References of "Unpublished conference/Abstract"
     in
Bookmark and Share    
Peer Reviewed
See detailExperimental and in silico approaches to study the interaction of Remorin with plant plasma membrane : specific interaction of the C-term domain with lipids
Deleu, Magali ULg; Nasir, Mehmet Nail ULg; Gronnier, Julien et al

Conference (2015, September 29)

The function of Remorins, a diverse family of plant-specific proteins (1) is far to be fully elucidated. One of them, StREM1.3 (for Solanum tuberosum Remorin from group 1, homolog 3) has been reported to ... [more ▼]

The function of Remorins, a diverse family of plant-specific proteins (1) is far to be fully elucidated. One of them, StREM1.3 (for Solanum tuberosum Remorin from group 1, homolog 3) has been reported to regulate cell-to-cell propagation of the potato virus X (2). It was also shown to be localized to the inner leaflet of plasma membranes (PMs) and along plasmodesmata, bridges connecting neighbor cells essential for cell-to-cell communication in plants (3). The mechanisms driving StREM1.3 association with PM is still an open question. It was shown recently that a domain of 28 residues at the C-terminus of the potato (RemCA) is required and sufficient for anchoring to the PM (4). Here we combined experimental and in silico biophysics to unravel the molecular bases of RemCA membrane binding. Biomimetic membrane models of plant PM such as monolayers and liposomes were used with various biophysical techniques (Langmuir monolayer technique, Fourier-transformed infrared spectroscopy, circular dichroïsm) and modeling tools (home-made methods and molecular dynamics) (5) to answer to three questions: (i) What is the conformation adopted by RemCA within a membrane?, (ii) Is there any membrane lipid specificity in the RemCA-membrane binding? (iii) What is the role of the two different RemCA domains in the interaction? Results show that RemCA displays a preference for plant phosphoinositide and sitosterol-enriched inner leaflet plasma membrane rafts. Within the membrane, the C-terminal and the N-terminal domains adopt a random coil and a -helical conformation respectively. The C-terminal domain acts as a driver to bind RemCA to the membrane while the N-terminal domain stabilizes the peptide at the membrane. Lysine residues have a crucial importance in this interaction. References (1) Raffaele et al., Plant Physiol., 2007, 145: 593–600 (2) Raffaela et al., Plant Cell, 2009, 21: 1541–1555. (3) Maule, Curr. Opin. Plant Biol., 2008, 11: 680–686. (4) Perraki et al., Plant Physiology, 2012, 160 : 624-637. (5) Deleu et al., Biochim. Biophys. Acta – Biomembranes, 2014, 1838 : 3171-3190. [less ▲]

Detailed reference viewed: 43 (3 ULg)
Full Text
Peer Reviewed
See detailHigh-throughput sequencing of toxins with pharmacological interest: proof of concept and first applications
Echterbille, Julien ULg; Degueldre, Michel ULg; Boulanger, Madeleine ULg et al

Conference (2015, September 28)

Animal venoms are complex chemical cocktails, comprising wide ranges of biologically active reticulated peptides that target with high selectivity and efficacy varieties of membrane receptors. Assuming ... [more ▼]

Animal venoms are complex chemical cocktails, comprising wide ranges of biologically active reticulated peptides that target with high selectivity and efficacy varieties of membrane receptors. Assuming the fact that each of the 170,000 venomous species reported can produce more than 250 bioactive toxins, at least 40,000,000 bioactive peptides and proteins may be discovered. Among the four described species of mambas, Eastern Jameson’s mamba (Dendroaspis jamesonii kaimosae) venom is the less characterized since only 9 peptides are referenced in database. This work aims at developing a new strategy devoted to the deep analysis of animal venoms. Our approach consists in a first separation of the venom using cation exchange chromatography. Each primary fraction is then purified a second time by classical RP-HPLC. A total of 328 fractions, containing amongst 1 and 4 toxins, are finally collected. MALDI-MS analysis of each fraction is done in order (1) to obtain information about masses and (2) to obtain sequences of toxins thanks to MALDI-In Source Decay (ISD) dissociation coupled with on MALDI target plate reduction of the peptides. ISD has already been demonstrated efficient for toxin sequencing1, and especially when using 1,5-DAN as reducing matrix2. ISD yields to sequences that cover more than 50% of peptide sequences by series of singly charged c-type ions. Thanks to this methodology, we were able to obtain 85% of satisfactory results i.e. spectra giving quite long tags of amino acids (up to 20 residues). As a way to validate our method, a tag coming from ISD spectrum interpretation has found a match in database for an Eastern Jameson’s mamba toxin. The global sequence has then been obtained by extrapolation on the ISD spectrum. Since ISD spectra are simpler than classical MS/MS spectra, automation of spectra interpretation, difficult with other fragmentation techniques (CID, ETD…), is implementable. In the near future, sequences obtained with this approach will be used to direct tests of biological activity through sequence homologies with already known ligands for different kinds of membrane receptors. [less ▲]

Detailed reference viewed: 20 (3 ULg)
See detailPsychological benefits of a multidisciplinary rehabilitation program after breast cancer
Leclerc, Anne-France ULg; FOIDART-DESSALLE, Marguerite ULg; Bury, Thierry ULg et al

Conference (2015, September 27)

Background : Breast cancer is the most frequent cancer in women, affecting 8 women out of 100. With early detection and improved treatments, the number of deaths linked to this disease has declined ... [more ▼]

Background : Breast cancer is the most frequent cancer in women, affecting 8 women out of 100. With early detection and improved treatments, the number of deaths linked to this disease has declined. However, the disease and its treatments are at the origin of many undesirable side effects such as fatigue, anxiety, weight gain and sleep disorders. The objective of this study is to determine the psychological benefits of a multidisciplinary rehabilitation program among women treated for breast cancer (on average six months after the end of the adjuvant radiotherapy or chimiotherapy). Material and methods : 122 patients were included into a control group (n = 61) and a treated group (n = 61). All participants were submitted to evaluations before the beginning of the trial and after three months. These evaluations included different questionnaires exploring the quality of life, anxiety, depression and various functions and other symptoms related to cancer (EORTC QLQ-C30, EQ-5D, STAI, HADS) and functional assessments. The control group has received no intervention unlike the treated group that received a three-month rehabilitation including supervised physical training (90 min) with three times a week and various psycho-educational sessions (120 min) once a week. Results : After three months, the health status (quality of life) (p < 0,0001), the functional role (p = 0,031), emotional state (p < 0,0001) and physical (p = 0,0045), cognitive (p = 0,0027) and social functions (p = 0,0018) improve significantly in the treated group. This observation also applies to symptoms of fatigue (p < 0,0001), insomnia (p < 0,0001), pain (p = 0,002), dyspnea (p = 0,009), loss of appetite (p = 0,04), anxiety (p < 0,0001) and depression (p < 0,0001) as well as physical parameters obtained through functional assessments. In the control group, these improvements do not appear. Conclusions : This study shows the feasibility and psychological benefits of such a multidisciplinary oncological rehabilitation program in women after their treatments for breast cancer. Additional studies are needed to know the optimal time of beginning (during treatments or after them) and the optimal management time for this support. [less ▲]

Detailed reference viewed: 53 (19 ULg)
Full Text
See detailHypoxic ischemic encephalopathy : new insights in neuroprotection
VIELLEVOYE, Renaud ULg

Conference (2015, September 26)

Hypoxic-ischemic encephalopathy (HIE) is a major contributor to neonatal morbidity and mortality and is a common cause of disability with devastating impact on individuals and families. During the acute ... [more ▼]

Hypoxic-ischemic encephalopathy (HIE) is a major contributor to neonatal morbidity and mortality and is a common cause of disability with devastating impact on individuals and families. During the acute phase, HIE is initially characterized by an excitotoxic cascade with hypoxic membrane depolarization, cytotoxic edema, glutamate release and intracellular accumulation of calcium leading to necrotic cell death and production of proinflammatory cytokines through the NF-κB pathway. In a second phase, reperfusion leads to production of free radicals, activation of proteases and phospholipases, exacerbing the damage to cell membrane and DNA and mitochondrial dysfunction causing caspase mediated apoptotic cell death. In a third phase, growth factors and inflammatory cytokines produced during the early phase of HIE attempt to repair damage induced by hypoxia–ischemia. Although the utility of therapeutic hypothermia induced in the 6 hours following HIE in the reduction of death or major neurodevelopmental disability is now well established in the neonate with moderate or severe encephalopathy, almost half of these children still die or have abnormal outcomes [1]. Protocols attempting to optimize cooling with deeper hypothermia (33.5°C vs 32.0°C) and/or longer duration (72h vs 120h), as well protocols studying neuroprotective effect of late hypothermia (6-24h) or hypothermia for 33-35 week GA preterm babies are currently performed. Furthermore, experimental data suggest that hypothermia extends the duration of the therapeutic window [2] and that certain drugs given during this time may improve neuroprotection either additively or synergistically. Xenon is a noble gas with anaesthetic and neuroprotective properties. It inhibits NMDA receptor, promotes cell survival and induces the production of erythropoietin and vascular endothelial growth factor through the hypoxia inducible factor 1 alpha (HIF-1α) pathway. Data from experimental piglet models of hypoxia-ischemia (HI) demonstrate a synergy when Xenon is administered in combination with mild therapeutic hypothermia [3]. In the human newborn, a phase-1 trial recently established that breathing 50% Xenon for up to 18 hours with 72 hours of cooling was feasible, with no adverse effects seen with 18 months’ follow-up [4]. A monocentric phase-3 trial is currently under process in England. Melatonin is a remarkable natural antioxidant but also exhibits antiapoptotic and anti-inflammatory properties in vitro. In animal models, melatonin administration prior or after the onset of HI significantly reduced infarct volume demonstrating both prophylactic and therapeutic effect [5-6]. When combined with hypothermia, melatonin enhances neuroprotection by reduction of the H–I-induced increase in clinically relevant biomarkers in the deep grey matter of newborn piglets [7]. Clinical studies confirmed its safety profile and its ability to reduce biomarkers level of HI in the human newborn [8]. Recently, a randomized controlled trial showed that the combination of melatonin and hypothermia administered to infants with moderate-to-severe H–I brain injury was efficacious in reducing oxidative stress, neonatal seizures and MRI brain lesions as well as in improving neurological outcomes at 6 months of age [9]. Erythropoietin (EPO) and its receptor are expressed in the developing central nervous system and are required for normal brain development. EPO is up-regulated in umbilical cord blood from babies who have suffered HI, which may be an endogenous repair mechanism. In vitro and in vivo neuroprotection induced by EPO is achieved by several mechanisms such as direct neurotrophic effect, direct antioxidant effects, decreased inflammation or regulation between pro-apoptotic and anti-apoptotic factors. Safety profile of EPO administration during hypothermia for newborns with HIE has been established in Phase I trials [10]. In a randomized prospective pase-2 trial, repeated low-dose rEPO reduced the risk of disability for infants with moderate but not severe HIE at 18 months, without apparent side effects [11]. A double-blind randomized controlled phase-3 trial is currently performed in France. Allopurinol is a xantine-oxidase inhibitor. In high concentrations it also scavenges hydroxyl radicals and prevents free radical formation. Allopurinol provides neuroprotection in rat and piglets models of HIE. In the human, a systematic review and meta-analysis of three studies on 114 newborns did not reveal statistically difference in the risk of death or a composite of death or severe neurodevelopmental disability between groups [12]. It was hypothesized that postnatal allopurinol treatment started too late to reduce reperfusion-induced free radical surge. However, in a recent study, allopurinol given to mothers during labor with fetal hypoxia did not significantly lower neuronal damage markers in cord blood even if post hoc analysis revealed a potential beneficial treatment effect in girls [13]. Magnesium sulfate (MgSO4) is a naturally occurring NMDA receptor antagonist. MgSO4 given to mothers at risk for preterm birth is associated with a reduced risk of cerebral palsy and gross motor dysfunction in their children. Its role as an adjuvant to therapeutic hypothermia in the asphyxiated term infant remains unclear. A recent review of preclinical studies using MgSO4 in HIE highlights the inconsistent impact between studies related to a lack of temperature control during and after HI, along with variability in the dose, timing of treatment [14]. A metaanalysis of five randomized controlled trials that compared magnesium to control in newborns with HIE showed a significant improvement in short term outcomes but no difference in the composite outcome of death or moderate to severe disability at 18 months [15]. Other NMDA and AMPA antagonist such as topiramate and memantine also exhibited neuroprotective properties in animal models but safety and efficacy in the human newborn with HIE still needs to be clarified [16]. N-acetyl cysteine (NAC) acts as a glutathione precursor with antioxidant, antiapoptotic, and anti-inflammatory properties. In a piglet model of HIE, NAC reduced cerebral oxidative stress, reduced cerebral lactate accumulation and improved cerebral perfusion. When combined with hypothermia in the asphyxiated rodent, NAC decreased infarct volume, improved myelin expression and functional outcomes on a synergistic pattern. NF-κB inhibitors and NO synthase inhibitors are other therapeutic options currently under investigation in in vitro and in vivo preclinical studies. Moreover, recent research performed at the University of Liege also suggests that Estetrol (E4), an estrogen synthetized exclusively by the human foetus, has neuroprotective properties in a rat model of HIE. Translation to clinical use in humans still needs to be studied [17]. Several therapies have also been suggested in order to improve mechanisms of repair and regeneration observed after the HI insult. Growth factors such as BDNF, IGF-1, EGF or bFGF can improve cell viability, stimulate the growth of new neurons or promotes oligodendroglial differentiation and myelination. Recent advances in regenerative medicine suggest that stem cell transplantation may improve repair of the damaged brain after HIE through the replacement of dead cells as well as through the release of trophic factors [18]. Animal preclinical data are promising. However many questions need to be answered with well-designed controlled trials before clinical application in daily practice. References [1] Edwards AD et al. (2010) Neurological outcomes at 18 months of age after moderate hypothermia for perinatal hypoxic ischaemic encephalopathy: synthesis and meta-analysis of trial data. BMJ. 340:c363. [2] O'Brien F et al. (2006) Delayed whole-body cooling to 33 or 35 degrees c and the development of impaired energy generation consequential to transient cerebral hypoxia-ischemia in the newborn piglet. Pediatrics 117:1549–59. [3] Chakkarapani, E. et al. (2010) Xenon enhances hypothermic neuroprotection in asphyxiated newborn pigs. Ann. Neurol. 68, 330–341 [4] Dingley, J. et al. (2014) Xenon ventilation during therapeutic hypothermia in neonatal encephalopathy: a feasibility study. Pediatrics 133, 809–818 [5] Carloni, S. et al. (2008) Melatonin protects from the long-term consequences of a neonatal hypoxic–ischemic brain injury in rats. J. Pineal. Res. 44, 157–164 [6] Hutton, L.C. et al. (2009) Neuroprotective properties of melatonin in a model of birth asphyxia in the spiny mouse (Acomyscahirinus). Dev. Neurosci. 31, 437–451 [7] Robertson, N.J. et al. (2013) Melatonin augments hypothermic neuroprotection in a perinatal asphyxia model. Brain 136, 90–105 [8] Fulia, G. et al. (2001) Increased levels of malondialdehyde and nitrite/nitrate in the blood of asphyxiated newborns: reduction by melatonin. Journal of Pineal Research; 31(4):343–349. [9] Aly, H. et al. (2015) Melatonin use for neuroprotection in perinatal asphyxia: a randomized controlled pilot study. J. Perinatol. 35, 186–191 [10] Wu, Y.W. et al. (2012) Erythropoietin for neuroprotection in neonatal encephalopathy: safety and pharmacokinetics. Pediatrics 130, 683–691 [11] Zhu, C. et al. (2009) Erythropoietin improved neurologic outcomes in newborns with hypoxic–ischemic encephalopathy. Pediatrics 124, 218–226 [12] Chaudhari, T. and McGuire, W. (2012) Allopurinol for preventing mortality and morbidity in newborn infants with hypoxic–ischaemic encephalopathy. Cochrane Database Syst. Rev. 7, Cd006817 [13] Kaandorp, J.J. et al. (2015) Maternal allopurinol administration during suspected fetal hypoxia: a novel neuroprotective intervention? A multicentre randomised placebo controlled trial. Arch. Dis. Child Fetal Neonatal Ed. 100, F216–F223 [14] Galinsky, R. et al. (2014) Magnesium is not consistently neuroprotective for perinatal hypoxia-ischemia in term-equivalent models in preclinical studies: a systematic review. Dev. Neurosci. 36, 73–82 [15] Tagin, M. et al. (2013) Magnesium for newborns with hypoxic–ischemic encephalopathy: a systematic review and meta-analysis. J. Perinatol. 33, 663–669 [16] Wu, Q et al. (2015) Neuroprotective agents for neonatal hypoxic–ischemic brain injury. Drug Discovery Today. [17] Tskitishvili, E et al. (2014). Estetrol attenuates neonatal hypoxic–ischemic brain injury. Experimental Neurology, 261, 298-307. [18] Kelen, D and Robertson, NJ. (2010) Experimental treatments for hypoxic ischaemic encephalopathy. Early Human Development 86; 369–377. [less ▲]

Detailed reference viewed: 29 (0 ULg)
See detailPhysicochimie de la pollution atmosphérique
Mahieu, Emmanuel ULg

Conference (2015, September 25)

Detailed reference viewed: 20 (5 ULg)
Peer Reviewed
See detailHabitants des petites villes et des villages face à la nature dans les paysages ordinaires
Vanderheyden, Vincent ULg

Conference (2015, September 25)

La recherche sur les perceptions paysagères dénigre souvent les paysages ordinaires, ces paysages modifiés par l’homme qui n’appellent pas à la protection. Pourtant, dans les régions de forte densité de ... [more ▼]

La recherche sur les perceptions paysagères dénigre souvent les paysages ordinaires, ces paysages modifiés par l’homme qui n’appellent pas à la protection. Pourtant, dans les régions de forte densité de population comme la Belgique, les paysages naturels sont rares ou inexistants, sans pour autant que la nature ait disparu des paysages ordinaires. Il est donc intéressant de se poser la question de la nature dans de tels paysages : à partir de quand un paysage est-il perçu comme naturel par ceux qui l’observent ou y vivent ? Les critères dépendent-ils du mode d’habiter (petite ville, village périurbain ou village rural) ou d’autres facteurs liés à la trajectoire biographique des gens ? Trois terrains d’études ont été retenus pour la recherche : la Wallonie picarde, l’Entre-Sambre et Meuse et l’Ardenne. Ces terrains offrent des paysages ruraux assez typés et suffisamment différenciés et éloignés des grandes agglomérations urbaines, hormis Tournai, ville d’envergure régionale. La Wallonie picarde présente des paysages de vastes plateaux agricoles limoneux au relief plan et peu élevé, occasionnellement surplombé de petites collines. L’Entre-Sambre-et-Meuse offre des paysages mixtes, alternant cultures, prairies et boisement dans un relief plus accidenté d’altitude moyenne. Enfin, l’Ardenne, troisième terrain, montre des paysages de hauts plateaux disséqués, dominés par les massifs forestiers et les pâturages. Ces terrains offrent un bel aperçu du continuum urbain-rural belge : de la petite ville en milieu rural au semis d’habitat très lâche du village ardennais, loin de l’habituelle dichotomie ville - campagne. Dans ces terrains, une approche empirique a été privilégiée. Nous y avons interviewé trois groupes de neuf étudiants (18-25 ans) d’un niveau d’éducation moyen (Bac +1 à Bac +3), non spécialistes en analyse du paysage, habitant dans de petites villes ou villages et un de leurs parents. Durant l’enquête, les personnes devaient classer des photos de paysages ruraux belges plus ou moins impactés par la présence de l’homme (habitat, cultures, éoliennes, pylônes, zones périurbaines) puis devaient motiver leur classement. Les entretiens ont été enregistrés, retranscrits et codés à l’aide d’un logiciel d’analyse qualitative. L’analyse de contenu montre des résultats contrastés. Un certain consensus indépendant du mode d’habiter semble se dégager concernant la présence d’éléments anthropiques récents, tels quel les éoliennes, les zones industrielles ou les pylônes électriques : cela participe à la dénaturation d’un paysage, avec une subtile nuance pour les éoliennes, où la symbolique positive écologique peut pour certains contrebalancer la perte de naturalité induite. Chez des personnes vivant dans un milieu plus urbanisé, le paysage naturel attire, car il change des habitudes de vie. Certains n’hésitent pas à qualifier un paysage de naturel pour peu qu’il contienne suffisamment de végétation, fusse une vaste étendue agricole dédiée à la monoculture. Chez des personnes vivant dans des milieux très ruraux par contre, on ne constate pas toujours la tendance inverse : même la petite ville voisine semble parfois trop urbanisée à leurs yeux pour y vivre. A leurs yeux, les paysages deviennent moins attractifs au fur et à mesure que la densité du bâti devient perceptible. Plus qu’une analyse du visuel, cette recherche montre également que les gens s’imaginent être dans le paysage, entendant les bruits ou ressentant une perte de convivialité à mesure que le paysage s’industrialise ou se remplit de maisons. [less ▲]

Detailed reference viewed: 21 (4 ULg)
See detailEn tous quartiers ou j’ay esté. Le récit de pèlerinage de Georges Lengherand, mayeur de Mons (1486–1487)
Bruwier, Marie-Cécile; Docquier, Gilles; Marchandisse, Alain ULg

Conference (2015, September 25)

Detailed reference viewed: 14 (2 ULg)
See detailBaltic seagrass meadows as a sediment carbon sink
Jankowska, Emilia; Włodarska-Kowalczuk, Maria; Michel, Loïc ULg et al

Conference (2015, September 25)

Detailed reference viewed: 5 (0 ULg)
Full Text
See detailOn generalized Hölder spaces
Kreit, Damien; Nicolay, Samuel ULg

Conference (2015, September 24)

We introduce generalized pointwise Hölder spaces as the point wise version of generalized uniform Hölder spaces. These last ones can be seen as a special case of generalized Besov spaces.

Detailed reference viewed: 17 (2 ULg)
See detailMedicinal plants, malaria and biotechnology
Frederich, Michel ULg; Jansen, Olivia ULg; Muganga, Raymond et al

Conference (2015, September 24)

The first part of the talk will be dedicated to the investigation of medicinal plants with the objective to identify new antimalarial treatments. According to the last World Malaria Report [1], there were ... [more ▼]

The first part of the talk will be dedicated to the investigation of medicinal plants with the objective to identify new antimalarial treatments. According to the last World Malaria Report [1], there were 584 000 deaths for 198 millions malaria cases worldwide in 2013. Particularly, the disease caused an estimated 437 000 African children died before their fifth birthday, still in 2013. Malaria is caused by a parasite, Plasmodium sp. and transmitted by Anopheles mosquitoes. The problem of parasite resistance towards common available medicines such as chloroquine, mefloquine, quinine, is increasing. In this context, the vegetal kingdom remains the main source of pharmacologically active compounds against this parasitic infection as attested by the famous quinine, isolated from Cinchona sp., artemisinin extracted from Artemisia annua and also atovaquone derived from lapachol found in several Bignoniaceae. All these substances are related to plants with traditional use against fever and malaria. Beside these well-known examples, various new antiplasmodial compounds are frequently discovered from Nature, particularly following an ethnopharmacological approach, as reviewed by several authors in recent years [2-6]. Then, the pharmacological and phytochemical study of plants from traditional pharmacopoeias can be of first interest not only to discover new antimalarial “lead compounds”, but also to valorize local vegetal species whose efficacy and safety would have been demonstrated in laboratory and by clinical investigations [7,8]. Some results obtained with Dicoma tomentosa from Burkina-Faso [9] and Terminalia mollis from Rwanda [10] will be presented. In the second part of the talk, two applications of biotechnology for the production of artemisinin and paclitaxel and then some works developed at the ‘Université de la Réunion’ will be presented. In the framework of this collaboration, Psiadia arguta, an endemic plant from Reunion Island, which is known to have cytotoxic, anti-plasmodial and anti-inflammatory properties, was subjected to micropropagation. The objective of the work was to compare the biological properties and the phytochemical composition of callus, vitroplants and acclimatized plants of Psiadia arguta [11]. 1. WHO, World Malaria Report 2014, December 2014, Geneva (http://www.who.int/malaria/publications/world_malaria_report_2014/en/). 2. Batista R, Silva Ade J Jr, de Oliveira AB: Plant-derived antimalarial agents: new leads and efficient phytomedicines. Part II. Non-alkaloidal natural products. Molecules 2009, 14:3037-72. 3. Bero J, Frédérich M, Quetin-Leclercq J : Antimalarial compounds isolated from plants used in traditional medicine. Journal of Pharmacy and Pharmacology 2009, 61:1401–1433. 4. Bero J and Quetin-Leclercq J: Natural products published in 2009 from plants traditionally used to treat malaria. Planta Medica 2011, 77:631-40. 5. Kaur K, Jain M, Kaur T, Jain R: Antimalarials from nature. Bioorganic & Medicinal Chemistry 2009, 17:3229–3256. 6. Nogueira CR and Lopes LMX: Antiplasmodial Natural Products. Molecules 2011, 16:2146-2190 7. Ginsburg H and Deharo E: A call for using natural compounds in the development of new antimalarial treatments – an introduction. Malaria Journal 2011, 10 (suppl. 1):S1 8. Willcox M, Graz B, Falquet J, Diakite C, Giani S, Diallo D: A “reverse pharmacology” approach for developing an antimalarial phytomedicine. Malaria journal 2011, 10(suppl1):S8 9. Jansen, O., Tits, M., Angenot, L., Nicolas, J.-P., De Mol, P., Nikiema, J.-B., & Frédérich, M : Anti-plasmodial activity of Dicoma tomentosa (Asteraceae) and identification of urospermal A-15-O-acetate as the main active compound. Malaria Journal 2012, 11, 289. 10. Muganga, R., Angenot, L., Tits, M., & Frédérich, M : In vitro and in vivo antiplasmodial activity of three Rwandan medicinal plants and identification of their active compounds. Planta Medica 2013, 80(6), 482-489. 11. Mahy Justine, Comparative study of biological activities and analysis of volatile compounds of Psiadia arguta in various cultures: vitroplants and acclimatized plants. Mémoire de M2, 2013, Université de Liège/Université de la Réunion. [less ▲]

Detailed reference viewed: 79 (3 ULg)
Full Text
Peer Reviewed
See detailPerformances of a simple exhaust mechanical ventilation coupled to a mini heat pump: modeling and experimental investigations
Ransy, Frédéric ULg; Gendebien, Samuel ULg; Lemort, Vincent ULg

Conference (2015, September 24)

According to the European directive 2012/27/EU of October 2012 on energy efficiency, buildings represented 40 % of the EU’s final energy consumption in 2011. The major part of this energy consumption is ... [more ▼]

According to the European directive 2012/27/EU of October 2012 on energy efficiency, buildings represented 40 % of the EU’s final energy consumption in 2011. The major part of this energy consumption is due to the residential sector for space heating and domestic hot water production. Moreover, buildings are crucial to achieve the EU objective of reducing greenhouse gas emissions by 80-95 % by 2050 compared to 1990. In order to reduce these greenhouse gas emissions, retrofit measures regarding insulation and air-tightness have to be taken. However, such improvements of the building envelope lead to a relative increase in consumption related to ventilation. Indeed, according to Orme (2001), Roulet et al. (2001) and Fouih et al. (2012), the heating demand due to ventilation can reach more than 50 % of the total building heating demand for new and retrofitted buildings. To reduce the energy consumption due to ventilation, exhaust air heat pumps (EAHPs) can be used instead of the traditional heat recovery with an air-to-air heat exchanger. EAHPs recover heat from the exhaust air of the ventilation system to produce domestic hot water and space heating. According to Fehrm et al. (2002), this technology is already widely used in the northern countries such as Germany and Sweden. In fact, according to Fracastoro et al. (2010), efficiencies of EAHPs are higher than those obtained with outside air or geothermal heat pumps in certain conditions, whatever the climate location. Berg et al. (2010) have monitored three houses in Sweden equiped with exhaust air heat pumps. The seasonal performance factor (SPF) values were all within the range 1.4-1.7. This factor takes into account the energy consumption of the heat pumps and the auxiliary heating systems. A 17 kW exhaust air heat pump has also been tested by Mikola et al. (2014). The measured SPF for the heat pump only (without taking into account the auxiliary heating system) was about 2.9-3.4 in winter and 3 in the summer. Exhaust air heat pumps coupled with simple exhaust mechanical ventilation systems have many advantages compared to traditional balanced systems with heat recovery: • Only one fan is necessary and the duct system is simpler. Consequently, EAHPs are suitable for retrofitted buildings. • The heat pump can provide the whole part of the heating demand related to domestic hot water and 50 % of the heating demand related to space heating, according to Fracastoro et al. (2010). • The heat pump can also provide active cooling by inversing the refrigerating cycle. • The heat pump performance is high and remains constant with outdoor temperature changes since the temperature of the heat sink is constant (20°C). As a result, the system is cost-effective. • The system is compact, quiet and requires little maintenance. In the present paper, the energetic performances of an exhaust air heat pump are assessed through numerical and experimental studies. The thermal capacity of the machine is 1.5 kW when the inside air temperature is 20°C and the outside water temperature is 35°C. The heat pump is therefore ideally suited for new or retrofitted buildings. The system including a mechanical exhaust ventilation system and an exhaust air heat pump is first presented. Secondly, the heat pump model used afterwards to determine the heat pump seasonal performance factor is described. Thirdly, the model is calibrated to fit the measurement data. Finally, the heat pump model is coupled to a building model to determine the annual performance of the system. The system is compared to a traditional balanced ventilation system with heat recovery in terms of primary energy consumption, for different heating and DHW production systems (electric heater, heat pump, gas condensing boiler). [less ▲]

Detailed reference viewed: 69 (25 ULg)
Full Text
See detailVALIDATION RELEVANCE OF ANALYTICAL METHODS IN BIOTECHNOLOGY
Marini Djang'Eing'A, Roland ULg; Hubert, Philippe ULg

Conference (2015, September 24)

Detailed reference viewed: 21 (1 ULg)
See detailPerformances analytiques d’un biomarqueur : dialogue
CAVALIER, Etienne ULg

Conference (2015, September 23)

Detailed reference viewed: 9 (1 ULg)
Full Text
See detailStratospheric HCl increasing again, caused by dynamic variability, driven by increased tropopsheric wave activity
Notholt, J; Mahieu, Emmanuel ULg; Pfloeger, F et al

Conference (2015, September 22)

Detailed reference viewed: 17 (1 ULg)
See detailAir-sea ice gases exchange: update of recent findings, outcomes from sea ice models, caveats and open questions
Delille, Bruno ULg; Zhou, Jiayun; Kotovitch, Marie ULg et al

Conference (2015, September 21)

There are growing evidences that sea ice exchanges climate gases with the atmosphere. We will rapidly present a state of the art of current large scale assessment of spring and summer uptake of ... [more ▼]

There are growing evidences that sea ice exchanges climate gases with the atmosphere. We will rapidly present a state of the art of current large scale assessment of spring and summer uptake of atmospheric CO2. We will challenge these assessments with 1) new evidence of significant winter CO2 release for winter experiments 2) new finding of the role of bubbles formation and transport within sea ice and 3) impurities expulsion derived from combined artificial ice experiment and modelling. Finally, comparison of air-ice fluxes derived from automated chamber and micrometeorological method and, mechanistic and box models show significant discrepancies that suggest that the contribution of sea ice to the air-ocean fluxes of CO2 remain an open question. We will also highlight that sea ice contribute to the fluxes of other gases as CH4 ,N2O and DMS [less ▲]

Detailed reference viewed: 20 (4 ULg)
See detailPathways of recurrent high-grade squamous intraepithelial lesions of the cervix
Herfs, Michael ULg

Conference (2015, September 20)

Detailed reference viewed: 9 (1 ULg)
Peer Reviewed
See detailNon-invasive markers: the role of G-CSF?
Munaut, Carine ULg

Conference (2015, September 19)

Detailed reference viewed: 4 (0 ULg)
See detailNid de coucou. De quelques performances filmées dans l'espace public.
Hamers, Jérémy ULg

Conference (2015, September 18)

Detailed reference viewed: 22 (1 ULg)
Full Text
See detailThe importance of physical educators’ representations about physical activity
Cloes, Marc ULg

Conference (2015, September 18)

Physical education (PE) teachers need to develop clear representaitons about physical activity (PA). In fact, they have to promote an active lifestyle among their pupils/students and it will not be ... [more ▼]

Physical education (PE) teachers need to develop clear representaitons about physical activity (PA). In fact, they have to promote an active lifestyle among their pupils/students and it will not be possible without developing an extended knowledge about physical activity. This presentation has been designed in order to make the PE teachers and their trainers that their representations about PA could be worse than they believe. Moreover, the interactive way of this presentation will provide an interesting example of an approach that could be used on the field. [less ▲]

Detailed reference viewed: 41 (2 ULg)
Full Text
Peer Reviewed
See detailDietary mineral intakes of young Tibetan children living in areas endemic for Kashin-Beck disease: preliminary results of a cross-sectional survey
DERMIENCE, Michael ULg; Mathieu, Françoise; Li, Xiaowei et al

Conference (2015, September 18)

Kashin-Beck disease (KBD) is an endemic and chronic osteochondropathy whose etiology remains unclear. Environmental factors are assumed to be involved, among which the selenium and iodine deficiency is ... [more ▼]

Kashin-Beck disease (KBD) is an endemic and chronic osteochondropathy whose etiology remains unclear. Environmental factors are assumed to be involved, among which the selenium and iodine deficiency is frequently cited. The prevalence rate may be high in some rural areas of the Tibet Autonomous Region. The diet of the rural community is significantly different from the other communities (nomads and city-dwellers), who remains unaffected by KBD. Because their foods are mainly derived from local agriculture and artisanal production, their mineral composition may show significant discrepancies when compared with food composition data. The present survey aims at assessing the mineral dietary intakes of young Tibetan children living in rural areas endemic for the Kashin-Beck disease. A cross-sectional survey enrolling 250 children was carried out. The intakes were recorded for two days, on two different seasons, by the 24-hour food recall method. The minerals investigated were selected for their implication in bone metabolism and a specific food composition table was compiled from the China Food composition (book 1, 2nd edition), the USDA Food search for Windows (Version 1.0, Database version SR23), and a broad investigation on mineral composition of local and traditional Tibetan foods (Dermience et al., 2014). The calculation of daily intakes for the first season is now complete and some trends are emerging. Preliminary results suggest, inter alia, that the intakes of calcium are too low with unfavorable calcium to phosphorus ratio. On the contrary, sodium and manganese intakes are too high and could exceed tolerable upper levels. [less ▲]

Detailed reference viewed: 22 (3 ULg)
Full Text
See detailInnovation in Veterinary Education. Innovative tools to teach pregnancy and parturition in the horse.
Hanzen, Christian ULg; Govaere, Jan

Conference (2015, September 18)

Detailed reference viewed: 77 (2 ULg)
Full Text
Peer Reviewed
See detailSoluble biomarkers in OA: can they be used as indicator of HA re-injection?
Henrotin, Yves ULg

Conference (2015, September 18)

Detailed reference viewed: 14 (0 ULg)
Full Text
See detailGeophysics for the quantification of water fluxes in the soil-plant system
Garré, Sarah ULg; Binley, Andrew

Conference (2015, September 17)

Detailed reference viewed: 22 (0 ULg)
See detailStability and Aging of Phase Change Materials : An Ab Initio Perspective
Raty, Jean-Yves ULg

Conference (2015, September 17)

Data recording with Phase Change Materials is a much studied topic as the writing/erasing characteristics, cyclability and downscaling properties of these materials allow for efficient data storage in ... [more ▼]

Data recording with Phase Change Materials is a much studied topic as the writing/erasing characteristics, cyclability and downscaling properties of these materials allow for efficient data storage in future generations of devices. Nevertheless, some aspects of phase change materials are limiting their performances and delaying their wider technological application. First, aging phenomena are common to all amorphous structures, but of special importance PCMs since it impedes the realization of multi-level memories. Different interpretations have been proposed, but we focus here on the structural relaxation of amorphous GeTe, chosen because it is the simplest system that is representative of the wider class of GST alloys, lying along the GeTe-Sb2Te3 composition line of the GeSbTe phase diagram. One difficulty encountered in the simulation of these amorphous systems is that the direct generation of an amorphous structure by quenching a liquid using Density Functional Theory (DFT) based Molecular Dynamics leads to one sample with a small number of atoms, and, hence of small number of atomic environments. Here we sample a large number of local atomic environments, corresponding to different bonding schemes, by chemically substituting different alloys, selected to favor different local atomic structures. This enables spanning a larger fraction of the configuration space relevant to aging. Our results support a model of the amorphous phase and its time evolution that involves an evolution of the local (chemical) order towards that of the crystal. On the other hand its electronic properties drift away from those of the crystal, driven by an increase of the Peierls-like distortion of the local environments in the amorphous, as compared to the crystal [1]. A second problem faced by PCMs is the fact that data recording is limited at high temperature due to the increased propensity to recrystallize. One approach to counter this is to stabilize the PCM using impurity atoms such as C or N. Using DFT and the analysis of the mechanical properties (constraints theory), we demonstrate how these impurity atoms modify the rigidity of the network, which is experimentally correlated with the activation energy for crystallization [2]. Finally, the crystal phase itself has been shown to have variable conductivities depending on the thermal history and annealing conditions. If this could be used profitably for multi-level recording, it also indicates that the crystal is undergoes some temporal evolution. Using DFT, we clarify the stability behavior of GST crystal and show that the metal-insulator transition is driven by the migration of intrinsic vacancies and an Anderson localization transition [3]. [1] J.Y Raty, W. Zhang, J. Luckas, C. Chen, R. Mazzarello, C. Bichara and M. Wuttig, Nat. Comm. (2015) [2] G. Ghezzi, J.Y. Raty, S. Maitrejean, A. Roule, E. Elkaim and F. Hippert, Applied Physics Letters, 99 (2011) 151906 [3] W. Zhang, A. Thiess, P. Zalden, R. Zeller, P. H. Dederichs, J-Y. Raty, M.Wuttig, S. Blügel et R. Mazzarello, Nature Materials 11 (2012) 952 [less ▲]

Detailed reference viewed: 67 (4 ULg)
Full Text
See detailBien soigner l'arthrose: un enjeu capital pour notre société!
Henrotin, Yves ULg

Conference (2015, September 17)

Detailed reference viewed: 16 (0 ULg)
See detailSurgir dans le paysage urbain. Analyse sociocritique du projet Selfiecity
Hagelstein, Maud ULg

Conference (2015, September 17)

Mon intérêt pour le selfie s’inscrit dans le cadre d’une réflexion plus large sur la photographie vernaculaire (ou commune – au double sens du terme), c’est-à-dire celle qui n’est ni professionnelle, ni ... [more ▼]

Mon intérêt pour le selfie s’inscrit dans le cadre d’une réflexion plus large sur la photographie vernaculaire (ou commune – au double sens du terme), c’est-à-dire celle qui n’est ni professionnelle, ni explicitement artistique. Le selfie est un outil visuel qui me semble pouvoir bien fonctionner avec la thématique de l’espace urbain : *le selfie travaille à la mise en scène d’un sujet dans un contexte au sein duquel il s’implique, le sujet ayant ceci de particulier qu’il se constitue à la fois comme observateur d’une scène, opérateur de l’image (= opérateur de la représentation de cette scène) et comme figurant de celle-ci (partie de son contenu). *En tant qu’il indique donc bien souvent une interaction entre un sujet et son environnement (spatial, social), le selfie pourrait être un bon indicateur du rapport de figuration, d’intégration, liant l’homme à son espace urbain (direct ou indirect). Il m’intéressera ici pour une seconde raison (dont les enjeux sont plus directement politiques) : puisque le dispositif est relativement nouveau, en développement, le selfie peut servir en quelque sorte de laboratoire dans lequel on pourrait observer la constitution de normes formelles. Autrement dit, la nouveauté de cette forme d’expression lui permet d’échapper relativement (et sans doute provisoirement) à l’inévitable institutionnalisation progressive que connaît généralement l’art urbain. [less ▲]

Detailed reference viewed: 35 (1 ULg)
Full Text
See detailUse of dual carbon-chlorine isotope analysis to identify degradation pathways of 1,1,1-trichloroethane in groundwater
Palau, Jordi; Jamin, Pierre ULg; Badin, Alice et al

Conference (2015, September 17)

The high susceptibility of chlorinated aliphatic hydrocarbons (CAHs) like 1,1,1-trichloroethane (1,1,1-TCA) to be transformed via different competing pathways (biotic and abiotic) complicates the ... [more ▼]

The high susceptibility of chlorinated aliphatic hydrocarbons (CAHs) like 1,1,1-trichloroethane (1,1,1-TCA) to be transformed via different competing pathways (biotic and abiotic) complicates the assessment of their fate in groundwater. This knowledge is necessary to evaluate contaminant degradation and potential formation of toxic intermediates. Identifying pathways is further complicated in sites contaminated by mixed CAHs because some degradation products of 1,1,1-TCA can be formed from different precursors. Here, identification of pathways based solely on substrate-product concentration relationships may lead to ambiguous interpretations. This study investigates, for the first time, dual C−Cl isotope fractionation as a means of identifying and assessing degradation pathways of 1,1,1-TCA in groundwater. Distinctly different dual isotope trends (L = Δδ13C/Δδ37Cl) were observed for 1,1,1-TCA transformation via oxidation with heat-activated persulfate (L = ∞), reduction with zerovalent iron (L = 1.5 ± 0.1), hydrolysis and dehydrohalogenation (HY/DH, L = 0.33 ± 0.04) in laboratory experiments, illustrating the potential of a dual isotope approach. This approach was evaluated in an aerobic aquifer impacted by 1,1,1-TCA and trichloroethylene (TCE) with concentrations of up to 20 mg/L and 3.4 mg/L, respectively. For 1,1,1-TCA, the dual isotope slope determined from field samples (L = 0.6 ± 0.2, r2 = 0.75) was close to the slope observed for HY/DH in the laboratory (L = 0.33 ± 0.04), indicating that HY/DH was the predominant degradation pathway of 1,1,1-TCA in the aquifer. The observed deviation could be explained by a minor contribution of additional degradation processes. This result, along with the little degradation of TCE determined from isotope measurements, confirmed that 1,1,1-TCA was the main source of the 1,1-dichlorethylene (1,1-DCE) detected in the aquifer with concentrations of up to 10 mg/L. This study demonstrates that a dual C-Cl isotope approach can strongly improve the qualitative and quantitative assessment of 1,1,1-TCA degradation processes in the field. [less ▲]

Detailed reference viewed: 33 (4 ULg)
See detailAnalytical performance of a biomarker: what the clinician should know
CAVALIER, Etienne ULg

Conference (2015, September 17)

Detailed reference viewed: 10 (0 ULg)
See detailPriniples of Voice production
Finck, Camille ULg

Conference (2015, September 17)

Detailed reference viewed: 3 (0 ULg)
Full Text
See detailThe system of sanctions for the illicit trade of nuclear goods
Colussi, Ilaria Anna ULg

Conference (2015, September 17)

In the area of nuclear non proliferation, the illicit trade of goods that could be used to create nuclear weapons cannot be neglected. Indeed, many States and non-States actors seeking nuclear weapons or ... [more ▼]

In the area of nuclear non proliferation, the illicit trade of goods that could be used to create nuclear weapons cannot be neglected. Indeed, many States and non-States actors seeking nuclear weapons or wanting to maintain existing nuclear weapons arsenals or capabilities look for obtaining, acquiring and transporting in their own States or locations dual-use technologies, items and materials. This entails a chain of “actors”: (a) the suppliers of goods, (b) a procurement organization, (c) a trade company for the procurement of goods, (d) intermediaries in transport, and (e) banks which could finance the operations. Therefore, a set of measures for preventing the illicit trade, and for sanctioning the occurred one, need to be defined. The paper aims at focusing on the “sanctioning” phase for illicit trade of dual-use nuclear items. It analyses the set of sanctions established at the international and European Union level, precisely the economic sanctions (e.g.: embargos), the financial one (i.e., freezing of assets), the visa and travel bans, and the limitations on transport of goods (i.e., export/import restrictions), by considering the legal texts adopted in the international and European Union framework, according to a comparative analysis. [less ▲]

Detailed reference viewed: 14 (0 ULg)
See detailworkshop:laryngoscopy hands on station
Finck, Camille ULg

Conference (2015, September 17)

training of a group of 20 endocrine surgeons to correctly perform a laryngeal examination in fibroscopy. Live examination of a patient suffering of laryngeal paralysis

Detailed reference viewed: 4 (0 ULg)
Peer Reviewed
See detailVocabulaire liturgique et strates lexicales en indo-iranien ancien
Swennen, Philippe ULg

Conference (2015, September 16)

Detailed reference viewed: 10 (0 ULg)
See detailBuilding bridges (preliminary steps towards a new dictionary of Ancient Egyptian)
Winand, Jean ULg

Conference (2015, September 16)

Detailed reference viewed: 21 (0 ULg)
Full Text
See detailTowards processes-based groundwater vulnerability assessments
Dassargues, Alain ULg; Popescu, Cristina; Brouyère, Serge ULg

Conference (2015, September 15)

Various groundwater vulnerability methods have recently been developed. Considering groundwater quality issues, the most common techniques are based on calculation of an index expressing the protective ... [more ▼]

Various groundwater vulnerability methods have recently been developed. Considering groundwater quality issues, the most common techniques are based on calculation of an index expressing the protective effect (i.e. in terms of solute contaminant transport) of underground formations overlying the groundwater resource (Gogu & Dassargues, 2000, Gogu et al., 2003)). However, there is a strong need for new methods giving more emphasis on the processes-based calculation of vulnerability indicators. As a first alternative, a method is proposed based on three factors describing a pollution event (Brouyère et al., 2001): (1) the transit time from the source to the target, (2) the duration of the contamination breakthrough at the target, (3) the ratio between the maximum concentration at the target to the released concentration at the contamination source. The method can feature the impact of surface runoff to preferential infiltration points. Practically, the assessment can then be based on the simulated breakthrough curves at the ‘target’ corresponding to Dirac-type solicitations (Popescu et al., 2008). Different vulnerability maps can be built according to the relative importance conventionally given to each of the three factors. This concept allows a clear distinction between conventional aspects and processes-based results in the building of a final vulnerability indicator. A second proposal consists in reframing the groundwater vulnerability assessment in a Pressure-State-Impact causal chain that is familiar to decision makers (Beaujean et al., 2013). The method is here based on the calculation of sensitivity coefficients for a user-defined groundwater state for which several physically-based indicators are proposed. The sensitivity coefficients reflect the easiness with which the groundwater state transmits pressures into impacts. They are converted to vulnerability, using the concept of ‘transgressing a given threshold’ (Luers et al., 2003). While the methodology is general and can be applied in quantity as quality issues, the choice of causal chains has to be made prior to the calculation. The vulnerability is also related to a damaged state and is related to the ‘distance’ between the current state and a given threshold. Here also, the method allows a clear distinction between conventional choices (threshold) and scientific work (Dassargues et al., 2009). [less ▲]

Detailed reference viewed: 26 (1 ULg)
Full Text
Peer Reviewed
See detailEmpirical comparison of scoring rules at early stages of CAT
Magis, David ULg

Conference (2015, September 15)

Usual scoring rules in CATs include maximum likelihood (ML), weighted likelihood (WL) and Bayesian approaches. However, at early stages of adaptive testing, only a few item responses are available so the ... [more ▼]

Usual scoring rules in CATs include maximum likelihood (ML), weighted likelihood (WL) and Bayesian approaches. However, at early stages of adaptive testing, only a few item responses are available so the amount of information is very limited and in addition constant patterns (i.e. only correct or only incorrect responses) are often observed, yielding ML scoring intractable. Specific scoring rules (such as fixed- or variable stepsize adjustments) were developed for that purpose. However recent research highlighted that both Bayesian and WL scoring rules may provide finite values even with small sets of items. The purpose of this presentation is twofold: (a) to make a quick review of available scoring rules at early stages of CAT, and (b) to present empirical results from a simulation study that compares those scoring rules. More precisely, three scoring scenarios will be investigated: stepsize adjustment followed by ML, Bayes or WL followed by ML, and constant scoring rule throughout the CAT. These methods will be compared by means of simulated item banks and under various CAT scenarios for next item selection and stopping rules. Empirical results will be presented and practical guidelines for early stage scoring will be outlined. [less ▲]

Detailed reference viewed: 19 (1 ULg)
Full Text
See detailCorporate Board Attributes and CAC: A Comparative Study of France, Germany and UK
Boussaid, Nabila ULg; Hamza, Taher; Sougné, Danielle ULg

Conference (2015, September 14)

This paper investigates the impact of corporate board of directors’ attributes on conditional accounting conservatim in the French, German and British contexts. Using pooled regression model over the ... [more ▼]

This paper investigates the impact of corporate board of directors’ attributes on conditional accounting conservatim in the French, German and British contexts. Using pooled regression model over the period 2009-2012, our findings report that the relationship between corporate board attributes and accounting conservatism is country dependent. First, regarding the board composition, we find that the effect of board size is positive for German firms, negative for French firms and insignificant for British firms. We also document a positive association between board independence and accounting conservatism for British firms. However, we find no evidence of a positive association between codetermination and earnings conservatism in German context. Second, female seats on board seem to increase conservative reporting in financial statement only for French firms. Lastly, board meeting frequency in French and British firms appears to increase accounting conservatism. As a robustness test, we use an alternative measure of accounting conservatism namely, time–series of earnings changes measure and confirm the previous results. Overall, our results reveal that corporate board affects the financial reporting quality. [less ▲]

Detailed reference viewed: 27 (2 ULg)
Full Text
See detailSharing in neuroimaging: collecting with Brainmap, quantitatively analysing and sharing with ANIMA
Genon, Sarah ULg; Reid, Andrew; Eickhoff, Simon

Conference (2015, September 14)

Detailed reference viewed: 12 (1 ULg)
Full Text
See detail18FDG-PET/CT IMAGING IN SUSPECTED ACUTE RENAL ALLOGRAFT REJECTION
LOVINFOSSE, Pierre ULg; WEEKERS, Laurent ULg; BOVY, Christophe ULg et al

Conference (2015, September 13)

The diagnosis procedure for kidney transplant recipients (KTR) with suspected acute rejection (AR) relies on needle biopsy. Noninvasive tests to predict nonrejection would be preferable. AR is associated ... [more ▼]

The diagnosis procedure for kidney transplant recipients (KTR) with suspected acute rejection (AR) relies on needle biopsy. Noninvasive tests to predict nonrejection would be preferable. AR is associated with a recruitment of activated leukocytes into the transplant, which are characterized by a high metabolic activity and an increased uptake of glucose analog, Fluoro-deoxyglucose ( FDG). Thus, FDG-Positron emission tomography coupled with computed tomography (PET/CT) may help noninvasively distinguish nonrejection from AR. From January 2013 to February 2015, we prospectively performed 32 FDGPET/ CT in 31 adult KTR with suspected renal AR who underwent a biopsy. Biopsies were categorized as “normal”, “borderline”, “AR” or “others” according to Banff classification. PET/CT imaging was performed within 201 ± 18 minutes after i.v. administration of 3.2 ± 0.2 MBq/kg of FDG, before any modification of immunosuppression. The mean standard uptake values (SUV) of both upper and lower renal poles were measured, with no threshold activity. Biopsies were diagnosed as “normal”, “borderline”, “AR” or “others” in 8, 10, 8 and 6 (including 3 polyoma-BK nephropathies) cases. Mean SUV respectively reached 1.5 ± 0.2, 1.6 ± 0.3, 2.9 ± 0.8, 2.2 ± 1.2 in each category. Mean SUV of biopsy-proven AR was significantly higher than “normal” cases (p<0.01). No difference was found between “normal” vs. “borderline”, or between “AR” vs. “others” histopathology. Still, a positive correlation between mean SUV and acute composite (g+i+t+v+ptc) Banff score was found, with a coefficient of 0.70 (p<0.001). Sensitivity and specificity of FDG-PET/CT in detecting pathological biospies were respectively 92.3% and 36.8%, with a mean SUV threshold at 1.4. FDG-PET/CT imaging may help discriminate nonrejection, thereby avoiding unnecessary transplant biopsy in KTR with suspected AR. [less ▲]

Detailed reference viewed: 28 (7 ULg)
See detailGreen synthesis of polyphosphoesters, a promising class of bioinspired degradable materials
Lecomte, Philippe ULg; Baeten, Evelien

Conference (2015, September 11)

Detailed reference viewed: 19 (3 ULg)
Full Text
Peer Reviewed
See detailL'utilisation des insectes dans la pharmacopée de l'Égypte gréco-romaine
Marganne, Marie-Hélène ULg

Conference (2015, September 11)

Telles qu'on peut les déchiffrer dans les papyrus littéraires grecs retrouvés en Égypte (IV/IIIe siècles avant notre ère – VI/VIIe siècles de notre ère), les prescriptions médicales recourent-elles à des ... [more ▼]

Telles qu'on peut les déchiffrer dans les papyrus littéraires grecs retrouvés en Égypte (IV/IIIe siècles avant notre ère – VI/VIIe siècles de notre ère), les prescriptions médicales recourent-elles à des insectes et, si tel est le cas, à quelle(s) variété(s), en raison de quelle(s) propriété(s) et pour quel(s) type(s) d'affections ? C'est à ces questions que l'on tentera de répondre, en complétant le témoignage des sources papyrologiques par celui des sources littéraires grecques et latines sur la pharmacopée de l'Égypte gréco-romaine. [less ▲]

Detailed reference viewed: 28 (1 ULg)
Full Text
Peer Reviewed
See detailTentativi di avvicinamento a Il figlio di Bakunìn (1991) di Sergio Atzeni (1952-1995)
Curreri, Luciano ULg

Conference (2015, September 11)

Detailed reference viewed: 47 (6 ULg)
Peer Reviewed
See detailPredator cues and risky habitats affect foraging activity in salamanders
Melotto, Andrea; Ficetola, Gentile Francesco; Denoël, Mathieu ULg et al

Conference (2015, September 11)

Detailed reference viewed: 12 (0 ULg)
Peer Reviewed
See detailWill Big Data Deliver its Promised Productivity Growth?
Artige, Lionel ULg

Conference (2015, September 11)

Detailed reference viewed: 27 (0 ULg)
Peer Reviewed
See detailCe que l'image fait à l'histoire
Havelange, Carl ULg

Conference (2015, September 11)

Detailed reference viewed: 14 (0 ULg)
Peer Reviewed
See detailChallenges for Scale-Up of Batch Phase Separation
Pfennig, Andreas ULg; Becker, Karsten; Bach, S. et al

Conference (2015, September 10)

Detailed reference viewed: 29 (1 ULg)
Peer Reviewed
See detailNewts skip aquatic life and forego reproduction in response to alien fish introduction
Winandy, Laurane ULg; Darnet, Elodie; Denoël, Mathieu ULg

Conference (2015, September 10)

Detailed reference viewed: 15 (1 ULg)
See detailDéception et incertitude en démocratie
Jamin, Jérôme ULg

Conference (2015, September 10)

Detailed reference viewed: 14 (0 ULg)
Full Text
Peer Reviewed
See detailNumerical simulations on embedded solids : integration of CAD and eXtended Finite Element Analysis
Duboeuf, Frédéric ULg; Béchet, Eric ULg

Conference (2015, September 10)

The aim of this communication is to propose a procedure in order to dissociate the geometric description of the field’s approximation within the extended finite element method (X-FEM) and with non ... [more ▼]

The aim of this communication is to propose a procedure in order to dissociate the geometric description of the field’s approximation within the extended finite element method (X-FEM) and with non-matching meshes. Implicit and explicit approaches are combined in order to represent with accuracy all the CAD entities regardless of their dimension. The choice of appropriate tools such as Level Sets technique allows to describe evolving interfaces with great flexibility. The design of a dedicated P1 functional space is achieved by decimating the traces of standard finite element (FE) shape functions, thanks to a new algorithm, especially when the problem domain is embedded in a space of a higher dimension. An analysis of the approximation properties of the P1 FE trace spaces on hyper-surfaces is available in the literature and applied for solving PDEs on closed surfaces without boundary. Dirichlet boundary conditions are applied using a convenient choice of stable Lagrange multiplier space, according to a new generalized algorithm. That extends the existing solutions to every combination of the space domain and boundary dimensions. In terms of solvers, the introduction of double Lagrange multipliers can be used to recover the positive definiteness of the bilinear form. This approach allows to treat any embedding, i.e. 1, 2, or 3D problems embedded in 2 or 3D background meshes. The possibility of applying the methodology to beams is investigated, with a potential application to through-thickness reinforced composites in a mixed-dimensional modelling framework. [less ▲]

Detailed reference viewed: 39 (10 ULg)
Full Text
See detailOsteopontin as a new target in glioblastoma progression and resistance to radiotherapy
Henry, Aurélie ULg; Bellahcene, Akeila ULg; Castronovo, Vincenzo ULg et al

Conference (2015, September 10)

Glioblastoma (GBM) is the most aggressive and common solid human brain tumor. Because of GBM heterogeneity, location and aggressiveness, none of the available treatment is curative. These treatments ... [more ▼]

Glioblastoma (GBM) is the most aggressive and common solid human brain tumor. Because of GBM heterogeneity, location and aggressiveness, none of the available treatment is curative. These treatments include maximal surgical resection, radiotherapy and concomitant or adjuvant chemotherapy with Temozolomide (TMZ). However, the prognosis of adult patients with GBM remains poor and the survival outcome after treatment does not exceed 15 months. Glioblastoma-composing cells have developed many strategies to counteract these current therapies. Among the wide hallmarks acquired to survive, osteopontin (OPN) ranks correlates with lower overall and disease-free/relapse-free survival in all tumors combined, as well in brain cancer. OPN expression is largely considered as a molecular cancer marker associated with poor prognosis for patients with cancer. Our preliminary works (Lamour V and Henry A, IJC 2015) have demonstrated the role of OPN in the tumorigenicity of glioblastoma cells and its importance in the maintenance of the stem charachters. Within the continuance of this work, our recent studies focused on the potential role of OPN in the resistance of glioblastoma cells to radiotherapy and its implication in the initiation of Double Strand Breaks (DSBs) repair mechanism. In this context, U251-MG and U87-MG cells were used to assess the role of OPN in the initiation of the DSBs repair mechanism after an exposure to gamma-irradiation (γ–IR). The transient transfection of both cell lines with siRNA directed against OPN shown a lower induction of γ–H2AX compared to control (irrelevant siRNA). The survival of U251-OPN depleted cells was also affected after an exposure to γ–IR (based on clonogenic assays). However, the sole depletion of OPN in U87 cells affected their survival (independently of the γ–IR). To prove that the secreted form of OPN is necessary to survive after γ–IR, conditionned medium of U87-shSCR clones (rich in OPN) was used to treat U87shOPN clones before an exposure to γ–IR. By immunofluorescence, we observed that the γ–H2AX staining was higher in U87 shOPN clones than when treated with their own conditionned medium (poor in OPN). Currently, we are investigating the in vivo implication of OPN in the initiation of DSBs repair mechanism after an exposure of mice to γ–IR (whole brain exposure). For this purpose, IPTG-inducible U87 shRNA clones (SCR and OPN) have been generated and validated for an orthotopic xenograft model in NOD-SCID mice. The survival after a radiotherapy of 10 Gy (2Gy per day for 5 days) will be assessed in OPN-positive and –negative tumor-bearing mice. Taken together, these datas suggest that OPN could represent an important pronostic factor for patient response to radiotherapy in the context of GBM. [less ▲]

Detailed reference viewed: 62 (21 ULg)
Peer Reviewed
See detailWhat do they mean? Listening to babies communicating in the daily setting in ECEC service
Pirard, Florence ULg; Legrand, Anne; Michel, Aurore ULg

Conference (2015, September 09)

The main aim of the study was to gain understanding of how babies communicate in ECEC services. Previous literature indicates that babies can interact and communicate precociously, not only with adults ... [more ▼]

The main aim of the study was to gain understanding of how babies communicate in ECEC services. Previous literature indicates that babies can interact and communicate precociously, not only with adults (Stern, 2005; Threvarten, 2011), but also with other children (Tomasello et al., 2005). The ECEC service can be considered as a setting where interaction and communication between peers can be sustained by practitioners who observe them, document what happens, analyse together the educational condition to guarantee and regulate their action (Stambak et al., 1983). The study involved qualitative and action research initiated by Cresas and IEDPE (self-regulating participatory assessment, Ballion et al., 1988), combined with an analysis of activity approach focused on contextualised process. An action researcher has gathered practitioners, trainers and researchers from France, Spain, Croatia, Italy and Belgium to analyse educational daily practice in ECEC services and their effect on communication between peers. Videos have been used to document and analyse the practice (EADAP, 2011). The ethical considerations taken in this study involved collaborative perspectives that give an active place to all participants (researchers, trainers, practitioners? parents and children). Informed consent and authorization for using video in the research are guaranteed. Participants identify and document communication processes between very young children observed in natural setting (ECEC services). These processes are characterised by several aspects: duration, emotional expression and meaningful linking of observed behaviours between babies. A shared meaning from the video documentation can be co-constructed like some narrative stories. Participants consider the activity of babies as meaningful stories that they should understand and sustain with interest. We discuss implications for professionalisation of the workforce (initial training and professional development). [less ▲]

Detailed reference viewed: 19 (4 ULg)
See detailPractical training session on virus discovery from High Throughput Sequencing data
Massart, Sébastien ULg

Conference (2015, September 09)

Detailed reference viewed: 11 (0 ULg)
See detailUn musée du Moyen Age à Namur
George, Philippe ULg

Conference (2015, September 09)

Detailed reference viewed: 15 (0 ULg)
Peer Reviewed
See detailReevaluating IUCN Red List assesment on European amphibians
Crnobrnja-Isailović, Jelka; Cogalniceanu, Dan; Denoël, Mathieu ULg et al

Conference (2015, September 09)

Detailed reference viewed: 17 (0 ULg)
Peer Reviewed
See detailStudy of the impact of school average ability on career expectations
Dupont, Virginie ULg

Conference (2015, September 09)

Detailed reference viewed: 20 (2 ULg)
Full Text
Peer Reviewed
See detailEthylene polymerization mediated by nickel(II) covalently anchored to silica xerogels
Lambert, Stéphanie ULg; Sacco, Luigi

Conference (2015, September 08)

Heterogeneous catalysis is generally widely preferred for industrial applications thanks to the well-known advantages of easier product-catalyst separation and recovery of the catalyst process and, often ... [more ▼]

Heterogeneous catalysis is generally widely preferred for industrial applications thanks to the well-known advantages of easier product-catalyst separation and recovery of the catalyst process and, often, to the enhanced stability of the catalyst. But in terms of selectivity, homogeneous catalysis usually provides better results. From this point of view, the grafting of homogeneous catalysts onto a solid support seems the ideal combination in order to achieve the advantages of both heterogeneous and homogeneous catalysis, allowing the developing of more environmentally friendly and economical processes with potential application in the industry. Further, to covalently link a homogeneous onto silica (a support which is thermally, chemically and mechanically resistant, with a well defined structure) is the best way to limit metal leaching and sintering. Nitrogen-based ligands containing one of several Schiff bases have been reported to form active catalysts with “late-metal” (such as Fe, Pd, Ni,…) for the ethylene polymerization [1]. Moreover, substituted pyrazole-based organometallic complexes gave also promising results in this field. These facts let us suggest that the pyrazolylpyridine derivatives bearing a tethered trimethoxysilylated group synthesized in a previous work [2] are potentially good candidate to prepare hybrid catalyst (i.e. soluble organometallic complexes covalently bonded onto an insoluble support, in this case silica) with Ni-II, Fe-II or Pd-II for ethylene polymerization. [less ▲]

Detailed reference viewed: 14 (2 ULg)
Peer Reviewed
See detailIconic virtues of diagrams. Peirce and ampliative reasoning
Leclercq, Bruno ULg

Conference (2015, September 08)

In his Critic of pure reason, Immanuel Kant notoriously claimed that, being grounded on the forms of sense intuition, arithmetical and geometrical propositions are both synthetic (i.e. informative) and a ... [more ▼]

In his Critic of pure reason, Immanuel Kant notoriously claimed that, being grounded on the forms of sense intuition, arithmetical and geometrical propositions are both synthetic (i.e. informative) and a priori. Bernard Bolzano, followed in this by the logicist movement (from Gottlob Frege to Rudolf Carnap), answered that the generality and necessity of mathematical propositions and proofs can only be grounded on conceptual analysis. Even though, just like Frege, he is one of the fathers of formal logic, Charles Sanders Peirce provides some semiotic reasons to think that Kant was right: diagrams do convey general meanings and provide some knowledge which is necessary yet non-trivial. Unlike logical analysis, visual presentation of concepts in schemas or diagrams helps to explore concepts by stressing some of their “side” features in such a way that new knowledge is gained: « diagrams evolve what was involved » (CP4/86). This is why, according to Kant’s notion of intuitive construction, mathematical inferences are not merely deductive but are inventive and ampliative. My talk aims at identifying some iconic virtues of diagrams which, according to Peirce, explain their epistemic productivity. A first one lies in the “formal” nature of icons, which allows them to express syntactic relations between descriptive (symbols) and demonstrative (indices) components of structured information. On this respect, even algebraic and ideographic expressions are icons exhibiting a general form – a “rheme” – in which places for indices are filled with variables “x” and “y” meaning “any individual”. For this reason, even though they are singular, diagrams are “abstractions” in the sense that they represent relations rather than their terms. Only with this in prospect can a second, and more studied, feature of diagrams matter, namely their two-dimensionality, which helps to exhibit complex relations that cannot be seen on linear linguistic expressions. Finally, a third feature of diagrams lies in their imaginary rather than referential character. Icons connote without denoting, and therefore they can be informational without this information being limited to singular individuals. Furthermore, this non referential character of icons is what makes them open to virtual exploratory manipulations that allow to consider and investigate possibilities which in turn inform us on not obvious properties of the presently visible configuration. [less ▲]

Detailed reference viewed: 31 (0 ULg)
See detailPremières notes pour l'ethnographie d'un projet européen en situation embarquée
Thoreau, François ULg

Conference (2015, September 08)

Detailed reference viewed: 12 (0 ULg)
See detailDiasporic Experience and Music in Caryl Phillips’s Crossing the River
Mascoli, Giulia ULg

Conference (2015, September 07)

This paper deals with Caryl Phillips who has incessantly represented diasporic experience in his work where he evokes complex identities at the crossroads between Africa, the Caribbean and Europe. My ... [more ▼]

This paper deals with Caryl Phillips who has incessantly represented diasporic experience in his work where he evokes complex identities at the crossroads between Africa, the Caribbean and Europe. My proposal is to concentrate on Phillips’s novel Crossing the River (1993) which extensively explores the theme of the African diaspora and which, interestingly, has also been described as his most jazzy text. This narrative not only addresses diasporic themes, such as uprootings and lost origins, but very much like jazz -- which is for Brathwaite “a cry from the heart of the hurt man” (277) – it gives a voice to the victims of history, to shattered individuals in pain whose tragic fate is viewed at once as personal and collective. Benítez-Rojo draws attention to the importance of rhythm in this text, but he only provides a limited analysis with no specific examples of how this significant feature of the work is achieved or the purposes it serves. In this paper I will try to demonstrate that Phillips’s thematic and formal use of music, including the references to classic themes of the African American musical tradition or the recurrent and creative use of repetitions, has a performative role and reenacts the duty of remembering inherent in the diasporic experience. [less ▲]

Detailed reference viewed: 11 (0 ULg)
See detailA Stylistic Analysis of Caryl Phillips's "Made in Wales"
Tunca, Daria ULg

Conference (2015, September 07)

Detailed reference viewed: 24 (3 ULg)
See detailLa perte comme identité : le cas des familles post-séparation et post-divorce.
D'Amore, Salvatore ULg

Conference (2015, September 07)

Detailed reference viewed: 18 (1 ULg)
See detailImmunoglobulin E enhances host resistance to venoms.
Marichal, Thomas ULg

Conference (2015, September 07)

Detailed reference viewed: 8 (0 ULg)
See detailThe 4m International Liquid Mirror Telescope
Surdej, Jean ULg

Conference (2015, September 07)

The International Liquid Mirror Telescope (ILMT) consists of a 4-m diameter zenith telescope with a liquid mirror characterized by a f/2 focal ratio. It is a collaborative project between Belgium, Canada ... [more ▼]

The International Liquid Mirror Telescope (ILMT) consists of a 4-m diameter zenith telescope with a liquid mirror characterized by a f/2 focal ratio. It is a collaborative project between Belgium, Canada, India and Poland. The participating institutions are: Institute of Astrophysics and Geophysics of the Liege University (IAGL), the Royal Observatory of Belgium (ROB), six Canadian universities (British Columbia, Laval, Montreal, Toronto, Victoria and York), the Aryabatta Research Institute of Observational Sciences (ARIES, Nainital, India) and the Observatory of Poznan (UAM, Poland). This telescope is being installed at the Devasthal observatory, India (Longitude 79° 41' 04'' E, +29° 21' 40'' N, altitude 2450m), in the central Himalayas. First light should happen in early 2016. It will image every night a strip of sky having an approximate width of 27' in declination using a 4096 x 4096 pixel CCD detector that will work in the time delay integration (TDI) mode. The ILMT will thus perform a deep survey of a long and narrow strip of sky by looking at stars, galaxies, AGN, quasars, asteroids, space debris, ... crossing its field of view. It will observe in the i', r', g' SDSS spectral bands. This survey will thus be mainly dedicated to photometric and astrometric variability studies of faint objects. Among the main scientific goals, let us mention the detection and follow up of a few tens of multiply imaged quasars produced by gravitational lensing, hundreds of supernovae every year, detection of nearby brown dwarfs, white dwarfs and other faint stars based upon their trigonometric parallax and/or proper motion measurements, photometric variability studies of thousands of quasars and millions of stars as well as space debris detection at dusk and/or at dawn. Right now, numerous data sets have already been obtained of the ILMT strip of sky with smaller telescopes in the TDI mode. These will be used to carry out preliminary scientific projects and calibration of the ILMT data. A pipeline and database are presently in construction at the Poznan Observatory. Some videos and recent photographs will illustrate the present status of the ILMT project. [less ▲]

Detailed reference viewed: 10 (3 ULg)
Full Text
Peer Reviewed
See detailCitizens abroad and Regional Elections: A diffusionist Perspective
Lafleur, Jean-Michel ULg; Arrighi, Jean-Thomas

Conference (2015, September 06)

In this paper we shift the focus away from the state to the regional demos with the aim to introduce the notion of scale in the study of external voting. It is divided into three parts. Following a ... [more ▼]

In this paper we shift the focus away from the state to the regional demos with the aim to introduce the notion of scale in the study of external voting. It is divided into three parts. Following a preliminary discussion on the external franchise from a sub-state perspective, we proceed with a comparative overview of the rules of acquisition and loss of the franchise in regional elections and show that the extension of the franchise to ‘regional expatriates’ is a relatively exceptional practice. We then identify factors that in our view are key to understand the absence of a vertical diffusion of the external franchise to lower levels of government, in sharp contrast with its rapid horizontal diffusion at the state level. The second part examines the debates surrounding the inclusion and exclusion of the franchise in three cases of protracted nationalist mobilization that translated into far reaching territorial autonomy: Catalonia, Scotland and Flanders. The third and final section contrasts the similarities and differences that can be found between our three cases and reflects upon the lessons that can be drawn from them. [less ▲]

Detailed reference viewed: 27 (0 ULg)
Full Text
Peer Reviewed
See detailBinge Drinking at young age
Gavray, Claire ULg

Conference (2015, September 05)

discussion théorique et méthodologique sur le concept et la mesure du binge drinking. Présentation des facteurs liés à cette pratique chez les adolescents filles et garçons. Analyse des résultats à la ... [more ▼]

discussion théorique et méthodologique sur le concept et la mesure du binge drinking. Présentation des facteurs liés à cette pratique chez les adolescents filles et garçons. Analyse des résultats à la lumière des opportunités historiques sexuées en évolution.données ISRD3-Belgique [less ▲]

Detailed reference viewed: 31 (5 ULg)
Full Text
See detailMagnetic shielding properties of tubular bulk superconductors subjected to stray magnetic fields
Hogan, Kevin ULg; Fagnard, Jean-François ULg; Wera, Laurent ULg et al

Conference (2015, September 04)

Superconducting materials act as efficient magnetic shields thanks to their intrinsic magnetic properties. The vast majority of studies on superconducting shields has been conducted in homogeneous ... [more ▼]

Superconducting materials act as efficient magnetic shields thanks to their intrinsic magnetic properties. The vast majority of studies on superconducting shields has been conducted in homogeneous magnetic field configurations. Only few works have been done concerning inhomogeneous magnetic field configurations while those are representative of practical situations. Moreover, those configurations are non-trivial given the magnetic hysteretic behaviour of type-II superconductors. In the present work, we aim at investigating and understanding the magnetic response of a superconducting hollow cylinder made of Bi-2223 subjected to the magnetic stray field of various magnetic sources. Thanks to a bespoke 3D mapping system and a three-axis Hall probe, we measure the magnetic flux density distribution in the vicinity of the cylinder when the latter is subjected to those stray fields. All experiments are carried out in liquid nitrogen. Our experimental data allow us to apprehend the magnetic field penetration inside the superconductor in inhomogeneous field configurations and to compare those to results obtained with homogeneous fields. Then we compare our results to a finite element model of an infinite tube subjected to an inhomogeneous magnetic field in order to gather information on the magnetic field penetration and the current density distribution inside the superconductor. [less ▲]

Detailed reference viewed: 35 (9 ULg)
See detailAge-related modulations in cognitive functions and its cerebral underpinnings
Collette, Fabienne ULg

Conference (2015, September 04)

Detailed reference viewed: 14 (1 ULg)
Full Text
See detailFrom Aleph to Alma: Fulfillment, feel it fully
Van Ruymbeke, Muriel ULg; Lhoest, Rémy ULg; Thirion, Paul ULg

Conference (2015, September 04)

If it is well prepared, migrating from Aleph to Alma brings users a lot of advantages. To reach the go live day with as less worries as possible, ULg Library's preparation consisted in two things: a deep ... [more ▼]

If it is well prepared, migrating from Aleph to Alma brings users a lot of advantages. To reach the go live day with as less worries as possible, ULg Library's preparation consisted in two things: a deep understanding of Alma new concepts and a simplification of our physical fulfillment policy. This presentation, based on our experience, will aim at describing the main differences between Aleph and Alma regarding fulfillment concepts and their significant consequences on implementation and migration jobs. On a fulfillment point of view, what distinguishes Aleph from Alma is that, in Aleph, the circulation policy is based on item status. On the contrary in Alma it is based on the location, and its traffic rules built by a set of terms of uses (TOU). Numerous other idioms complete the Alma toolkit and allow physical item’s fulfillment customizing. But to really enjoy the new possibilities given by Alma, it is important to fully feel the necessary changes… at the very beginning ! [less ▲]

Detailed reference viewed: 53 (4 ULg)
See detailWildflowers sown at field margins have positive and negative effects on pests and parasitoids
Hatt, Séverin ULg; Uyttenbroeck, Roel ULg; Chevalier Mendes Lopes, Thomas ULg et al

Conference (2015, September 03)

Wildflower strips are sown at field margins throughout Europe to support insect conservation in agricultural areas. Among other insects, parasitoids may favor a biological regulation of pests. On an ... [more ▼]

Wildflower strips are sown at field margins throughout Europe to support insect conservation in agricultural areas. Among other insects, parasitoids may favor a biological regulation of pests. On an experimental field of the research platform AgricultureIsLife in Gembloux (University of Liège, Belgium), three replications of five wildflower seed mixtures were sown in strips adjacent to crops in spring 2013. Insect pests and their parasitoids were pan-trapped in spring 2014 in both wildflower strips and oilseed rape crops and identified at the species level. Flower species and cover were monitored in the strips using 1 m² quadrats, before mowing. Meligethes spp. were found abundantly in crops when oilseed rape was blooming. Meligethes’ parasitoids occurred later and their abundance was positively correlated with that of Meligethes in the flower strips. At the crop ripening stage, weevils Ceutorhynchus spp. occurred and were followed by an increase in abundance of their parasitoids in both crops and flowers. Positive as well as negative correlations were found between the abundance of these pests, their parasitoids and different flower species blooming at this time. The link between these results with flower species’ functional traits will be discussed. [less ▲]

Detailed reference viewed: 36 (12 ULg)
Full Text
See detailUne féminité en métamorphose: Représentation de la féminité noire dans le cinéma black-British
Herbert, Emilie ULg

Conference (2015, September 03)

Le long-métrage "Burning an illusion", réalisé par Menelik Shabazz, met en scène l'éveil politique d'une jeune femme noire, Pat (Cassie McFarlane) lorsqu'elle fait l'expérience du racisme et de la ... [more ▼]

Le long-métrage "Burning an illusion", réalisé par Menelik Shabazz, met en scène l'éveil politique d'une jeune femme noire, Pat (Cassie McFarlane) lorsqu'elle fait l'expérience du racisme et de la violence dans les rues de Londres. "Burning an illusion" est l'un des premiers films black British à prendre pour personnage principal une femme et Shabazz décrit la conscientisation politique de Pat en termes ouvertement féminins : sa transformation intellectuelle passe en effet par une métamorphose physique. A travers une africanisation de son apparence (son maquillage disparaît, ses vêtements changent et ses cheveux, soigneusement lissés au début du film, reprennent leur apparence naturelle), Pat manifeste son rejet des codes de beauté occidentaux qui annihilent les femmes noires en imposant la blancheur comme point de référence. Ce long-métrage, réalisé en 1981, met en avant une notion développée par un féminisme noir qui s'éveille à la même époque en Grande-Bretagne : celle de la (re)conquête de la féminité noire à travers la création d'une identité black British fluide qui reconnaît la nature fragmentée des identitées hybrides, racialisées et genrées (Mirza, 1997). L'analyse d'un corpus de plusieurs films du mouvement du black British Cinema des années 1980 et 90 à travers une approche intersectionnelle, féministe et de genre nous permettra de comprendre ce processus de redéfinition de la féminité noire, jusqu'alors rendue invisible au sein du cinéma britannique blanc (Bourne, 2001). Les films étudiés encouragent en effet la revalorisation de la beauté naturelle du corps féminin noir, permettant ainsi son mouvement d'objet à sujet (Weekes, 1997), en passant par un processus de métamorphose physique. Le corps y est fragmenté (Coly, 2010) afin d'en déconstruire l'image socialement et culturellement produite (Jordan-Zachery, 2013) et de créer ainsi une nouvelle syntaxe qui permet d'articuler et de comprendre le corps féminin noir différemment (Doane, 1981). [less ▲]

Detailed reference viewed: 40 (5 ULg)
Full Text
See detailMilk biomarkers to detect ketosis and negative energy balance using MIR spectrometry
Grelet, Clément ULg; Bastin, Catherine ULg; Gelé, Marine et al

Conference (2015, September 02)

Detailed reference viewed: 30 (9 ULg)
Full Text
Peer Reviewed
See detailImpact of a one-day preventive voice program for teachers : A longitudinal study
Remacle, Angélique ULg; Gerber, Silvain; David, Claire et al

Conference (2015, September 02)

I. INTRODUCTION Teachers are professional voice users, i.e. people who rely on a consistent, special, or appealing voice quality to achieve their job. If afflicted with dysphonia or aphonia, they would ... [more ▼]

I. INTRODUCTION Teachers are professional voice users, i.e. people who rely on a consistent, special, or appealing voice quality to achieve their job. If afflicted with dysphonia or aphonia, they would generally loose motivation at work and seek alternative employment [1]. Teachers represent the largest group of professionals complaining of dysphonia: they represent 20% to 25% of the treatment-seeking workers [2, 3]. Voice disorders impact both physical and psychological health. They represent a public health problem, since they have considerable economic consequences in terms of treatment and replacement of professionals who suffer from these problems [4]. Moreover, they have been shown to interfere with quality of life, emotional state, job satisfaction, performance and attendance [4, 5]. Finally, a teacher’s dysphonia adversely impacts students’ comprehension and learning [6]. These negative effects of teachers’ voice disorders motivate to develop prevention programs and test their efficacy. This study aims to evaluate the impact over a five-month period of a one-day prevention program for female teachers. This program includes both direct and indirect methods. II. METHODS A. Participants Twenty-two female kindergarten and elementary schoolteachers with less than 5 years of experience participated in this study. Half of them (test group) took part in a one-day prevention program in October, while the other half (control group) received no counseling on the use of the voice. B. Assessments For each participant, five sustained /a/ vowels and the reading of a text were recorded (1) at two times of the workday (morning and evening), and (2) at three times of the year: October (T0), December (T1) and February (T2). For the sustained vowels, we measured maximum phonation time (MPT), mean fundamental frequency (F0), values of jitter, shimmer and harmonics-to-noise ratio (HNR). For the texts, we measured mean F0, standard deviation in F0 and intensity, and parameters related to speech rate (number of syllables per second, number of pauses and mean duration of pauses). For each parameter, a repeated-measures ANOVA (2 groups * 2 times of day * 3 times of year) was carried out. Participants also completed a questionnaire on voice use and comfort at the three test sessions. III. RESULTS A. Time of day effect The main effect of time of day showed an increase in the mean F0 of the vowels and the text following a workday (p<.01). MPT and HNR also increased (p<.01), while jitter and shimmer decreased at the end of the day (p<.05). The speech rate measures showed that the teachers tended to pause less often while reading the text at the end of the day, and their pauses were shorter (p<.05). B. Time of year effect The main effect of time of year showed an increase in the mean F0 of the vowels and the text during the year (p<.01), with the highest values observed in December (T1). The speech rate measures also showed an increase in the number of syllables per second (p<.01) and a tendency for speakers to pause less often later in the year. C. Group effect Several acoustic parameters showed that voice changed during the day and during the year in significantly different ways in the two groups. Thus, the MPT increased more during the year for the control group than for the test group. The elevation of mean F0 during the day increased to a similar degree for both groups between T0 and T1, but continued to increase until T2 for the control group, while it decreased for the test group. Jitter and shimmer decreased significantly following a workday for both groups at T0, and this decrease was more marked for the test group at T1 and T2. Finally, analysis of the questionnaires showed a very strong deterioration in teachers’ self-evaluations of vocal comfort and control at T1; nevertheless there were significantly fewer complaints from the group that received the prevention program. IV. DISCUSSION AND CONCLUSION For both groups, the changes in the observed parameters suggested an increase in vocal fatigue and hyperfunctional phonation during the day and during the year. The results showed greater vocal deterioration in December than at the other points in the school year (October and February). For several acoustic parameters, the comparison of the two groups showed a less severe vocal deterioration for subjects who received the preventive program. Moreover, the questionnaires showed that the prevention program had a significantly positive impact on the changes in the teachers’ perception during the year. These results encourage to offer such preventive interventions to teachers before or during their career, since they have a positive impact on teachers’ perception and vocal comfort. V. REFERENCES [1] Titze IR, Lemke J, Montequin D. (1997). Populations in the U.S. workforce who rely on voice as a primary tool of trade: A preliminary report. Journal of Voice, 11(3), 254-259. [2] Van Houtte, E., Van Lierde, K., D'Haeseleer, E., & Claeys, S. (2010). The prevalence of laryngeal pathology in a treatment-seeking population with dysphonia. Laryngoscope, 120(2), 306-312. [3] Remacle, A., Petitfils, C., Lejeune, L., Finck, C., & Morsomme, D. (2014). Quel est le profil professionnel des patients consultant en phoniatrie ? 70e Congrès de la Société Française de Phoniatrie, Paris, France. (October 13, 2014). [4] Roy, N., Merrill, R. M., Thibeault, S., Parsa, R. A., Gray, S. D., & Smith, E. M. (2004). Prevalence of voice disorders in teachers and the general population. Journal of Speech, Language, and Hearing Research, 47(2), 281-293. [5] Chen, S. H., Chiang, S.-C., Chung, Y.-M., Hsiao, L.-C., & Hsiao, T.-Y. (2010). Risk factors and effects of voice problems for teachers. Journal of Voice, 24(2), 183-190. [6] Morsomme, D., Minel, L., & Verduyckt, I. (2011). Impact of teachers’ voice quality on children’s language processing skills. Vocologie: Stem en Stemstoornissen, 4, 9-15. [less ▲]

Detailed reference viewed: 56 (4 ULg)
See detailDevelopment of photo- or thermo-reversible cross-linked recyclable shape-memory materials
Defize, Thomas ULg; Riva, Raphaël ULg; Thomassin, Jean-Michel ULg et al

Conference (2015, September 01)

Shape-memory polymers (SMPs) are remarkable materials able to switch from a stressed deformed state (temporary shape) to their initial relaxed state (permanent shape) by the application of a stimulus ... [more ▼]

Shape-memory polymers (SMPs) are remarkable materials able to switch from a stressed deformed state (temporary shape) to their initial relaxed state (permanent shape) by the application of a stimulus, such as heat or light. Typically, the shape-memory property is generally observed for chemically or physically cross-linked polymers that exhibit an elastomeric behavior above a phase transition, e.g. glass or melting transition. As an example, cross-linked semi-crystalline poly(ε-caprolactone) (PCL) is widely studied for the development of SMPs. As most of SMPs are irreversibly cross-linked material, their reprocessing is impossible preventing any recycling. Thereby, reversible reactions, allowing the formation/cleavage of the network, raise tremendous interest for the development of new SMPs. Recently, we reported the preparation reversibly cross-linked PCL-based SMP using the Diels-Alder (DA) reaction between furan and maleimide end-groups of 4-arm star-shaped PCL, well-known to create reversible bonds. After implementation, this shape-memory material was demonstrated to be recyclable, and was characterized by excellent fixity and recovery before and after recycling experiments. However, the relatively low retro DA temperature of the furan-maleimide adducts led to an inelastic deformation during shape-memory tensile cycles. In order to get rid of this drawback, an alternative approach was investigated. The substitution of the DA reaction by a photo-reversible reaction, typically the photo-induced (2+2) cycloaddition of coumarins, was proposed to prepare cross-linked PCL matrix presenting one-way and two-way memory properties, since photolabile adducts are supposed to be stable during shape-memory tensile cycles. [less ▲]

Detailed reference viewed: 44 (3 ULg)
Full Text
See detailModel-Based Stressed Blood Volume is an Index of Fluid Responsiveness
Pironet, Antoine ULg; Dauby, Pierre ULg; Chase, J. Geoffrey et al

Conference (2015, September 01)

Fluid therapy is frequently used to manage acute circulatory failure. This therapy aims to restore cardiac output by fluid administration, which increases the quantity of fluid in the circulation. However ... [more ▼]

Fluid therapy is frequently used to manage acute circulatory failure. This therapy aims to restore cardiac output by fluid administration, which increases the quantity of fluid in the circulation. However, it has been shown to be effective only in certain cases, leading to the need for indices of fluid responsiveness. Total stressed blood volume has recently been shown to be such an index of fluid responsiveness. However, the current methods to determine this parameter require specific procedures. In this work, a more straightforward method is developed using data available in the intensive care unit. A simple three-chamber cardiovascular system model is used, of which total stressed blood volume is a parameter. All model parameters (including total stressed blood volume) are adjusted to pig experimental data during fluid administrations. The resulting value of total stressed blood volume is always negatively associated with the relative change in cardiac output after fluid administration. This finding confirms that total stressed blood volume is an index of fluid responsiveness. Another finding of this study is that the response curves are subject-specific. The method developed in this work can be applied to humans, since the data required is typically available in an intensive care unit. [less ▲]

Detailed reference viewed: 20 (1 ULg)
Peer Reviewed
See detailFitness evaluation and molecular characterization of a recombinant murine norovirus (MuNoV) during serial passages in cell culture
Ferreira de Oliveira Filho, Edmilson; Di Felice, Elisabetta; Toffoli, Barbara et al

Conference (2015, September 01)

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a ... [more ▼]

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a recombinant Wu20/CW1 strain was obtained after in vitro coinfection of RAW264.7 cells with parental MuNoV strains CW1 and Wu20 (Mathijs et al 2010). The recombinant strain showed reduced plaque size compared to the parental strains and it was suggested that this was due to modified virulence properties in vitro. The aim of this study was to observe and molecularly characterize the natural genetic evolution of the recombinant MuNoV strain across in vitro replications. Methods: MNV strains used in this study were CW1, WU20 (Thackray et al., 2007, kindly provided by prof. H. Virgin) and Rec MNV (Mathijs et al., 2010). RAW 264.7 cells (ATCC TIB-71) grown in Dulbecco’s modified Eagle’s medium (Invitrogen) complemented (DMEMc) with 10 % heat inactivated FCS (BioWhittaker), 2 % penicillin (5000 U /ml) and streptomycin (5000 mg/ml) (PS; Invitrogen) and 1 % HEPES buffer (1 M; Invitrogen). The recombinant strain was serially replicated in vitro in RAW264.7 cells (up to 14 passages). RAW 264.7 (Mouse leukaemic monocyte macrophage) cells were infected with MNV for 72 hours and afterwards lysed by freeze and thaw and viruses purified by ultracentrifugation of both cells and supernatant. Viral plaque sizes of early and late progenies (30 for each virus) were compared with the Image J software. The experiment was repeated two times. RNA was extracted from 140 ml purified suspension 1:5 diluted using the QIAamp Viral RNA Mini KitTM (Qiagen) according to the manufacturer’s instructions. cDNA was generated using a poly-A primer tagged GCCAACGACCGGGAGGCCAGC(T)20 previously described (Müller et al 2007) using superscript ii reverse transcriptase kit (Invitrogen®) treated with RNase H or with other antisense primers using iScript select kit (Bio-Rad®). For the genetic characterization two different studies were conducted. The first study aimed to develop a sequencing strategy in order to obtain the complete genome of the recombinant MNV. Then, in the second study, sequences obtained from different viral passages into RAW cells (e.g. P5 and P14) were compared in order to study the viral adaptation. Primers were designed using the Primer Express® software and netprimer® (Premier biosoft). PCR was performed using taq polymerase with thermopol buffer (new England biolabs) as per manufacturer’s instructions. Afterwards, fragments were excised from agarose gel and DNA purified using the QIAquick Gel Extraction KitTM (Qiagen) and cloning using the PGEM T easy cloning kit (Promega) plasmid DNA was transferred to sequencing by GATC Biotech (Koblenz, Germany). Results: The size of the lysis plaque surface of P2 and P14 showed a considerable divergence. The average plaque size increased from the earlier to the later progenies (from 0.1 mm2 to around 0.5 mm2). A significant difference was demonstrated between them with the Mann and Whitney non parametric statistical test. The genetic characterization of the recombinant strain obtained in vitro was previously based on partial genomic sequences, which provided limited information. Accordingly to our initial molecular analysis of 1.5 kb partial genomic sequence comprising the part of the RdRp and the part of the VP1 did not show any genetic modifications between passage 4 (accession number HM044221) and passage 14 recMNV. Therefore, a strategy for sequencing the complete genome of the different MNV strains was established. The genome of the recombinant MNV was divided into seven regions and the amplification was performed using either new designed or previous published primers. Molecular analysis using the nearly complete genome of the recombinant MNV passage 14 and the two parental strains (CW1 and WU20) showed nine modifications in the genome, comprising three aminoacid changes. Accordingly, two modification were in the RdRp region aa position 1384 Glycine (G) instead of Aspartic acid (D) and aa position 1393 Serine (S) instead of Asparagine (N) and one modification was in the capsid region one modification on aa position 296 Glutamic Acid (E) instead of Lysine. Conclusion: Even preliminary, our data provide evidence of virus adaptation to a new environment (here a cell culture system) after a recombination event. In order to specify whether these hints of genetic mutations could explain fitness modifications during in vitro evolution we need to compare the sequences of passage 14 and the previous viral cellular passages. In addition, two other parameters of in vitro virulence modification will be investigated: (i) virus production and (ii) growth kinetics. The data should provide interesting information about genetic evolution in the genus Norovirus, especially regarding recombination events and explain how a recombinant strain, first disadvantaged compared to its parental strains, could regain fitness by genetic evolution. [less ▲]

Detailed reference viewed: 17 (1 ULg)
See detailRelationship between Stroke Volume and Pulse Wave Velocity
Kamoi, Shun; Pretty, Christopher; Chiew, Yeong Shiong et al

Conference (2015, September 01)

Stroke Volume (SV) measurements are essential for evaluating patient hemodynamic status and response to therapy. However, current methods for monitoring SV require either invasive or non- invasive ... [more ▼]

Stroke Volume (SV) measurements are essential for evaluating patient hemodynamic status and response to therapy. However, current methods for monitoring SV require either invasive or non- invasive additional measurements. This study investigates the relationship between SV and Pulse Wave Velocity (PWV) to examine whether the value of PWV can capture the changes in SV. The analysis was performed using data from six porcine experiments (N=6 Pietrain Pigs, 20-29 kg) in which left ventricular volume, aortic arc pressure, and descending aortic pressure waveforms were measured simultaneously. From the measured data, correlation coefficients were determined between absolute value of aortic PWV, SV and trend value ‘PWV – mean PWV’, ‘SV – mean SV’ during periods when changes in SV were induced from preload changes, as well as infusion of dobutamine. The results showed good correlation (r = 0.59) for trend value, however, the correlation coefficient were poor with r = 0.028 for absolute value across all pigs. The analysis showed that value of PWV is reliable for capturing trend value of SV in preload changes. However, it is unreliable for capturing absolute value of SV or changes in SV made from dobutamine. [less ▲]

Detailed reference viewed: 47 (0 ULg)
See detailL'emploi du conjonctif en kirundi
Tuyubahe, Pascal ULg

Conference (2015, September 01)

The verb in the conjuctive mood accompagnies always an other verb (auxiliary verb or verb in subordinate clause (valencielle or not) not introduced by a linking word. It is marked by an initial high tone ... [more ▼]

The verb in the conjuctive mood accompagnies always an other verb (auxiliary verb or verb in subordinate clause (valencielle or not) not introduced by a linking word. It is marked by an initial high tone on the first vowel after the first consonnant. After an auxiliary, the high tone disappears in the presence of -ra- morpheme in the present tense. Auxiliaries trigger raising from subject to subect and distinguish two type of morpheme -ra- in the conjunctive verb: -ra- determined syntactically and -ra- determined lexically. [less ▲]

Detailed reference viewed: 14 (2 ULg)
See detailCross-linked polymer micelles made of polyphosphate containing amphiphilic copolymers for drug delivery
Riva, Raphaël ULg; Vanslambrouck, Stéphanie ULg; Ergül, Zeynep ULg et al

Conference (2015, September 01)

In the pharmaceutical field, amphiphilic block copolymers are of great interest for the nanovectorization of active principles in Drug Delivery. Indeed, new drugs are synthesized each day but in too many ... [more ▼]

In the pharmaceutical field, amphiphilic block copolymers are of great interest for the nanovectorization of active principles in Drug Delivery. Indeed, new drugs are synthesized each day but in too many cases, their high hydrophobicity makes them useless because of the absence of an appropriated administration method. Typically, amphiphilic block copolymers present the remarkable property to self-assemble in water with formation, in most cases, of spherical micelles characterized by a hydrophobic core and a hydrophylic corona. Rapidly, their ability to encapsulate a hydrophobic drug in their hydrophiobic core was investigated to increase the solubility of the drug in aqueous media, prevent its degradation and decrease its toxicity. However, polymer micelles suffer of the main drawback to be unstable in diluted medium, leading to a premature release of the drug, when the concentration falls down the critical micellar concentration (CMC), which it is rapidly observed after intravenous injection. This work aims at reporting on the development of a drug delivery device based on a new amphiphilic block copolymers made of degradable polyphosphate and bioeliminable poly(ethylene oxide). Thanks to their biocompatibility, biodegradability and their structure similar to natural biomacromolecules, polyphosphates are appealing polymers for biomedical applications. In contrast to aliphatic polyesters, polyphosphate properties and functionality are easily tuned via the chemical nature of the lateral chains R. In order to get rid of the CMC, the crosslinking of the micelle’s core was realized by UV radiation, in order to fulfill the increasingly stringent requirements of biomedical applications. For this purpose, photo-cross-linkable groups were introduced on the polyphosphate backbone. The effect of the crosslinking rate on the drug loading and the drug release was evaluated using doxorubicin as model drug. [less ▲]

Detailed reference viewed: 295 (7 ULg)
Full Text
See detailRèglement EU 650/2012 sur les successions et planification successorale
Wautelet, Patrick ULg

Conference (2015, September)

Detailed reference viewed: 30 (0 ULg)
Full Text
Peer Reviewed
See detailLes premières forêts communautaires du Gabon - Le film - Bonus 1
Meunier, Quentin; Boldrini, Sylvie; Federspiel, Michèle et al

Conference (2015, September)

Detailed reference viewed: 3 (2 ULg)
Full Text
See detailThe use of the Vadose Zone Experimental Setup as an innovative in situ characterization method for the vadose zone: a case study at an industrial contaminated site in Belgium
Fernandez de Vera, Natalia ULg; Beaujean, Jean ULg; Jamin, Pierre ULg et al

Conference (2015, September)

The development of protection and remediation plans for contaminated soil and groundwater require a detailed understanding of the transport of pollutants in the subsurface. However, such understanding is ... [more ▼]

The development of protection and remediation plans for contaminated soil and groundwater require a detailed understanding of the transport of pollutants in the subsurface. However, such understanding is affected by the lack of spatial and temporal coverage provided by the current in situ characterization technologies. A new system has been developed in order to overcome such limitations. The vadose zone experimental setup is a new development combining cross-hole geophysics and the Vadose Zone Monitoring System (VMS). In cross-hole geophysics, an injection of an electrical current using electrodes installed in vertical boreholes is triggered. From measured potential differences, spatial patterns related with subsurface heterogeneities, water content and solute concentrations are inferred. The VMS allows continuous measurements of water content at different depths of the vadose zone, as well as water sampling. The system is formed by a flexible sleeve containing monitoring units along its depth which is installed in a slanted borehole. The system was installed at a former industrial site in Belgium, where soil and groundwater are contaminated with BTEX, PAH, and heavy metals. Two VMS were installed in two slanted boreholes on site, together with four vertical boreholes containing electrodes for geophysical measurements. The site was initially monitored under natural recharge conditions. Water content sensors located along the VMS registered fast wetting and draining reactions to rainfall events followed by the activation of water transport through fractures. Results from soil water samples show continuous evolution of water chemistry with depth, due to disequilibrium between infiltrated water and the hydrochemical conditions in the unsaturated zone. Subsequently, a saline tracer was injected in the surface. The transport of the tracer in the subsurface was monitored via cross-hole and surface geophysics. Results from imaging reflect the evolution of a plume through vertical and lateral transport and dilution. [less ▲]

Detailed reference viewed: 70 (11 ULg)
See detailObservations of Mars aurorae
Gérard, Jean-Claude ULg; Soret, Lauriane ULg; Libert, Ludivine ULg et al

Conference (2015, September)

We present recent results obtained by combining remote sensing observations and in situ measurements of the Martian aurora made from Mars Express.

Detailed reference viewed: 34 (8 ULg)
Full Text
See detailA new hybrid approach for modelling groundwater flow in karst aquifers
Willems, Thibault ULg; Hakoun, Vivien ULg; Renard, Philippe et al

Conference (2015, September)

Groundwater flow modelling in karst aquifers represents a real challenge that requires adapted methods. The applicability of an innovative hybrid approach for modelling groundwater flow in karst aquifers ... [more ▼]

Groundwater flow modelling in karst aquifers represents a real challenge that requires adapted methods. The applicability of an innovative hybrid approach for modelling groundwater flow in karst aquifers, namely the Hybrid Finite Element Mixing Cell (HFEMC) method, is evaluated. The hybrid approach consists in combining a classical finite element (FE) model, to model slow flow in the rock matrix, with spatially distributed lumped reservoirs, to model fast flow in the karst conduits network. Water exchanges between the rock matrix and the conduits network are accounted for by means of an internal Fourier boundary conditions (BC). This BC (1st order exchange relation) allows to control the magnitude of water transfers between fast and slow flow domains. We tested the applicability of the HFEMC method on a schematic synthetic domain and on a real karst system. In the synthetic case analysis, we discussed dynamic processes of groundwater storage occurring in the karst system during a recharge pulse. The study focuses on the influence of selected parameters on representative variables such as the discharge curve of the karst system or pressure and mass transfers between conduits and rock matrix sub-domains. In this way, an inversion of the hydraulic gradient between karst conduits and the surrounding rock matrix is shown to occur during the recharge pulse. This phenomenon results in a temporary storage of water from conduits to the rock matrix, which impacts the modelled discharge curve. The first test performed on a real study site, the Noiraigue spring karst system (Jura mountains, Switzerland), exemplify the use of two separated lumped reservoirs for describing the conduits network, which allows to consider two base levels in the karst system. It also points out the challenges to face when modelling a complex natural karst system with the HFEMC approach. The results obtained show that the HFEMC approach is a good candidate to model groundwater flow in karst aquifers. [less ▲]

Detailed reference viewed: 59 (17 ULg)
Full Text
See detailComparison of the wear behavior of high speed steel grades obtained from conventional casting and laser cladding
Hashemi, Seyedeh Neda ULg; Lecomte-Beckers, Jacqueline ULg; Montrieux, Henri-Michel ULg et al

Conference (2015, September)

Tools Steels are alloys which withstand severe mechanical and physicochemical stresses in service. Therefore their alloying design that involved both the original chemical composition and the casting ... [more ▼]

Tools Steels are alloys which withstand severe mechanical and physicochemical stresses in service. Therefore their alloying design that involved both the original chemical composition and the casting route is crucial in order to achieve a tailored microstructure exhibiting enhanced wear performances. Tools steels obtained from conventional casting processes had received lot of attention so far as they yield typical microstructure composed of a quasi-continuous network of coarse grain boundary carbides with grain size ranging between 20 to 200 µm. Direct energy deposition applied to Tools Steels represents a new emerging technique that may allow ultrafine grained microstructures due to the higher cooling rates achieved especially in the solidification range. In this paper, four tool steels grades were studied, one of them being obtained from a conventional casting process and the other ones originated from the direct energy deposition. Differential Thermal Analysis helps enhancing the solidification sequence of the studied alloys, while their microstructure after subsequent heat treatment was characterized by the means of both optical and electron microscopes together with hardness measurements. Tribological tests carried out at room temperature and at high temperature were performed while using a “pin-on-disc” device. Based on the friction coefficient and the wear rate, the wear performances of the tool steel were determined and compared with one another. The influence of metallurgical features (the grain size, or the nature, the size and the distribution of carbides) on the wear behavior was also enhanced. The setting of the wear test parameters together with the microstructure of the studied materials seems to strongly influence the subsequent abrasion and wear mechanisms. [less ▲]

Detailed reference viewed: 16 (2 ULg)