD = 6.1, Range = 60-80) and 175 younger adults (M = 40.8, SD = 12.9, Range = 20-59). Participants performed a large battery of cognitive tests that assessed episodic memory, working memory, executive and attentional functions. Results on the MEQ (Morningness-Eveningness Questionnaire; Horne & Östberg, 1976) confirmed the age-related shift toward a self-reported morning preference in older adults. Second, the categorization of participants according to their MEQ scores and the time of testing revealed that the OTD has a greater impact upon cognitive performance in older than in younger adults. Third, the age-related OTD impact was more striking in working memory (Brown-Peterson and Pasat) and episodic memory tasks (Buschke) than in other aspects of the cognitive functioning. In conclusion, older participants tested during their peak circadian periods tend to show greater performance on memory tasks that require careful or strategic processing relative to older participants who are tested at off-peak times of day. Taken together, these findings indicate that care must be taken when investigators are considering the effects of age on effortful memory tasks, which are particularly modulated by OTD in older adults. [less ▲]

Detailed reference viewed: 23 (5 ULg)
Full Text
See detailMental health and emotions in couples with an alcoholic member
Dethier, Marie ULg; Counerotte, Christelle; Blairy, Sylvie ULg

Poster (2009, June 03)

Detailed reference viewed: 33 (10 ULg)
Full Text
See detailA theoretically motivated approach of receptive language assessment based on an interactive spreading activation account of language processing
Martinez Perez, Trecy ULg; Majerus, Steve ULg; Delvenne, Marie-Anne ULg et al

Poster (2009, June 03)

In French language, existing tests do not provide a sensitive assessment of auditory comprehension impairments in aphasic patients. These tests don’t detect slight deficits because their a limited number ... [more ▼]

In French language, existing tests do not provide a sensitive assessment of auditory comprehension impairments in aphasic patients. These tests don’t detect slight deficits because their a limited number of tasks and items. Our aim was to construct a series of more sensible tasks to assess auditory perception. Our battery consists on of phonological, lexical, semantic and verbal short-term memory tasks with a high number of items for each test. The computerization of tasks allows to measure correct answers and time latency and allows a standardized assessment. Our poster will focus on our assessment tasks of auditory comprehension, performances pattern of our aphasic patient and underlying theoretical models. [less ▲]

Detailed reference viewed: 76 (27 ULg)
Full Text
See detailPilot scale biotransformation of vegetal oil into natural green note flavor using sugar beet leaves as sources of hydroperoxide lyase
Gigot, Cédric ULg; Ongena, Marc ULg; Fauconnier, Marie-Laure ULg et al

Poster (2009, June 02)

Natural green note aromas (GLVs) are highly attractive flavors commonly used in the food industry. These are produced in extremely low levels upon physiological stress in plant organs of any sort. This ... [more ▼]

Natural green note aromas (GLVs) are highly attractive flavors commonly used in the food industry. These are produced in extremely low levels upon physiological stress in plant organs of any sort. This weak sporadic presence entails a very expensive extraction step to obtain pure GLVs. Therefore catalytic biotransformations of fatty acid sources, the initial substrate for GLVs, have been developed. Enzymatic defense pathways and particularly the LOX pathway produce the major part of GLVs. Unlike GLV molecules that are emitted in the atmosphere, the enzymes are extractible from the plant material. Thus, a combination of plant enzyme extracts and substrate preparations provides all the ingredients for GLV production. Besides, sugar beet leaves present high levels of hydroperoxide lyase among plant sources and are available in large amounts during three months. In this enzymatic pathway, fatty acids are successively transformed by lipase, lipoxygenase and hydroperoxide lyase into aldehydes and alcohols, final compounds of GLVs pathway. Limiting and problematic steps occur with the action of hydroperoxide lyase, when enzymatic catalysis is followed by an enzyme destabilization. Alternative substrates bind irreversibly to the heme group of the enzyme and end the reaction. This poster briefly describes the development of a complete bioprocess for natural GLV production, from hydrolysis to purification. A high level of biotransformation could be achieved using optimum experimental conditions and a cheap source of plant materials. [less ▲]

Detailed reference viewed: 62 (2 ULg)
Full Text
Peer Reviewed
See detailRelative serum protein quantification based upon ICPL and 2D-LC-MS identifies potential frailty biomarkers in elderly patients
Turtoi, Andrei ULg; Mazzucchelli, Gabriel ULg; Dobson, Rowan ULg et al

Poster (2009, June 01)

This study shows the ability of the ICPL and nano-HPLC-MS/MS to perform relative quantification and identification of serum protein biomarkers. Frailty is a geriatric syndrome that is commonly associated ... [more ▼]

This study shows the ability of the ICPL and nano-HPLC-MS/MS to perform relative quantification and identification of serum protein biomarkers. Frailty is a geriatric syndrome that is commonly associated with the decline in multisystemic reserve, cognition and sensory capabilities. It is negatively influencing the outcome of a disease prolonging the patient’s recovery. The discrepancy between the actual and the biological age brings the uncertainty of predicting frailty in a given individual. This study is addressing the problem of finding suitable biomarkers that bear the ability to objectively predict frailty in elderly patients. It furthermore provides a robust method for reliable relative quantification of serumproteins. Serum samples used in this study were divided into six groups regarding the patient’s disease (hip-fracture, infection and cardiac decompensation) and frailty status (frail or robust). The individual sera were pooled and a volume of 20 µL was depleted of high abundantproteins. After labeling with ICPL (isotope coded protein label), serum proteins were fractionated according to their respective pI (0-3, 4-7 and 8-12). The samples were further subjected to tryptic digestion followed by the treatment with the Glu-C enzyme. The peptides were analyzed on the 2D-nano-HPLC system (Ulimate 3000®) using four different concentrations of salt injections (45, 75, 150 and 500 mM ammonium acetate). The HPLC system was connected on-line with the electrospray ion-trap mass spectrometer Esquire HCT ultra®. The relative protein quantification using ICPL and mass spectrometry allowed for comparison of six patient groups with respect to a standard sample. The latter represented a group of healthy old subjects. This technique allowed for the detection of approx. 200 proteins, whereas about 50 % of those contained the ICPL label and could therefore be quantified. The identified proteins covered 3 – 4 orders of magnitude ofprotein concentration in human serum. Several proteins displayed a significant modulation allowing for some preliminary conclusions to be drawn. At this point it can be stated that significantly elevated levels of C-reactive protein (factor 12) and alpha-1-antichimotrypsin (f. 4) proved to be potentially good indicators of frailty. Increased concentrations of alpha-1-microglobulin (f. 4) and alpha-2HS-glycoprotein (f. 2) have been found in the robust patients, whereas no significant concentration alteration could be detected in the frail groups. These results refer to the acute phase response since the samples were collected immediately after patient hospitalization. Current investigations addressing the later sampling times should shed more light on the suitability of these markers to predict frailty in elderly patients. At this stage it is obvious that although several markers are found to be in common for all the frail or robust patients, the disease status additionally complicates the biomarker signature. Therefore a more individualized approach should also be considered, where depending on the age and clinical findings a more defined group of markers should be selected to address the problem of frailty. [less ▲]

Detailed reference viewed: 60 (6 ULg)
Full Text
See detailMaturation of toxins in the venom duct of conustextile
Dobson, Rowan ULg; Collodoro, Mike; Gilles, Nicolas et al

Poster (2009, June)

Detailed reference viewed: 11 (1 ULg)
Full Text
See detailShort-term temperature impacts on soil respiration.
Buysse, Pauline ULg; Goffin, Stéphanie ULg; Carnol, Monique ULg et al

Poster (2009, June)

Despite considerable recent work on soil heterotrophic respiration, a mechanistic understanding of this process is still missing. Temperature is one of the most important driving factors. It can influence ... [more ▼]

Despite considerable recent work on soil heterotrophic respiration, a mechanistic understanding of this process is still missing. Temperature is one of the most important driving factors. It can influence the mechanism through multiple ways, whose importance may vary with time. An incubation experiment is set up to study short-term temperature influences on soil microbial respiration and its evolution through time. Soil samples are taken in spring from the surface layer (0-25cm) of a bare agricultural loamy soil situated in Lonzée in Belgium (Hesbaye region) and are homogenized before being placed into incubators at three different temperatures, namely 5, 15 and 25°C. Temperature is regulated by Peltier systems that warm up or cool down a sand bath containing jars with soil samples. Once a week, incubation temperatures are increased and decreased by 5°C-steps, starting from each incubator temperature, to achieve a one-day temperature cycle between 5 and 35°C. CO2 flux measurements are performed at each temperature step by a closed dynamic chamber system, after the temperature has stabilized in the samples. Microbial biomass (C and N) is determined four times during the temperature cycle by the fumigation-extraction technique and soil labile carbon is measured at the beginning of each cycle by the hot-water extraction method. Moisture levels in soil samples are regularly checked and adjusted to keep optimal soil moisture content. Between CO2 flux measurements, jars are left open to ensure that anaerobic conditions do not occur. Further investigations could include an assessment of the importance of substrate availability and depletion on microbial activity, and a model development related to the results provided by this experiment. [less ▲]

Detailed reference viewed: 80 (9 ULg)
Peer Reviewed
See detailTheoretical Study of Transformation Mechanism for the Corundum-to-Rh2O3(II) Transition in Al2O3
Xu, Bin ULg; Dong, Jianjun; Stokes, Harold et al

Poster (2009, June)

Detailed reference viewed: 12 (0 ULg)
Peer Reviewed
See detailFirst-Principles Study of the Mechanism for B4-to-B1 Phase Transformation in AlN
Xu, Bin ULg; Dong, Jianjun; Stokes, Harold et al

Poster (2009, June)

Detailed reference viewed: 16 (0 ULg)
Peer Reviewed
See detailMarginal bone resorption and marginal bone level around implants in the posterior mandible: A 4-year retrospective study.
LAMBERT, France ULg; Geron, Caroline; LECLOUX, Geoffrey ULg et al

Poster (2009, June)

Long-term bone remodelling of implant placed in the posterior mandibule: a radiological study. France Lambert, Kim Vincent, Caroline Geron, Geoffrey Lecloux, Eric Rompen. Purpose: The aim of this study ... [more ▼]

Long-term bone remodelling of implant placed in the posterior mandibule: a radiological study. France Lambert, Kim Vincent, Caroline Geron, Geoffrey Lecloux, Eric Rompen. Purpose: The aim of this study was to analyse direct and long-term (4 years) marginal bone remodelling of various implant systems placed in the posterior mandibule with a single stage approach. Materials and methods: 50 partially edentulous patients received a total of 114 implants in the posterior mandibule (TE implant, Straumann®, Switzerland; Replace® Select Straight, Nobel Biocare, Sweden; Branemark System® MKIV, Nobel Biocare, Sweden). All implants were non-submerged, and loaded 8 to 12 weeks post surgery. X-rays were taken at baseline, 6 weeks, after loading and at long-term. Using a image processing program (Image J), bone losses were measured at each time point. Bone levels were also recorded using the first thread as reference point. Results: The mean bone loss reached 0.506±0.498 mm at 6 weeks, 0.798±0.599 after loading and 1.037±0.799 after 4 years. Bone losses were significatively higher on smokers and on patients displaying signs of bruxism. No statistical difference was found between the different implant types. Conclusion: 50% of the bone loss had already occurred within the 6 weeks post surgery with all implant types. Higher bone losses were often associated to risk factors such as tabacco addiction and bruxism. [less ▲]

Detailed reference viewed: 27 (1 ULg)
Peer Reviewed
See detailHow good are we at extracting personal information from voices?
Dehon, Hedwige ULg; Lambert, Florence

Poster (2009, June)

Detailed reference viewed: 4 (0 ULg)
Full Text
See detailAnalyse comparée de la formation des éducateurs sportifs en Algérie et en Communauté française de Belgique
Kerfes, Nabil; Boudaoud, Abdelyamine; Alem, Jaouad et al

Poster (2009, June)

Toute formation supérieure a ses principes et ses particularités visant à développer des compétences en relation avec les finalités professionnelles disponibles. La formation des éducateurs sportifs est l ... [more ▼]

Toute formation supérieure a ses principes et ses particularités visant à développer des compétences en relation avec les finalités professionnelles disponibles. La formation des éducateurs sportifs est l'une des préoccupation majeurs de toutes les sociétés cherchant le progrès et le développement, il existe de nombreuses raisons pour lesquelles les nouveaux étudiants choisissent leur avenir universitaire ou professionnel, ils abordent l'enseignement supérieur avec des dispositions diverses à l'égard du contenu de la formation et des professions sur lesquelles elle débouche. Ce travail se situe dans le champ de l’éducation comparée. Il propose une lecture compréhensive de deux systèmes de formation dans un esprit d’ouverture et d’élargissement des connaissances. En nous inspirant de deux études effectuées dans le domaine de la formation des éducateurs physiques dans des contextes culturels très différents (Groupe de recherche de MJS, 1983, pour l’Algérie – Groupe de recherche interuniversitaire, 2003, pour la Belgique francophone). L’objectif de cette recherche a dès lors consisté à déterminer les motifs qui incitent les étudiants à s'inscrirent aux études de diverses formations sportives, qu’ils soient universitaires ou non. Notre recherche s’est basée, d’une part, sur l’analyse des textes officiels relatifs à l’organisation des études supérieures dans le domaine sportif et, d’autre part, sur des données collectées auprès des acteurs impliqués dans quatre institutions de formation, deux de la région d’Alger et deux de la région liégeoise. Il convient de retenir que, dans chaque contexte culturel, une institution universitaire et une non universitaire ont été analysées. Nos résultats portent ainsi sur un échantillon total de 290 sujets (40 membres des staffs pédagogiques, 108 étudiants et 142 diplômés). Les formateurs ont été interviewés tandis que les sujets des deux autres groupes ont répondu à des questionnaires. La version arabe de chaque instrument a été traduite à partir des outils en français. Un expert en a assuré le contrôle de validité. Dans cet article, nous porterons notre attention sur l’analyse des réponses fournies par les trois types d’acteurs à deux questions fermées consistant à identifier le degré d’importance accordé par les sujets à des motifs d'inscription aux études en éducation physique et sportive, par l’intermédiaire d’échelles de Lickert à quatre niveaux. Les réponses ont été encodées dans une base de données informatique et traitées au moyen du logiciel Statistica (Stat Soft, 2006). Aucune différence significative n’est enregistrée dans la comparaison des réponses des sujets interrogés. Nous constatons toutefois que, d'une part, l'amour du sport et la volonté de pratiquer du sport sont parmi les plus importants des motifs de suivre cette formation, et d'autre part, dans les deux institutions belges, une importance plus grande est donnée à l'entraînement sportif, le contexte culturel ne semble pas non plus beaucoup influencer les avis des sujets interrogés. [less ▲]

Detailed reference viewed: 41 (4 ULg)
Full Text
See detailLa validité de construit des épreuves physiques qui mesurent l’aptitude physique générale sportive des candidats pour une formation en sport au Maroc et en Algérie
Alem, Jaouad; Dadouchi; Kerfes, Nabil et al

Poster (2009, June)

A l’instar de certains chercheurs en sciences de l’éducation qui ont tenté de démontrer l’existence d’un facteur unique d’intelligence générale G, certains kinésiologues ont, eux aussi, longtemps cru en ... [more ▼]

A l’instar de certains chercheurs en sciences de l’éducation qui ont tenté de démontrer l’existence d’un facteur unique d’intelligence générale G, certains kinésiologues ont, eux aussi, longtemps cru en l’existence d’un facteur unique d’aptitude physique générale sportive (Thomas, 1989). Cette recherche analyse la validité de construit des épreuves physiques censées mesurer l’aptitude physique générale des candidats pour une formation supérieure en sport au Maroc (7 épreuves) et en Algérie (4 épreuves). La base de données est composée de 990 candidats masculins du Maroc et 491 de l’Algérie, âgés en moyenne de 20 ans. Les analyses factorielles en composantes principales avec rotation varimax des performances à ces épreuves aussi bien selon le genre des candidats que selon leur spécialité sportive révèlent systématiquement une solution factorielle en deux composantes qui se distinguent selon la durée du travail pour produire de l’énergie et qui prédisent plus de 50% de la variance du construit mesuré. La 1ière composante correspond à la puissance musculaire phosphagénique ou encore à la capacité de produire en moins de sept secondes du phosphate déjà présent dans les muscles, elle est définie par les autres épreuves physiques. La 2ième composante correspond à la puissance musculaire glycolytique ou encore à la capacité de produire du lactate en plus de 12 secondes, elle est définie par la course de vitesse et la course de résistance. Nos analyses n’ont pas démontré la validité de construit de 7 ou 4 dimensions différentes d’aptitude physique sportive mais plutôt l’existence de deux composantes différentes de la puissance musculaire. [less ▲]

Detailed reference viewed: 49 (3 ULg)
Peer Reviewed
See detailQuantifying hand cross contamination in food.
Rodrigues, Ana; Dure, Rémi ULg; Delhalle, Laurent ULg et al

Poster (2009, June)

Detailed reference viewed: 17 (0 ULg)
Peer Reviewed
See detailFirst-Principles Study of Phase Transitions in Silicon Nitride at High Pressure
Xu, Bin ULg; Dong, Jianjun; Shebanova, Olga et al

Poster (2009, June)

Detailed reference viewed: 11 (0 ULg)
Peer Reviewed
See detailThe influence of encoding style on false memories
Dehon, Hedwige ULg; Laroi, Frank ULg; Van der Linden, Martial

Poster (2009, June)

Detailed reference viewed: 10 (0 ULg)
Full Text
See detailSleep in the vegetative and minimally conscious states
Cologan, Victor ULg; Schabus, Manuel; Maquet, Pierre ULg et al

Poster (2009, June)

Résultats préliminaires de l'étude du sommeil chez les patients cérébrolésés en état de conscience altéré.

Detailed reference viewed: 8 (0 ULg)
Full Text
Peer Reviewed
See detailIdentification of biomarkers to estrogen exposure using MCF-7/BOS cell line exposed to 17β-estradiol and phytoestrogens
Collodoro, Mike ULg; Bertrand, Virginie ULg; Lemaire, Pascale ULg et al

Poster (2009, June)

Use of an estrogen responsive cell line and proteomic for biomarker discovery and the screening of xenoestrogen

Detailed reference viewed: 49 (6 ULg)
Full Text
See detailFuture CCD and CSH variations: Deep-sea impact of ocean acidification
Munhoven, Guy ULg

Poster (2009, June)

The evolutions of atmospheric CO2 partial pressure (pCO2) and of the carbonate compensation depth and the calcite and aragonite saturation horizons (CSH and ASH, respectively) have been studied with the ... [more ▼]

The evolutions of atmospheric CO2 partial pressure (pCO2) and of the carbonate compensation depth and the calcite and aragonite saturation horizons (CSH and ASH, respectively) have been studied with the coupled oceansediment model MBM-MEDUSA [1], over the next 50,000 years. MBM-MEDUSA includes a full description of sedimentary exchange processes, taking into account chemical carbonate erosion in a consistent way. The adopted emission scenarios were based upon logistic functions [2], considering total emissions of 500, 1000, 2000 and 4240 GtC); the adopted stabilisation scenarios were the S350, S450, S550, S650 and S750 from the IPCC [3]. While the evolutions of atmospheric pCO2 and pH have got a great deal of attention so far (e.g., [4, 5]), only a few studies have considered the saturation horizons [5, 6], and, to our best knowledge, this is the first study also focusing on compensation depth variations. Simulation experiments were started with a 50,000 year spin-up to 1750 A.D. (at steady state). This state was characterised by an atmospheric pCO2 of 277 ppm, a CSH depth of 3350 m and a CCD of 4300 m (in the Indo-Pacific, which can be considered the most representative reservoir for the global ocean). In all experiments, we found that CCD variations were considerably greater than CSH variations. The 500 GtC emission scenario yielded CSH and CCD maximum shoalings of 450 and 800 m, respectively, in the year 3400 A.D. about; with the 4240 GtC emission scenario, both CSH and CCD became shallower than 500 m in 2650 A.D. With the highly optimistic S350 stabilisation scenario, CSH and CCD become even shallower than with the 500 GtC emission scenario (650 m and 1000 m shoaling, respectively), although in the year 5000 A.D. only. For the close-to-CO2-doubling scenario S550, CSH and CCD shoaled by about 1950 and 2450 m (to depths of 1400 and 1900 m, respectively). As a result, most of the sea-floor environment bathed in water that was highly corrosive to carbonate material. In the S650 and S750 scenarios experiments, the CCD becomes shallower than 500 m, leaving little space for benthic carbonate producers to survive. [1] Munhoven (2007) Deep-Sea Res. II 54, 722-746. [2] Bacastow and Dewey (1996) Energy Convers. Mgmt. 37, 1079-1086. [3] IPCC (1994) Climate Change 1994, Cambridge University Press. [4] Caldeira and Wickett (2003) Nature 425, 325-325. [5] Orr et al. (2005) Nature 437, 681-686. [6] Cao and Caldeira (2008) Geophys. Res. Lett. 35, L19609. [less ▲]

Detailed reference viewed: 59 (3 ULg)
Full Text
Peer Reviewed
See detailEvaluation of the dynamic adsorption of gas on active carbon beds using in situ X-ray µ-tomography coupled with 3D image analysis
Almazan, Maria del Carmen; Léonard, Angélique ULg; Lodewyckx, Peter et al

Poster (2009, June)

Detailed reference viewed: 50 (9 ULg)
See detailFading of Modern Prussian Blue Pigments : Preliminary Study
Samain, Louise ULg; Sougrati, Moulay T.; Hatert, Frédéric ULg et al

Poster (2009, June)

Detailed reference viewed: 19 (3 ULg)
Peer Reviewed
See detailHigh incidence of invasive group B streptococcal infections in uninfected infants born to HIV-1 mothers
Epalza, C.; Goetghebuer, T.; Hainaut, M. et al

Poster (2009, June)

Detailed reference viewed: 11 (1 ULg)
Peer Reviewed
See detailS'auto-former aux TIC
Henry, Julie ULg; Denis, Brigitte ULg; Vandeput, Etienne ULg

Poster (2009, June)

Poster présentant deux dispositifs de formation visant la maitrise des TIC et la méthodologie (didactique des TIC) qui les sous-tendent.

Detailed reference viewed: 99 (5 ULg)
Full Text
See detailTxXIIIA, an atypical homodimeric conotoxin found in the Conus textilevenom
Quinton, Loïc ULg; Gilles, Nicolas; De Pauw, Edwin ULg

Poster (2009, June)

Detailed reference viewed: 6 (2 ULg)
See detailEvidence for distinct roles for basal ganglia and SMA in automatic and unconscious inhibition of voluntary actions
D'Ostilio, Kevin ULg; Garraux, Gaëtan ULg

Poster (2009, June)

Introduction: Although previous research highlighted the importance of automatic and unconscious inhibition in motor control, the neural correlates of such processes remain unclear. Basal ganglia ... [more ▼]

Introduction: Although previous research highlighted the importance of automatic and unconscious inhibition in motor control, the neural correlates of such processes remain unclear. Basal ganglia dysfunctions have long been associated with impairment in automatic motor control. In addition, Sumner & al. (2007) suggested a key role of the medial frontal cortex by administrating a masked priming task (e.g., Eimer & Schlaghecken 2003) to a patient with a small lesion restricted to the supplementary motor area (SMA)., Here, we used fMRI in normal subjects to better delineate the respective roles of SMA and basal ganglia in automatic and unconscious motor inhibition. Methods: We used event-related BOLD fMRI at 3T to record brain activity in 26 healthy volunteers (22 ± 2 years) as they performed the subliminal masked priming task. In this visuomotor task, participants are asked to make speeded button presses with the left or right hand following leftward or rightward pointing arrows, which are preceded by masked prime arrows. Here, two experimental variables were manipulated: the interval between the mask and the target (SOA: 0,100,150,200 or 250 ms) and the prime/target direction (compatible or incompatible). Imaging data processing and analysis were performed using SPM8b. Results: using Repeated Measures ANOVA of behavioral data (global interaction SOA*compatibility, p<0.0000001), we replicated the masked priming effects showing faster reaction times (i.e., motor response facilitation) in compatible than incompatible trials at 0-SOA (positive compatibility effect: diff = 21 ms, linear contrast : p<0.0000001) and the reverse (negative compatibility effect) at 100 (diff = -12 ms, p= 0.01) and 150-SOA (diff= -12 ms, p= 0.008) suggesting motor response inhibition. At 200 & 250 SOA, we no longer found significant compatibility effects (p>0.05) By applying a similar statistical model to imaging data, we observed a stronger activity in the in several regions, the SMA (p<0.001, uncorrected), caudate (p=0.002, uncorrected) and thalamus (p<0.001, uncorrected) showing stronger activity in compatible than incompatible trials at 100 and 150-SOA, as compared with 0-SOA. Moreover, the differential activity in the SMA was correlated with the negative compatibility effect (p= 0.01). When testing for a main effect of SOAs we didn’t find a differential activation of the SMA, but a stronger deactivation of the caudate (p=0.009, uncorrected) and the thalamus (p=0.007, uncorrected) at 100-150 SOA (inhibition conditions) compared to 0-SOA (facilitation condition). In a prime identification task administered after the fMRI experiment, subjects’ performance was at chance levels for primes displayed for 17 ms as in the main study, suggesting that the prime was not consciously perceived. Conclusions: These new findings suggest that automatic and unconscious inhibition of an activated motor response is mediated by the basal ganglia whereas medial frontal regions seem to be more implicated in the control of response conflict related to inhibition. [less ▲]

Detailed reference viewed: 34 (2 ULg)