References of "Unpublished conference/Abstract"
Bookmark and Share    
Full Text
Peer Reviewed
See detailMilk biomarkers to detect ketosis and negative energy balance using MIR spectrometry
Grelet, Clément ULg; Bastin, Catherine ULg; Gelé, Marine et al

Conference (2015, September 02)

Detailed reference viewed: 38 (11 ULg)
See detailDevelopment of photo- or thermo-reversible cross-linked recyclable shape-memory materials
Defize, Thomas ULg; Riva, Raphaël ULg; Thomassin, Jean-Michel ULg et al

Conference (2015, September 01)

Shape-memory polymers (SMPs) are remarkable materials able to switch from a stressed deformed state (temporary shape) to their initial relaxed state (permanent shape) by the application of a stimulus ... [more ▼]

Shape-memory polymers (SMPs) are remarkable materials able to switch from a stressed deformed state (temporary shape) to their initial relaxed state (permanent shape) by the application of a stimulus, such as heat or light. Typically, the shape-memory property is generally observed for chemically or physically cross-linked polymers that exhibit an elastomeric behavior above a phase transition, e.g. glass or melting transition. As an example, cross-linked semi-crystalline poly(ε-caprolactone) (PCL) is widely studied for the development of SMPs. As most of SMPs are irreversibly cross-linked material, their reprocessing is impossible preventing any recycling. Thereby, reversible reactions, allowing the formation/cleavage of the network, raise tremendous interest for the development of new SMPs. Recently, we reported the preparation reversibly cross-linked PCL-based SMP using the Diels-Alder (DA) reaction between furan and maleimide end-groups of 4-arm star-shaped PCL, well-known to create reversible bonds. After implementation, this shape-memory material was demonstrated to be recyclable, and was characterized by excellent fixity and recovery before and after recycling experiments. However, the relatively low retro DA temperature of the furan-maleimide adducts led to an inelastic deformation during shape-memory tensile cycles. In order to get rid of this drawback, an alternative approach was investigated. The substitution of the DA reaction by a photo-reversible reaction, typically the photo-induced (2+2) cycloaddition of coumarins, was proposed to prepare cross-linked PCL matrix presenting one-way and two-way memory properties, since photolabile adducts are supposed to be stable during shape-memory tensile cycles. [less ▲]

Detailed reference viewed: 67 (5 ULg)
See detailCross-linked polymer micelles made of polyphosphate containing amphiphilic copolymers for drug delivery
Riva, Raphaël ULg; Vanslambrouck, Stéphanie ULg; Ergül, Zeynep ULg et al

Conference (2015, September 01)

In the pharmaceutical field, amphiphilic block copolymers are of great interest for the nanovectorization of active principles in Drug Delivery. Indeed, new drugs are synthesized each day but in too many ... [more ▼]

In the pharmaceutical field, amphiphilic block copolymers are of great interest for the nanovectorization of active principles in Drug Delivery. Indeed, new drugs are synthesized each day but in too many cases, their high hydrophobicity makes them useless because of the absence of an appropriated administration method. Typically, amphiphilic block copolymers present the remarkable property to self-assemble in water with formation, in most cases, of spherical micelles characterized by a hydrophobic core and a hydrophylic corona. Rapidly, their ability to encapsulate a hydrophobic drug in their hydrophiobic core was investigated to increase the solubility of the drug in aqueous media, prevent its degradation and decrease its toxicity. However, polymer micelles suffer of the main drawback to be unstable in diluted medium, leading to a premature release of the drug, when the concentration falls down the critical micellar concentration (CMC), which it is rapidly observed after intravenous injection. This work aims at reporting on the development of a drug delivery device based on a new amphiphilic block copolymers made of degradable polyphosphate and bioeliminable poly(ethylene oxide). Thanks to their biocompatibility, biodegradability and their structure similar to natural biomacromolecules, polyphosphates are appealing polymers for biomedical applications. In contrast to aliphatic polyesters, polyphosphate properties and functionality are easily tuned via the chemical nature of the lateral chains R. In order to get rid of the CMC, the crosslinking of the micelle’s core was realized by UV radiation, in order to fulfill the increasingly stringent requirements of biomedical applications. For this purpose, photo-cross-linkable groups were introduced on the polyphosphate backbone. The effect of the crosslinking rate on the drug loading and the drug release was evaluated using doxorubicin as model drug. [less ▲]

Detailed reference viewed: 322 (8 ULg)
Full Text
See detailModel-Based Stressed Blood Volume is an Index of Fluid Responsiveness
Pironet, Antoine ULg; Dauby, Pierre ULg; Chase, J. Geoffrey et al

Conference (2015, September 01)

Fluid therapy is frequently used to manage acute circulatory failure. This therapy aims to restore cardiac output by fluid administration, which increases the quantity of fluid in the circulation. However ... [more ▼]

Fluid therapy is frequently used to manage acute circulatory failure. This therapy aims to restore cardiac output by fluid administration, which increases the quantity of fluid in the circulation. However, it has been shown to be effective only in certain cases, leading to the need for indices of fluid responsiveness. Total stressed blood volume has recently been shown to be such an index of fluid responsiveness. However, the current methods to determine this parameter require specific procedures. In this work, a more straightforward method is developed using data available in the intensive care unit. A simple three-chamber cardiovascular system model is used, of which total stressed blood volume is a parameter. All model parameters (including total stressed blood volume) are adjusted to pig experimental data during fluid administrations. The resulting value of total stressed blood volume is always negatively associated with the relative change in cardiac output after fluid administration. This finding confirms that total stressed blood volume is an index of fluid responsiveness. Another finding of this study is that the response curves are subject-specific. The method developed in this work can be applied to humans, since the data required is typically available in an intensive care unit. [less ▲]

Detailed reference viewed: 24 (2 ULg)
See detailRelationship between Stroke Volume and Pulse Wave Velocity
Kamoi, Shun; Pretty, Christopher; Chiew, Yeong Shiong et al

Conference (2015, September 01)

Stroke Volume (SV) measurements are essential for evaluating patient hemodynamic status and response to therapy. However, current methods for monitoring SV require either invasive or non- invasive ... [more ▼]

Stroke Volume (SV) measurements are essential for evaluating patient hemodynamic status and response to therapy. However, current methods for monitoring SV require either invasive or non- invasive additional measurements. This study investigates the relationship between SV and Pulse Wave Velocity (PWV) to examine whether the value of PWV can capture the changes in SV. The analysis was performed using data from six porcine experiments (N=6 Pietrain Pigs, 20-29 kg) in which left ventricular volume, aortic arc pressure, and descending aortic pressure waveforms were measured simultaneously. From the measured data, correlation coefficients were determined between absolute value of aortic PWV, SV and trend value ‘PWV – mean PWV’, ‘SV – mean SV’ during periods when changes in SV were induced from preload changes, as well as infusion of dobutamine. The results showed good correlation (r = 0.59) for trend value, however, the correlation coefficient were poor with r = 0.028 for absolute value across all pigs. The analysis showed that value of PWV is reliable for capturing trend value of SV in preload changes. However, it is unreliable for capturing absolute value of SV or changes in SV made from dobutamine. [less ▲]

Detailed reference viewed: 73 (0 ULg)
See detailL'emploi du conjonctif en kirundi
Tuyubahe, Pascal ULg

Conference (2015, September 01)

The verb in the conjuctive mood accompagnies always an other verb (auxiliary verb or verb in subordinate clause (valencielle or not) not introduced by a linking word. It is marked by an initial high tone ... [more ▼]

The verb in the conjuctive mood accompagnies always an other verb (auxiliary verb or verb in subordinate clause (valencielle or not) not introduced by a linking word. It is marked by an initial high tone on the first vowel after the first consonnant. After an auxiliary, the high tone disappears in the presence of -ra- morpheme in the present tense. Auxiliaries trigger raising from subject to subect and distinguish two type of morpheme -ra- in the conjunctive verb: -ra- determined syntactically and -ra- determined lexically. [less ▲]

Detailed reference viewed: 19 (2 ULg)
Peer Reviewed
See detailFitness evaluation and molecular characterization of a recombinant murine norovirus (MuNoV) during serial passages in cell culture
Ferreira de Oliveira Filho, Edmilson; Di Felice, Elisabetta; Toffoli, Barbara et al

Conference (2015, September 01)

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a ... [more ▼]

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a recombinant Wu20/CW1 strain was obtained after in vitro coinfection of RAW264.7 cells with parental MuNoV strains CW1 and Wu20 (Mathijs et al 2010). The recombinant strain showed reduced plaque size compared to the parental strains and it was suggested that this was due to modified virulence properties in vitro. The aim of this study was to observe and molecularly characterize the natural genetic evolution of the recombinant MuNoV strain across in vitro replications. Methods: MNV strains used in this study were CW1, WU20 (Thackray et al., 2007, kindly provided by prof. H. Virgin) and Rec MNV (Mathijs et al., 2010). RAW 264.7 cells (ATCC TIB-71) grown in Dulbecco’s modified Eagle’s medium (Invitrogen) complemented (DMEMc) with 10 % heat inactivated FCS (BioWhittaker), 2 % penicillin (5000 U /ml) and streptomycin (5000 mg/ml) (PS; Invitrogen) and 1 % HEPES buffer (1 M; Invitrogen). The recombinant strain was serially replicated in vitro in RAW264.7 cells (up to 14 passages). RAW 264.7 (Mouse leukaemic monocyte macrophage) cells were infected with MNV for 72 hours and afterwards lysed by freeze and thaw and viruses purified by ultracentrifugation of both cells and supernatant. Viral plaque sizes of early and late progenies (30 for each virus) were compared with the Image J software. The experiment was repeated two times. RNA was extracted from 140 ml purified suspension 1:5 diluted using the QIAamp Viral RNA Mini KitTM (Qiagen) according to the manufacturer’s instructions. cDNA was generated using a poly-A primer tagged GCCAACGACCGGGAGGCCAGC(T)20 previously described (Müller et al 2007) using superscript ii reverse transcriptase kit (Invitrogen®) treated with RNase H or with other antisense primers using iScript select kit (Bio-Rad®). For the genetic characterization two different studies were conducted. The first study aimed to develop a sequencing strategy in order to obtain the complete genome of the recombinant MNV. Then, in the second study, sequences obtained from different viral passages into RAW cells (e.g. P5 and P14) were compared in order to study the viral adaptation. Primers were designed using the Primer Express® software and netprimer® (Premier biosoft). PCR was performed using taq polymerase with thermopol buffer (new England biolabs) as per manufacturer’s instructions. Afterwards, fragments were excised from agarose gel and DNA purified using the QIAquick Gel Extraction KitTM (Qiagen) and cloning using the PGEM T easy cloning kit (Promega) plasmid DNA was transferred to sequencing by GATC Biotech (Koblenz, Germany). Results: The size of the lysis plaque surface of P2 and P14 showed a considerable divergence. The average plaque size increased from the earlier to the later progenies (from 0.1 mm2 to around 0.5 mm2). A significant difference was demonstrated between them with the Mann and Whitney non parametric statistical test. The genetic characterization of the recombinant strain obtained in vitro was previously based on partial genomic sequences, which provided limited information. Accordingly to our initial molecular analysis of 1.5 kb partial genomic sequence comprising the part of the RdRp and the part of the VP1 did not show any genetic modifications between passage 4 (accession number HM044221) and passage 14 recMNV. Therefore, a strategy for sequencing the complete genome of the different MNV strains was established. The genome of the recombinant MNV was divided into seven regions and the amplification was performed using either new designed or previous published primers. Molecular analysis using the nearly complete genome of the recombinant MNV passage 14 and the two parental strains (CW1 and WU20) showed nine modifications in the genome, comprising three aminoacid changes. Accordingly, two modification were in the RdRp region aa position 1384 Glycine (G) instead of Aspartic acid (D) and aa position 1393 Serine (S) instead of Asparagine (N) and one modification was in the capsid region one modification on aa position 296 Glutamic Acid (E) instead of Lysine. Conclusion: Even preliminary, our data provide evidence of virus adaptation to a new environment (here a cell culture system) after a recombination event. In order to specify whether these hints of genetic mutations could explain fitness modifications during in vitro evolution we need to compare the sequences of passage 14 and the previous viral cellular passages. In addition, two other parameters of in vitro virulence modification will be investigated: (i) virus production and (ii) growth kinetics. The data should provide interesting information about genetic evolution in the genus Norovirus, especially regarding recombination events and explain how a recombinant strain, first disadvantaged compared to its parental strains, could regain fitness by genetic evolution. [less ▲]

Detailed reference viewed: 34 (4 ULg)
Full Text
See detailThe Number of Structures Compatible with any Specified Correlation Function
Gommes, Cédric ULg

Conference (2015, September)

Detailed reference viewed: 13 (1 ULg)
Full Text
See detailBifacial serrated technology in the southern African Still Bay: new data from Sibudu Cave, Kwazulu-Natal
Schmid, Viola; Porraz, Guillaume; Rots, Veerle ULg et al

Conference (2015, September)

Detailed reference viewed: 37 (4 ULg)
Full Text
Peer Reviewed
See detailInvestigation of volatile mixture emit by human tissues degradation
Stefanuto, Pierre-Hugues ULg; Dubois, Lena; Lloyd, Rebecca et al

Conference (2015, September)

Human rescue dog unit are the more efficient tool to locate cadaver or people trap after a natural disaster. However, the dog training process is long and expensive. Dog trainers are always looking for a ... [more ▼]

Human rescue dog unit are the more efficient tool to locate cadaver or people trap after a natural disaster. However, the dog training process is long and expensive. Dog trainers are always looking for a better understanding of the dog olfaction matching to improve their training methods (1). During these training sessions, dogs are usually trained to locate body pieces due to the difficulty to obtain a full cadaver. Moreover, some training aid solution are available but their compositions and their efficiencies are not worldwide recognized (2). To answer these questions, this project is monitoring the headspace human organs during the decomposition process. Five different organs are used: heart, lung, liver, kidney and blood. Every organs are sampled in triplicates and let to decompose in glass jar. Regularly, the headspace of the jar is sample by dynamic pumping to sorbent tubes that will further be injected on comprehensive two-dimensional gas chromatography system (GC×GC). GC×GC is a powerful analytical tool that allows the complete resolution of “the smell of death”, i.e. the decomposition odor (3-4). The compounds identified in the organs headspace can be compared with the one coming from decomposition studies on full bodies to establish a biomarkers list that will further be used for dog training solution elaboration. References 1. Hoffman et al. FSI (2009) 186, 6-13. 2. Stadler et al. J. Chrom. A. 1255, 202-206. 3. Stefanuto et al. CPC (2014) 79, 786-789. 4. Perrault et al. J. Sep. Sci. (2015) 38, 73-80. [less ▲]

Detailed reference viewed: 79 (14 ULg)
Full Text
See detailRèglement EU 650/2012 sur les successions et planification successorale
Wautelet, Patrick ULg

Conference (2015, September)

Detailed reference viewed: 42 (0 ULg)
Peer Reviewed
See detailThe materiality of Intangible Cultural Heritage: food and social encounters.
Mescoli, Elsa ULg

Conference (2015, September)

Following the patrimonialization process of the Mediterranean diet, some gastronomies found themselves involved within a common framework of food traditions. Some regional practices, indicated as ... [more ▼]

Following the patrimonialization process of the Mediterranean diet, some gastronomies found themselves involved within a common framework of food traditions. Some regional practices, indicated as representative of national food cultures, were chosen to illustrate a shared heritage that historically took a shape around the Mediterranean sea. This heritage, still concretely performed, needed to be stated and preserved against the globalization of food practices. Institutional and political dynamics, occurring on a transnational level, triggered this process, which is nevertheless not detached from the communities involved. Common people played a fundamental role not only in promoting the patrimonialization process itself, but above all in concretely perpetuating some traditions and in spreading them in the contemporary world. In particular, some different cultural groups that found themselves living a common territory and social context thanks to migration, began dialoguing about their own food traditions, starting from some shared elements. As a consequence, some gastronomies interact through people’s practices and define in relation one to the other. This is the case, among others, of Moroccan and Italian cuisine. Throughout a doctoral research conducted within a group of Moroccan women living in the North of Italy, I collected an amount of ethnographic materials showing how social encounters developed through food. The influence of the patrimonialization process on these encounters made people try to find similarities among different traditional practices or to describe some ways of reinterpreting them in reason of the new context. My presentation will focus on these dynamics, thus proving that the Intangible Cultural Heritage is indeed grounded on materiality, that is, in this case, the concrete performance of food practices and their pragmatic effects on relations among humans. [less ▲]

Detailed reference viewed: 58 (2 ULg)
Full Text
See detailFirst Results From MAVEN’s Imaging UV Spectrograph
Schneider; McClintock; Stewart et al

Conference (2015, September)

We report the first results from The Imaging Ultraviolet Spectrograph (IUVS) aboard the Mars Atmosphere and Volatile and EvolutioN (MAVEN) spacecraft orbiting Mars. The instrument is accomplishing its ... [more ▼]

We report the first results from The Imaging Ultraviolet Spectrograph (IUVS) aboard the Mars Atmosphere and Volatile and EvolutioN (MAVEN) spacecraft orbiting Mars. The instrument is accomplishing its goals of characterizing the atmospheric composition and structure, enabling studies of atmospheric escape that will contribute to our understanding of Mars’ atmospheric evolution. In addition, the instrument has made unexpected discoveries concerning meteor showers, aurora and nightglow on Mars. [less ▲]

Detailed reference viewed: 33 (0 ULg)
Full Text
See detailImpact of forest transition on non-timber forest products in Central Africa
Gillet, Pauline ULg; Vermeulen, Cédric ULg; Feintrenie, Laurène

Conference (2015, September)

The objective of the study is to evaluate the impact of deforestation on non-timber forest products (NTFPs) harvest in Central Africa. The most common vegetal NTFPs are fruits, barks and leaves used as ... [more ▼]

The objective of the study is to evaluate the impact of deforestation on non-timber forest products (NTFPs) harvest in Central Africa. The most common vegetal NTFPs are fruits, barks and leaves used as complements to the staple food (cassava or plantain). Animal NTFPs such as caterpillars, worms and bush meat represent a major source of animal protein in the villagers’ diet. We analyzed the evolution of several parameters including NTFPs diversity, distance to the road, changes in land tenure rules, proportion in the alimentary bolus and in the villagers’ incomes. The research is based on field surveys, participatory mapping and geolocation of activities held in 8 villages. Three study sites are located at different stages on Mather’s forest transition curve (Mather, 1992). This curve shows the relationship between forest cover and population density. The sites represent the situations: (i) important cover of intact forest, (ii) forest partially degraded and under pressure of conversion to other land uses and (iii) small surfaces of degraded forest with a trend of plantation of useful trees on deforested land. Results show a reduction in NTFPs diversity along with the increase of deforestation. The maximum distance of collection sites to the road increases between the first and the second study site, as a consequence of the decrease in the quantity of NTFPs available. This distance decreases significantly in the third study site due to the contraction of villages’ terroir. The diversity of bush meat decreases while the hunting bag evolves from big to small species along with the forest transition. Land tenure rules to access and extract NTFPs become stricter. As a consequence, the proportion of these products reduces in the alimentary bolus and in the family cash income. This analysis establishes a strong link between Mather’s forest transition curve and the decline of the importance of NTFPs in the village production and livelihoods systems [less ▲]

Detailed reference viewed: 39 (0 ULg)
See detailIUVS observations of Nitric Oxide nightglow
Stiepen, Arnaud ULg; The IUVS team

Conference (2015, September)

Detailed reference viewed: 23 (4 ULg)
See detailTransparent electrodes based on silver nanowire networks: physical properties and potential applications
Lagrange, Mélanie; Sannicolo, Thomas; Langley, Daniel et al

Conference (2015, September)

Transparent electrodes (TE) constitute a key component of optoelectronic devices such as solar cells, efficient organic light-emitting diodes (OLEDs), touch screens. Currently the most widely used TE is ... [more ▼]

Transparent electrodes (TE) constitute a key component of optoelectronic devices such as solar cells, efficient organic light-emitting diodes (OLEDs), touch screens. Currently the most widely used TE is indium tin oxide (ITO), which offers low resistivity and high transparency in the visible. However the scarcity of indium and the lack of flexibility of ITO has prompted the search for alternative materials. Among emerging TE, metallic nanowire (NW) networks appear to be a promising solution since these percolating networks exhibit excellent properties with sheet resistance of a few Ω/sq and optical transparency of 90%, fulfilling the requirements for many applications. In addition, the fabrication of these electrodes involves low-temperature process steps and upscaling methods, thus making them very appropriate for future use as TE for flexible devices. Our research is focused on both the fabrication of TE based on silver NW and the optimization of their physical properties, using experimental and modelling approaches. The influence of several key parameters such as network density, silver NW dimensions as well as thermal annealing, on the networks physical properties is thoroughly explored. A comprehensive understanding of the relationship between design and main physical properties of these promising nanostructured networks will be presented. Their stability will also be discussed. Finally, we will also show that such TE can be very well adapted as transparent heaters. [less ▲]

Detailed reference viewed: 57 (3 ULg)
Full Text
See detailThe use of the Vadose Zone Experimental Setup as an innovative in situ characterization method for the vadose zone: a case study at an industrial contaminated site in Belgium
Fernandez de Vera, Natalia ULg; Beaujean, Jean ULg; Jamin, Pierre ULg et al

Conference (2015, September)

The development of protection and remediation plans for contaminated soil and groundwater require a detailed understanding of the transport of pollutants in the subsurface. However, such understanding is ... [more ▼]

The development of protection and remediation plans for contaminated soil and groundwater require a detailed understanding of the transport of pollutants in the subsurface. However, such understanding is affected by the lack of spatial and temporal coverage provided by the current in situ characterization technologies. A new system has been developed in order to overcome such limitations. The vadose zone experimental setup is a new development combining cross-hole geophysics and the Vadose Zone Monitoring System (VMS). In cross-hole geophysics, an injection of an electrical current using electrodes installed in vertical boreholes is triggered. From measured potential differences, spatial patterns related with subsurface heterogeneities, water content and solute concentrations are inferred. The VMS allows continuous measurements of water content at different depths of the vadose zone, as well as water sampling. The system is formed by a flexible sleeve containing monitoring units along its depth which is installed in a slanted borehole. The system was installed at a former industrial site in Belgium, where soil and groundwater are contaminated with BTEX, PAH, and heavy metals. Two VMS were installed in two slanted boreholes on site, together with four vertical boreholes containing electrodes for geophysical measurements. The site was initially monitored under natural recharge conditions. Water content sensors located along the VMS registered fast wetting and draining reactions to rainfall events followed by the activation of water transport through fractures. Results from soil water samples show continuous evolution of water chemistry with depth, due to disequilibrium between infiltrated water and the hydrochemical conditions in the unsaturated zone. Subsequently, a saline tracer was injected in the surface. The transport of the tracer in the subsurface was monitored via cross-hole and surface geophysics. Results from imaging reflect the evolution of a plume through vertical and lateral transport and dilution. [less ▲]

Detailed reference viewed: 112 (14 ULg)
Full Text
See detailLes premières forêts communautaires du Gabon - Le film - Bonus 1
Meunier, Quentin; Boldrini, Sylvie; Federspiel, Michèle et al

Conference (2015, September)

Detailed reference viewed: 7 (4 ULg)
See detailIconologies contemporaines : une compréhension symbolique de l’image est-elle toujours d’actualité ?
Hagelstein, Maud ULg

Conference (2015, September)

Le problème que je voudrais envisager ici tient à la pertinence de la compréhension symbolique de l’image. Il me semble qu’à première vue, la théorie de l’image contemporaine met en défaut ... [more ▼]

Le problème que je voudrais envisager ici tient à la pertinence de la compréhension symbolique de l’image. Il me semble qu’à première vue, la théorie de l’image contemporaine met en défaut l’interprétation symbolique de l’image. Ce débat peut être rapporté au problème de l’héritage, par les nouvelles générations de spécialistes de l’image, de la discipline de l’ICONOLOGIE et à la réception des travaux des grands historiens/théoriciens de l’art qui l’ont fondée. Depuis la fin des années 1980, de nombreuses tentatives visent à donner au concept d’iconologie un sens actuel. Au point que l’on peut – sans dénaturer cet élan théorique nouveau – parler d’« iconologies contemporaines ». La méthode iconologique vise l’interprétation du contenu symbolique des images. Elle repose donc entièrement sur une compréhension symbolique du visuel, et s’est d’ailleurs nourrie du dialogue avec la philosophie des formes symboliques d’E. Cassirer. Dans le système décrit par Cassirer, l’art se définit en tant que fonction symbolique (ce qui revient à dire = l’art est un domaine de production de significations, dont la vocation principale serait de charger de sens des éléments sensibles/matériels). Cette fonction symbolique particulière serait en outre inscrite dans un devenir historique (puisque le « contenu » des œuvres, les éléments de sens associés aux éléments sensibles, dépend fortement du contexte socio-historique d’inscription et reflète/révèle une vision du monde historiquement déterminée). Depuis la fin des années 1980, cette méthode a commencé à générer chez les théoriciens de l’art et du visuel (en général), toutes sortes de réactions d’insatisfaction – voire même d’hostilité. Les différentes réactions (je vais en détailler trois aujourd’hui : T. Mitchell, G. Didi-Huberman et G. Boehm) s’accordent (ou en tout cas pourraient s’accorder) sur le fait que l’iconologie doit être complétée : l’approche symbolique des œuvres doit par ex. pouvoir s’appuyer sur une attention soutenue à leur matérialité (c’est à cet endroit que les outils « phénoménologiques », notamment, viennent au secours de l’analyse). [less ▲]

Detailed reference viewed: 29 (1 ULg)
Full Text
Peer Reviewed
See detailModelling Agents’ Behavior in the Context of River Floods: An Ant Colony based Approach
Saadi, Ismaïl ULg; El Saeid Mustafa, Ahmed Mohamed ULg; Teller, Jacques ULg et al

Conference (2015, September)

This paper presents a model for understanding short-term travelers’ behavior in the context of river floods. In several cities, river floods are considerably affecting urban transportation systems. In ... [more ▼]

This paper presents a model for understanding short-term travelers’ behavior in the context of river floods. In several cities, river floods are considerably affecting urban transportation systems. In this regard, decision makers need comprehensive models to define efficient risk management strategies. The dynamic nature of this problem requires an algorithm able to deal with traffic redirecting during the micro-simulation process. Furthermore, a transportation network contains a significant number of links and nodes which lead to large computation times. In this regard, an Ant Colony Optimization (ACO) algorithm is proposed to solve such combinatorial problems. In a basic ACO, some ants/agents might push the algorithm to converge toward non-optimal solutions. In this context, a MAX-MIN Ant System (AS) approach is included in the algorithm to stimulate the best solutions. In addition, the discrete choice model is adapted to allow more behavioral reactions regarding simulated river floods. [less ▲]

Detailed reference viewed: 22 (10 ULg)
Full Text
See detailThermal-vacuum and vibration test campaigns that led to the OUFTI-1 nanosatellite being fully qualified by ESA for launch and operation in Earth orbit
De Dijcker, Sébastien ULg; Werner, Xavier ULg; Broun, Valery ULg et al

Conference (2015, September)

OUFTI-1’s test campaigns were divided into two phases. The goal of Phase 1 is to demonstrate that the different functionalities of the satellite work as intended. The goal of Phase 2 is to subsequently ... [more ▼]

OUFTI-1’s test campaigns were divided into two phases. The goal of Phase 1 is to demonstrate that the different functionalities of the satellite work as intended. The goal of Phase 2 is to subsequently demonstrate that the satellite can withstand the launch into orbit, and then work properly in the conditions of space. The corresponding tests thus involve both thermal-vacuum environmental tests (in appropriate test chambers) and vibration tests (on appropriate vibration pods). The conditions simulated during these tests are as close as possible to those that the satellite will encounter during its mission, covering as many cases as possible, amid uncertainties, since neither the launcher nor the orbit were known prior to the tests. Both phases involve the flight model (FM), in accordance with the so-called "protoflight" approach. [less ▲]

Detailed reference viewed: 108 (6 ULg)
See detailSea ice in the global biogeochemical cycles: How much do we care?
Vancoppenolle, M.; Moreau, S.; Bopp, L. et al

Conference (2015, September)

Large changes in the state and seasonality of sea ice are expected for this century in both hemispheres. The impact of these changes on marine biogeochemical cycles and ecosystems is difficult to predict ... [more ▼]

Large changes in the state and seasonality of sea ice are expected for this century in both hemispheres. The impact of these changes on marine biogeochemical cycles and ecosystems is difficult to predict. Will the polar oceans be more or less biologically productive? Will they take up more or less carbon? At this stage, the answers to these key questions are not obvious. Marine biogeochemical cycles in the sea ice zone are characterized by specific processes that have been unravelled over the last 20 years or so. They involve active biological and chemical processes within the sea ice, the modulation of heat and gas exchanges by the ice cover; and the impact of growing and melting sea ice on the water column stratification and vertical exchanges in the water. To understand how sea ice influences marine biogeochemical cycles, the sea ice biogeochemical community focuses on: (i) the synthesis of existing data and the interpretation of robust large-scale patterns; (ii) the introduction of new representations of sea ice processes into large-scale models of the Earth System and the study of their impact; (iii) the evaluation of existing observation methods and the development of new ones. In this talk, I will review and synthesize recent research activities in these lines of thought. [less ▲]

Detailed reference viewed: 44 (0 ULg)
Full Text
Peer Reviewed
See detailSilurian acritarchs and associated freshwater and marine microfloras from Saudi Arabia: comprehensive review and new insights
Le Hérissé, A.; Steemans, Philippe ULg; Breuer, P. et al

Conference (2015, September)

Detailed reference viewed: 31 (5 ULg)
Peer Reviewed
See detailAssessing the anti-androgenic activities of chemicals and surface waters using Brachionus calyciflorus and the anti-YAS test
Joaquim-Justo, Célia ULg; Bellisai, Giulia; Chalon, Carole et al

Conference (2015, September)

It has been shown over the past decade that Brachionids are sensitive to some vertebrate hormones and environmental contaminants with endocrine disrupting properties in vertebrates. Several Brachionus ... [more ▼]

It has been shown over the past decade that Brachionids are sensitive to some vertebrate hormones and environmental contaminants with endocrine disrupting properties in vertebrates. Several Brachionus species have been shown to be particularly sensitive to progestagens and anti-androgens. Institutions in charge of the monitoring and the management of the environment, need to constantly update their tools to ensure optimal detection of hazardous chemicals and to achieve adequate protection of the environment. With that intent, we compared the results obtained when testing the androgenic and anti-androgenic activity of substances and surface water samples/effluents with the YAS and anti-YAS tests and by sexual reproduction tests with Brachionus calyciflorus. Respective sensitivities and feasibilities of both these types of tests have been assessed and will be discussed. [less ▲]

Detailed reference viewed: 10 (0 ULg)
Full Text
See detailDiscovery of Diffure Aurora on Mars
Stiepen, Arnaud ULg; Schneider; Jain et al

Conference (2015, September)

The Imaging Ultraviolet Spectrograph (IUVS, McClintock et al., 2014) onboard the MAVEN spacecraft has discovered diffuse aurora in Mars’ northern hemisphere spanning a wide range of geographic latitudes ... [more ▼]

The Imaging Ultraviolet Spectrograph (IUVS, McClintock et al., 2014) onboard the MAVEN spacecraft has discovered diffuse aurora in Mars’ northern hemisphere spanning a wide range of geographic latitudes and longitudes (Figure 1). This widespread aurora differs from the small auroral patches discovered by the SPICAM instrument onboard the Mars Express spacecraft (Bertaux et al., 2005; Leblanc et al., 2008; Gérard et al., submitted; Soret et al., submitted) restricted to regions of crustal magnetic fields in the southern hemisphere. Furthermore, the northern diffuse aurora appears to peak at altitudes below 100 km, while the crustal field aurora peaked around 120 km. [less ▲]

Detailed reference viewed: 41 (2 ULg)
Full Text
Peer Reviewed
See detailFabriquer la nature pour la récréation des citadins : le tourisme à la ferme, la « renaturation » d’un service dénaturé ?
Dubois, Charline ULg; Schmitz, Serge ULg

Conference (2015, September)

Beaucoup de personnes associent / confondent les espaces agricoles et espaces de nature, tant au niveau des utilisateurs qu’au niveau des décideurs. A travers l’activité spécifique de l’agritourisme, nous ... [more ▼]

Beaucoup de personnes associent / confondent les espaces agricoles et espaces de nature, tant au niveau des utilisateurs qu’au niveau des décideurs. A travers l’activité spécifique de l’agritourisme, nous voulons interroger la domestication de la nature par les agriculteurs afin qu’elle colle aux représentations des clients urbains. Nous analysons les nouvelles manières de concevoir la campagne et la nature au travers d’activités de loisirs et services récréatifs à la ferme. Certains agriculteurs, voulant diversifier leurs activités, participer au développement local ou récupérer et promouvoir une image valorisante de leur métier, développent de nouveaux produits et services touristiques, culturels, gastronomiques, de bien-être et de santé à destination de la société (Watkins & Matless 2003, Poulot 2011, Aubry & Pourias 2013). Pour accueillir des touristes, les agriculteurs ne doivent-ils pas dénaturer l’activité agricole pour « renaturer » de manière urbaine l’environnement proche ? Les agriculteurs qui choisissent l’agritourisme adaptent ainsi progressivement leurs produits aux attentes des citoyens. Mais quelle limite donner à cette adaptation quand on connaît le lien entre l’activité agricole et l’activité d’accueil à la ferme ? Quelle est l’importance de l’atout nature dans cette diversification ? Nous interrogeons d’abord un corpus de 40 récits de vie auprès d’agriculteurs wallons et luxembourgeois, tenanciers d’une activité de diversification centrée sur le tourisme au sein de leur exploitation agricole (pratiques agricoles différentes, produits touristiques variés, expériences courtes et longues, motivations complexes) (Dubois 2014). Ensuite nous utilisons les résultats d’une enquête réalisée dans la rue auprès de touristes potentiels (sur les 1148 individus interrogés dans 7 pôles touristiques de Wallonie et du Grand-Duché de Luxembourg, 48% se considèrent comme urbain) (Dubois 2014). Nous utilisons enfin une analyse des exploitations agricoles visitées et de leurs abords au travers des éléments et caractéristiques (milieu physique, anthropique, humain, animaux, produits touristiques) mis en avant dans les photos prises sur le terrain et dans les images utilisées pour leur promotion touristique. Les analyses de contenu (analyses qualitatives avec NVivo®) et les analyses statistiques (analyses quantitatives avec Statistica®) font ressortir que le concept de nature mis en avant se focalise aux paysages, aux promenades et au calme : notamment des paysages que la personne peut observer depuis la terrasse, des promenades balisées de courte durée et un calme qui invite au repos et où la personne se sent en sécurité. La nature voulue par les urbains est une nature très sélective et cadrée. Mais même si les agriculteurs évoluent dans leur finage, il existe des initiatives et des stratégies différentes : la plupart des agriculteurs se contentent de domestiquer la nature au abords de la ferme pour faire paraître un cadre agréable et sécurisant, se gardant de modifier leur pratiques agricoles dans les champs avoisinants, d’autres, minoritaires, on prévu des parcours de découvertes et des activités intégrées dans la nature tels les golfs fermiers. [less ▲]

Detailed reference viewed: 47 (8 ULg)
Full Text
See detailWhat can we learn about quasars and uni cation scheme with the microlensing technique ?
Sluse, Dominique ULg

Conference (2015, September)

Our understanding of the gravitational lensing phenomenon has deeply progressed since the discovery of the "first" gravitationally lensed object in 1979 by Walsh and collaborators. With more than hundreds ... [more ▼]

Our understanding of the gravitational lensing phenomenon has deeply progressed since the discovery of the "first" gravitationally lensed object in 1979 by Walsh and collaborators. With more than hundreds of quasars known to be multiply imaged by a foreground galaxy, gravitational lensing is now a powerful astrophysical and cosmological tool. The stars located in lensing galaxies produce small deflections of the light rays coming from distant quasars which adds to the main deflection from the lensing galaxy. Because the deflection caused by the stars is small, the micro-images they produce remain unresolved. Only a flickering of the flux and spectral deformation of lensed quasars images are observed. I will explain how this micro-lensing effect, can be used to study the inner region of distant quasars. Specifically, I will zoom out from the inner accretion disc up to the torus, and give an overview of the information which can be retrieved at each of these scales. I will give a special emphasis on the constraint we can put on the orientation/geometry of the various emitting regions (i.e. disc, broad line region, torus) at each of these scales. [less ▲]

Detailed reference viewed: 18 (2 ULg)
Full Text
See detailDe Erfrechtverordening : wat moet elke notaris weten?
Wautelet, Patrick ULg; Goossens, Elise

Conference (2015, September)

Cette présentation offre une première approche des principes généraux qui structurent le Règlement 650/2012 relatif aux successions

Detailed reference viewed: 95 (0 ULg)
Full Text
Peer Reviewed
See detailAlkali injuries may lead to errors of diagnosis and mistreatment (161)

Conference (2015, September)

Detailed reference viewed: 12 (0 ULg)
Full Text
See detailTrapped magnetic flux density and influence of crossed fields in structures combining large grain, bulk (RE)BCO superconductors and soft ferromagnetic discs
Philippe, Matthieu ULg; Ainslie, Mark D; Fagnard, Jean-François ULg et al

Conference (2015, September)

Bulk (RE)BCO superconductors are able to trap record magnetic fields and can be used as powerful permanent magnets in various engineering applications such as rotating machines and magnetic bearings. We ... [more ▼]

Bulk (RE)BCO superconductors are able to trap record magnetic fields and can be used as powerful permanent magnets in various engineering applications such as rotating machines and magnetic bearings. We combine soft ferromagnetic pieces with bulk, large grain (RE)BCO high temperature superconductors to form superconductor/ferromagnet (SC/FM) hybrid structures. We study how a ferromagnetic disc influences the trapped flux density at the surface of a SC/FM structure at 77 K and the magnetic moment of the whole structure. The flux density generated by the superconductor is shielded above the ferromagnet. The saturation of the ferromagnet by the flux of the superconductor is investigated with the help of a finite element model and a simple analytical formula is suggested to determine the saturation threshold. Finally, we show that the ferromagnetic disc lowers the relative demagnetization effect caused by the application of magnetic field cycles orthogonal to the main magnetization (crossed field configuration). [less ▲]

Detailed reference viewed: 45 (9 ULg)
Full Text
See detailStudy of the Crystallization Behavior and the Subsequent Martensitic Transformation in a High Chromium Cast Steel submitted to Different Austenitization Temperatures
Tchuindjang, Jérôme Tchoufack ULg; Habraken, Anne ULg; Lecomte-Beckers, Jacqueline ULg

Conference (2015, September)

The crystallization behavior a High Chromium Cast Steel (HCCS) has been determined under Equilibrium conditions with ThermoCalc® software, and under non-Equilibrium conditions through Differential Thermal ... [more ▼]

The crystallization behavior a High Chromium Cast Steel (HCCS) has been determined under Equilibrium conditions with ThermoCalc® software, and under non-Equilibrium conditions through Differential Thermal Analyses (DTA). The results are compared to each other and the differences between the predicted solidification path and the actual one obtained from DTA (Figure 1) are highlighted. The microstructure in the as-cast conditions is characterized while using both scanning electron microscopy (SEM) and hardness measurements. The SEM analysis involves a combination of methods such as backscattered electron observation, energy dispersive spectrometry and backscattered-electron diffraction with X rays, which ensure proper identification of complex solidification carbides and the matrix made of martensite and retained austenite (Figure 2a). Solid state transformations occurring during the heating stage up to the austenitization temperature are studied towards both DTA and dilatometry, especially the dissolution/precipitation reactions. Different austenitization temperatures are considered prior to cooling down to room temperature during dilatometry tests to determine the starting points (Ms) for martensite transformation. In addition a cryogenic quenching within liquid nitrogen is performed which allows the completion of the martensitic transformation (Figure 2b) and help determining the critical point for the end of the martensitic reaction (Mf points). An enhanced discussion based on the influence of the cooling rate and the undercooling is developed to explain the differences that are observed between equilibrium and non-equilibrium conditions, which are mainly related to the solidification sequence and the carbides formed. The influence of the austenitization temperature and the matrix composition/supersaturation on both Ms and Mf points is also discussed. [less ▲]

Detailed reference viewed: 23 (3 ULg)
Full Text
Peer Reviewed
See detailA new hybrid approach for modelling groundwater flow in karst aquifers
Willems, Thibault ULg; Hakoun, Vivien ULg; Renard, Philippe et al

Conference (2015, September)

Groundwater flow modelling in karst aquifers represents a real challenge that requires adapted methods. The applicability of an innovative hybrid approach for modelling groundwater flow in karst aquifers ... [more ▼]

Groundwater flow modelling in karst aquifers represents a real challenge that requires adapted methods. The applicability of an innovative hybrid approach for modelling groundwater flow in karst aquifers, namely the Hybrid Finite Element Mixing Cell (HFEMC) method, is evaluated. The hybrid approach consists in combining a classical finite element (FE) model, to model slow flow in the rock matrix, with spatially distributed lumped reservoirs, to model fast flow in the karst conduits network. Water exchanges between the rock matrix and the conduits network are accounted for by means of an internal Fourier boundary conditions (BC). This BC (1st order exchange relation) allows to control the magnitude of water transfers between fast and slow flow domains. We tested the applicability of the HFEMC method on a schematic synthetic domain and on a real karst system. In the synthetic case analysis, we discussed dynamic processes of groundwater storage occurring in the karst system during a recharge pulse. The study focuses on the influence of selected parameters on representative variables such as the discharge curve of the karst system or pressure and mass transfers between conduits and rock matrix sub-domains. In this way, an inversion of the hydraulic gradient between karst conduits and the surrounding rock matrix is shown to occur during the recharge pulse. This phenomenon results in a temporary storage of water from conduits to the rock matrix, which impacts the modelled discharge curve. The first test performed on a real study site, the Noiraigue spring karst system (Jura mountains, Switzerland), exemplify the use of two separated lumped reservoirs for describing the conduits network, which allows to consider two base levels in the karst system. It also points out the challenges to face when modelling a complex natural karst system with the HFEMC approach. The results obtained show that the HFEMC approach is a good candidate to model groundwater flow in karst aquifers. [less ▲]

Detailed reference viewed: 88 (21 ULg)
See detailObservations of Mars aurorae
Gérard, Jean-Claude ULg; Soret, Lauriane ULg; Libert, Ludivine ULg et al

Conference (2015, September)

We present recent results obtained by combining remote sensing observations and in situ measurements of the Martian aurora made from Mars Express.

Detailed reference viewed: 36 (9 ULg)
Full Text
See detailTwinkling Lights in the Nightside Upper Atmosphere: How Nightglow Contributes to our Understanding of Global Dynamics
Brecht, Amanda; Bougher, S.; Stiepen, Arnaud ULg et al

Conference (2015, September)

Upper atmospheres of planets continuously emit photons in the UV, Visible, and IR regions of the electromagnetic spectrum. Some of these emissions are classified as airglow, which includes dayglow and ... [more ▼]

Upper atmospheres of planets continuously emit photons in the UV, Visible, and IR regions of the electromagnetic spectrum. Some of these emissions are classified as airglow, which includes dayglow and nightglow. There are several mechanisms to create these emissions, but this presentation will focus on nightglow emissions resulting from photochemistry of neutral components. These neutral components originate on the dayside and are transported from the dayside to the nightside of a planet, where they subsequently undergo chemical reactions yielding nightglow. Nightglow emissions serve as effective tracers for planetary middle and upper atmosphere global wind systems due to their variable peak brightness and spatial distributions. The main planetary focus for this presentation will be on Mars and Venus’ atmospheres, due to the similar chemical constituents which populate their upper atmospheres. Currently, NO UV nightglow has been observed (e.g. Venus Express, Mars Express) on both Venus and Mars, while O2 IR nightglow has only been observed on Venus but is predicted to be seen on Mars. The observations show variations in time and location (latitude, local time, and altitude). The locations of the maximum nightglow intensities on each planet are different, but are supportive of the general picture of these two planet’s global circulation patterns. Model implications for both nightglows on both planets can provide valuable insight and understanding of the dynamical and chemical processes creating the nightglow emission variability. Two three-dimensional general circulation models will be utilized: the Venus Thermospheric General Circulation Model (VTGCM) and the Mars Global Ionosphere-Thermosphere Model (MGITM). The model output will be compared to nightglow datasets for each planet individually and planet to planet, to contrast the variations of the nightglow features and the underlying drivers for those variations. [less ▲]

Detailed reference viewed: 45 (5 ULg)
Full Text
See detailComparison of the wear behavior of high speed steel grades obtained from conventional casting and laser cladding
Hashemi, Seyedeh Neda ULg; Lecomte-Beckers, Jacqueline ULg; Montrieux, Henri-Michel ULg et al

Conference (2015, September)

Tools Steels are alloys which withstand severe mechanical and physicochemical stresses in service. Therefore their alloying design that involved both the original chemical composition and the casting ... [more ▼]

Tools Steels are alloys which withstand severe mechanical and physicochemical stresses in service. Therefore their alloying design that involved both the original chemical composition and the casting route is crucial in order to achieve a tailored microstructure exhibiting enhanced wear performances. Tools steels obtained from conventional casting processes had received lot of attention so far as they yield typical microstructure composed of a quasi-continuous network of coarse grain boundary carbides with grain size ranging between 20 to 200 µm. Direct energy deposition applied to Tools Steels represents a new emerging technique that may allow ultrafine grained microstructures due to the higher cooling rates achieved especially in the solidification range. In this paper, four tool steels grades were studied, one of them being obtained from a conventional casting process and the other ones originated from the direct energy deposition. Differential Thermal Analysis helps enhancing the solidification sequence of the studied alloys, while their microstructure after subsequent heat treatment was characterized by the means of both optical and electron microscopes together with hardness measurements. Tribological tests carried out at room temperature and at high temperature were performed while using a “pin-on-disc” device. Based on the friction coefficient and the wear rate, the wear performances of the tool steel were determined and compared with one another. The influence of metallurgical features (the grain size, or the nature, the size and the distribution of carbides) on the wear behavior was also enhanced. The setting of the wear test parameters together with the microstructure of the studied materials seems to strongly influence the subsequent abrasion and wear mechanisms. [less ▲]

Detailed reference viewed: 42 (9 ULg)
See detailNature des villes, nature des champs : Synergies et controverses. Journée de terrain à La Louvière (Belgique)
Schmitz, Serge ULg; Cornut, Pierre; Dubois, Charline ULg et al

Conference (2015, September)

Comment une ville moyenne, née du charbon et de l'industrialisation, se restructure pour s'inscrire sur la carte de Belgique et maintenir activités économiques et habitants? Entre patrimoine Unesco, Plan ... [more ▼]

Comment une ville moyenne, née du charbon et de l'industrialisation, se restructure pour s'inscrire sur la carte de Belgique et maintenir activités économiques et habitants? Entre patrimoine Unesco, Plan Communal de Développement de la Nature et Rénovation urbaine, nous analyserons les divers projets d'amélioration du cadre de vie et d'intégration de la nature tant côté ville que côté campagne. [less ▲]

Detailed reference viewed: 33 (2 ULg)
See detailControlling factors and occurrence of inorganic and organic compounds in groundwater of urban and industrial areas
Gesels, Julie ULg; Dollé, Fabien ULg; Leclercq, Julie et al

Conference (2015, September)

A relatively extensive survey of groundwater contaminants is performed in urban and industrial contexts, at the regional scale (Walloon Region of Belgium), outside spots of contamination related to ... [more ▼]

A relatively extensive survey of groundwater contaminants is performed in urban and industrial contexts, at the regional scale (Walloon Region of Belgium), outside spots of contamination related to contaminated sites. More specifically, the most detected inorganic trace elements and organic contaminants are identified and their levels of occurrence are described statistically. Mechanisms that can explain their occurrence in groundwater are discussed. From a more pragmatic point of view, the data set has been also used to derive upper limits of pollutant background concentrations to be used in decision-making related to the management of contaminated groundwater in urban and industrial environments. The results presented are based on 243 samples from 8 sectors located in different geological contexts and different urban and industrial contexts. Each groundwater sample was analyzed for 19 inorganic trace elements, 61 organic micro-pollutants and 10 major and minor elements. Five physico-chemical parameters were measured in the field, at the time of sampling to determine the environmental conditions prevailing in groundwater. For comparison, existing groundwater analyses in natural context, available for the entire Walloon Region, were compiled from several databases. Cumulative distribution function plots allow comparing the distributions of inorganic trace elements in urban and industrial sectors to those obtained at the scale of the entire Walloon region. Cumulative distribution function plots are also used to compare the distribution of the inorganic trace elements in the different lithologies, in urban and industrial contexts. The composition of groundwater is altered in urban and industrial sectors with increased concentrations for most inorganic trace elements and organic contaminants. Anthropogenic influence is not limited to inputs of pollutants but also to alterations of subsurface environmental conditions, in particular redox conditions, resulting in the mobilization of pollutants. The influence of lithology is also marked in the data set. [less ▲]

Detailed reference viewed: 24 (4 ULg)
Full Text
Peer Reviewed
See detailDelinquent youth groups in Belgium: representations of their realities
Witvrouw, Line ULg

Conference (2015, September)

Detailed reference viewed: 26 (3 ULg)
Full Text
See detailBrain trains: scenario development to explore intermodal rail transport expansion in, from and towards Belgium
Troch, Frank; Vanelslander, Thierry; Belboom, Sandra ULg et al

Conference (2015, September)

Detailed reference viewed: 33 (12 ULg)
Full Text
Peer Reviewed
See detailLes progrès de la foresterie sociale et communautaire
Vermeulen, Cédric ULg; Meunier, Quentin; Moumbogou, Carl et al

Conference (2015, September)

Depuis plus de dix ans, le Gabon s'est doté de lois forestières riches en promesses quant à la gestion sociale des massifs forestiers par les populations locales, à travers le concept de « forêt ... [more ▼]

Depuis plus de dix ans, le Gabon s'est doté de lois forestières riches en promesses quant à la gestion sociale des massifs forestiers par les populations locales, à travers le concept de « forêt communautaire ». C'est dans ce cadre que s'est inscrit le projet Union Européenne DACEFI, projet mis en oeuvre de 2010 à 2014 à travers un partenariat entre le Ministère en charge des Forêts, le WWF, l’association sans but lucratif belge Nature+ et le Laboratoire de foresterie tropicale et subtropicale de Gembloux Agro-Bio Tech. L'objectif était de développer la foresterie sociale et communautaire sur les plans technique, institutionnel et organisationnel. Les équipes du projet ont développé des concepts et méthodes innovantes adaptées aux contextes socio-économiques locaux. La mise en place d'un cadre réglementaire a permis la création des premières forêts communautaires du Gabon, tandis que le renforcement de capacités au niveau des communautés a permis une autonomisation et une responsabilisation nécessaire à la mise en oeuvre des premiers plans simples de gestion. DACEFI en chiffres, c’est une centaine de villages sensibilisés depuis le début du projet, 16 sites partenaires accompagnés, 8 associations villageoises reconnues et formées, 7 communautés activement engagées dans la création d’une forêt communautaire, plus de 10 écoles et plusieurs centaines d’élèves primaires sensibilisés sur la gestion durable, 10 textes de loi rédigés ou révisés pour la mise en place du cadre réglementaire régissant les forêts communautaires au Gabon, une clé de répartition des revenus construite, accompagnée d’outils ludiques pour sa mise en place et sa compréhension et enfin plus de 10 000 plants d’arbres produits en pépinières et des dizaines de sites enrichis. Un film a également été produit qui sera présenté séparément au congrès. [less ▲]

Detailed reference viewed: 36 (1 ULg)
Full Text
See detailChallenging ourselves: three benchmarks for nonlinear system identification
Schoukens, Maarten; Noël, Jean-Philippe ULg

Conference (2015, September)

Detailed reference viewed: 10 (2 ULg)
Peer Reviewed
See detailImpact of the trophic strategy on the eco-functional diversification of a coral reef fish family
Gajdzik, Laura ULg; Aguilar-Medrano, Rosalia; Parmentier, Eric ULg et al

Conference (2015, September)

The analyses of the role of trophic strategies as promoter or constraint on processes of diversification remain understudied, especially in fish. The Pomacentridae (damselfishes), a species-rich (394 ... [more ▼]

The analyses of the role of trophic strategies as promoter or constraint on processes of diversification remain understudied, especially in fish. The Pomacentridae (damselfishes), a species-rich (394 species) and worldwide distributed reef fish family, include three main trophic guilds: (1) pelagic zooplankton feeders, (2) benthic feeders grazing on turf algae or biting polyps and (3) an intermediate group feeding on zooplankton, small benthic invertebrates and algae. Our study aims to analyze the role of the trophic strategies in the eco-functional diversity of Pomacentridae. Due to its feeding versatility, we hypothesize that the intermediate trophic group is the most successful group in terms of eco-functional diversity through evolutionary time. To target our aim, we compiled detailed dietary, environmental and behavioral data for 201 pomacentrid species, and compared the eco-functional diversity among trophic guilds. Various metrics, such as functional entity (i.e. unique combinations of functional traits) and functional richness revealed that the intermediate trophic group exhibited the lowest diversity. Then, we used time-calibrated phylogenies and comparative methods to evaluate the impact of trophic strategies on the tempo of ecological diversification. Results were consistent and the lowest rate of diversification was found for the intermediate trophic group. Our study shows that a generalist trophic strategy does not promote ecological diversification but being specialized may increase the ability to evolve greater diversity. [less ▲]

Detailed reference viewed: 33 (4 ULg)
Full Text
See detailProperty rights, freedom of testation and protection of family members under the EU Succession Regulation
Wautelet, Patrick ULg

Conference (2015, September)

Cette présentation synthétise les possibilités offertes par le Règlement succession afin de protéger les proches du défunt contre la volonté de celui-ci de les priver des droits réservataires qui ... [more ▼]

Cette présentation synthétise les possibilités offertes par le Règlement succession afin de protéger les proches du défunt contre la volonté de celui-ci de les priver des droits réservataires qui pourraient leur revenir. [less ▲]

Detailed reference viewed: 55 (0 ULg)
Full Text
Peer Reviewed
See detailCadaveric VOC profiling from human internal cavity
Stefanuto, Pierre-Hugues ULg; Varlet, Vincent; Grabherr, Silke et al

Conference (2015, September)

The processes tacking place during body decomposition is not yet totally understood. Soon after death, the different parts of a body start to decompose. This phenomenon conduct to the production of gases ... [more ▼]

The processes tacking place during body decomposition is not yet totally understood. Soon after death, the different parts of a body start to decompose. This phenomenon conduct to the production of gases inside or around the different organs. These gases reservoirs can be located using imaging tools as post-mortem computed tomography (PMCT) and subsequently sample (1). The analysis of very volatile compounds inside these internal cavities already provides useful information for legal medicine investigations (2). It gives valuable information about the potential cause of death avoiding the invasiveness of the autopsy procedure. This project wanted to perform an untargeted screening of this internal cavity in order to monitor the decomposition process taking place inside a cadaver. The analytical method was base on previously used techniques for complete decomposition analysis (3-4). This study wanted to investigate the volatile organic compounds (VOC) mixture present in these cavities. To achieve this task, we applied solid phase micro-extraction (SPME) combined with two-dimensional gas chromatography coupled to high-resolution time of flight mass spectrometer (GC×GC-HRTOFMS). The first point was to demonstrate the ability of GC×GC-HRTOFMS to detect these VOC. The combination of different statistical approaches conducted to establishment of potential biomarkers list. Base on these biomarkers identification, different decomposition stages were observed for different organs in the same body. The cardiac area seems to decompose faster than the other tissues studied in this project. References 1. Levy A.D. et al., Am. J. Forensic Med. Pathol. (2010) 31, 12-17. 2. Varlet V. et al., Anal. Chim. Acta (2013) 784, 42-46. 3. Stadler S. et al., Anal Chem (2013) 85, 998–1005. 4. Stefanuto et al. CPC (2014) 79, 786-789. [less ▲]

Detailed reference viewed: 64 (12 ULg)
Peer Reviewed
See detailFish as aquatic "sniffer dogs": Olfactory-mediated behaviors and conditioning of common carps to cadaver odors
Jamandre, Brian Wade ULg; Ferrari, Frederic; Joseph, Jean-Ronald et al

Conference (2015, September)

Even with the aide of modern technology, the search for cadaver or human remains underwater is still assisted by sniffer dogs mainly because of their superior sense of olfaction. However, dogs rely on ... [more ▼]

Even with the aide of modern technology, the search for cadaver or human remains underwater is still assisted by sniffer dogs mainly because of their superior sense of olfaction. However, dogs rely on volatile organic compounds in the air and that this may constraint their ability when searching for submerged cadavers. On the other hand, it has long been recognized that fishes use olfaction to sample odors from their surroundings to accomplish a task and are capable of acquiring new skills through training or conditioning. Despite decades of experimental and observational studies of the olfactory sensitivities of fishes, its potential application to forensic sciences has never been truly explored. In this pioneering research, we explore the possibility of using fish olfaction in detecting cadaver odors (porcine origin), using common carps Cyprinus carpio as model species in a series of experiments under laboratory conditions. We first observed the innate behavior of carps towards cadaver odors. Afterwards, the carps were trained in two-choice chamber experimental tanks by appetitive olfactory conditioning and odor masking methods. We also experimented on the effects of cadaver odors by early exposure using eggs and larval impregnation techniques, and observing the behaviors when they develop to early juveniles. In general, we found out that common carps are naturally repelled to cadaver odors. However using our devised conditioning protocol, results show that the conditioned carps were able to learn to be attracted to cadaver odors despite their innate aversion. The development of fish for cadaver detection is a simple but innovative idea and that it may present a cost-effective and reliable solution for the shortcomings of the existing methods in underwater cadaver search. We anticipate that this research will open up a variety of different studies in pursuit of developing fishes as biosensors and its application to forensic sciences. [less ▲]

Detailed reference viewed: 125 (12 ULg)
Peer Reviewed
See detailEcologia funcional de campos rupestres
Negreiros, Daniel; Le Stradic, Soizig ULg; Fernandes, Geraldo Wilson

Conference (2015, September)

Detailed reference viewed: 22 (0 ULg)
Peer Reviewed
See detailA Rorschach study of the borderline personality
Englebert, Jérôme ULg; Rommes, Jennifer; Mormont, Christian ULg et al

Conference (2015, August 28)

Nous étudions les manifestations psychologiques au test de Rorschach de sujets présentant un diagnostic de trouble de la personnalité borderline. Dans la continuité des études de Mormont (1969) et Mihura ... [more ▼]

Nous étudions les manifestations psychologiques au test de Rorschach de sujets présentant un diagnostic de trouble de la personnalité borderline. Dans la continuité des études de Mormont (1969) et Mihura (2006), nous avons administré le test à 15 sujets selon les recommandations du Système Intégré. Nos résultats indiquent les tendances spécifiques suivantes : une affectivité qui tend à être extratensive ou ambiéquale (86,7% des sujets), une proportion élevée de réponses couleur/forme (80%), un nombre élevé d’abstractions (66,7%), un nombre important de réponses « agressives » (80%) et « morbides » (86,7%). Une altération variable du testing de la réalité apparait pour chaque protocole. Notons la présence importante (80%) de références personnelles (PER). Signalons également la présence constante de termes particuliers dans le verbatim : énonciation de la couleur rouge (sang, amour), caractère dysphorique de certaines réponses (monstrueux, diabolique), ainsi que des perceptions duales (le bien/le mal). En conclusion, notre étude suggère que le Rorschach en Système Intégré, repérant en première approche des éléments psychologiques que l'on peut raisonnablement mettre en rapport avec la sémiologie clinique et la théorie des personnalités borderlines, l'approfondissement de la recherche peut laisser espérer une meilleure compréhension de ce trouble complexe. [less ▲]

Detailed reference viewed: 106 (6 ULg)
Peer Reviewed
See detailOne hand – many faces. Painterly practices in the Theban Tomb of vizier Amenemope (TT 29)
Laboury, Dimitri ULg; Pieke, Gabriele

Conference (2015, August 28)

Since 1999, the Belgian Archaeological Expedition in the Theban (Mission archéologique dans la Nécropole thébaine - MANT) is executing fieldwork in several tombs located in the southern part of Sheikh ... [more ▼]

Since 1999, the Belgian Archaeological Expedition in the Theban (Mission archéologique dans la Nécropole thébaine - MANT) is executing fieldwork in several tombs located in the southern part of Sheikh Abdel Gurna. As part of this fieldwork, the project “Painters and painting in the Theban Necropolis under the 18th Dynasty“ (FNRS – Univeristy of Liège) aims at studying painterly practices and working procedures of artists and workshops in charge of the decoration of elite tombs in this cemetery. The paper will present the results of recent work carried out in this context in the tomb of Amenemope (TT 29), vizier under Amenhotep II. Unlike in many other Theban tombs of the 18th dynasty where different painters are attested, evidence points to a single hand, responsible for the execution of the entire wall paintings preserved in this funerary chapel. Nevertheless the style of human figures or hieroglyphs is not completely consistent but to the contrary shows certain variability in the layout and execution of motifs, that the paper will address as an issue. [less ▲]

Detailed reference viewed: 62 (2 ULg)
Peer Reviewed
See detailCompeting one-way essential complements: the forgotten side of net neutrality
Gautier, Axel ULg

Conference (2015, August 28)

Detailed reference viewed: 18 (0 ULg)
Peer Reviewed
See detailThe Rorschach and the theory of art: the sublime and the formal
Englebert, Jérôme ULg; Sass, Louis

Conference (2015, August 28)

Together with the crucial work of standardization initiated by Exner, a future focus for research on the Rorschach test concerns the psychological significance of the variables. The Comprehensive System ... [more ▼]

Together with the crucial work of standardization initiated by Exner, a future focus for research on the Rorschach test concerns the psychological significance of the variables. The Comprehensive System has a solid empirical basis offering impressive validity and reliability. By contrast, study and discussion of the psychological correlates of the different codes and their interpretation remains something of a work-in-progress, in much need of both speculative hypotheses and theoretical reflection. In this context, we hope to offer an original hypothesis that is rooted in esthetic theory (Schiller, Burke, Schopenhauer), literature (Stendahl), the philosophy of art (Kant), and existential philosophy (Heidegger). In this paper we propose to introduce the notion of the « sublime », which is to be distinguished from the « beautiful », in order to provide a way of interpreting the significance of both Vista (V) and Form Dimension (FD) responses in the Rorschach. The sublime is associated with a submersion of the cognitive faculties, even a state of feeling overwhelmed, in contrast with the clarity of the beautiful, which is associated with an experience of things being circumscribed in space and under the cognitive/perceptual control of the subject. Our reflection will lead into discussion of the links between perception and anxiety, and to the distinction to be made between anxiety and fear. In concluding, we will take up the adaptive dimension of Vista and FD responses, insofar as they reflect, in accord with Rorschach (1921) and Exner (2003), various forms of introspective awareness. [less ▲]

Detailed reference viewed: 34 (2 ULg)
Peer Reviewed
See detailTradition and Creativity. Toward a Study of Intericonicity in Ancient Egyptian Art
Laboury, Dimitri ULg

Conference (2015, August 27)

Although a key-concept in Art historical discourse and reasoning, creativity has almost always been avoided as an issue in the discussion of Ancient Egyptian Art, as if the notion was simply irrelevant in ... [more ▼]

Although a key-concept in Art historical discourse and reasoning, creativity has almost always been avoided as an issue in the discussion of Ancient Egyptian Art, as if the notion was simply irrelevant in such a context. This surprising phenomenon has clearly deep roots in the history of the western vision of Ancient Egyptian Art (and civilization). Nonetheless, the investigation of some (actually quite rare) cases of true copies in Ancient Egyptian Art reveals that creativity operated within a process of reinterpretation of previous works and their tradition, a process that can be best analyzed, it seems, with the help of the conceptual frame of intericonicity (or interpictoriality). The paper will also aim to defend the use of this notional tool in the analysis of Ancient Egyptian Art by attempting to define how creativity was conceptualized in Ancient Egyptian textual claims for innovation and originality. [less ▲]

Detailed reference viewed: 88 (1 ULg)
Full Text
Peer Reviewed
See detailA new dictionary of Ancient Egyptian
Winand, Jean ULg

Conference (2015, August 27)

Detailed reference viewed: 283 (3 ULg)
Peer Reviewed
See detailHypnose et Stress : "La communication hypnotique comme outil d'amélioration de la qualité des soins et du bien être au travail ?"
Nyssen, Anne-Sophie ULg

Conference (2015, August 27)

Hypnose et Stress : "La communication hypnotique comme outil d'amélioration de la qualité des soins et du bien être au travail ?" La communication fait partie intégrante de la relation de soin. Mais ... [more ▼]

Hypnose et Stress : "La communication hypnotique comme outil d'amélioration de la qualité des soins et du bien être au travail ?" La communication fait partie intégrante de la relation de soin. Mais, quelle attention portons-nous aux mots que nous utilisons au quotidien dans nos interactions ? On estime que 70 à 80% des plaintes et des poursuites en matière médicale sont liés à des problèmes de communication : manque d’attention du personnel pressé, jargon incompréhensible, manque de collaboration,... Ces difficultés de communication manifestent leurs conséquences à la fois chez les patients et chez le personnel soignant, qui ne sort pas indemne des difficultés relationnelles. Ces dernières années, il n’y a pas un mois sans qu’une nouvelle étude parle de stress et de burnout chez le personnel soignant. Dans cet exposé, nous présenterons l’évolution du concept du stress, sa relation à la perception de contrôle et nous inviterons les soignants que nous sommes à observer un regard critique sur nos échanges verbaux. Nous montrerons comment les mots que nous utilisons au quotidien peuvent être porteurs de suggestions négatives et avoir un « effet nocebo » et comment l’apprentissage de l’hypnose constitue un outil puissant permettant d’améliorer à la fois la qualité des soins et le bien être au travail. [less ▲]

Detailed reference viewed: 104 (5 ULg)
Full Text
Peer Reviewed
See detailA shared repository of hieroglyphic signs: The Thot sign-list
Polis, Stéphane ULg; Rosmorduc, Serge

Conference (2015, August 27)

The principles to be taken into consideration for building a hieroglyphic sign list have been discussed for quite some time (Schenkel 1977), and recently received renewed and additional attention (Meeks ... [more ▼]

The principles to be taken into consideration for building a hieroglyphic sign list have been discussed for quite some time (Schenkel 1977), and recently received renewed and additional attention (Meeks 2013, Polis & Rosmorduc 2013). The catalogs of hieroglyphic signs (e.g. Buurman et al. 1988, Grimal et al. 1993), however, did not implement these principles, since their goal was rather to allow for the encoding and rendering (either on paper or on screen) of as many hieroglyphs as possible. As a result, hieroglyphic text editors (Gozzoli 2013) will usually do the trick when one aims at displaying hieroglyphic texts, but in its current state, the Manuel de Codage makes the creation of annotated corpora that include hieroglyphs problematic (Nederhof 2013). In this paper, we do not focus on issues pertaining to the relative positioning of hieroglyphs (Nederhof 2002), but on another — more essential — problem, namely the hieroglyphic sign-list itself. Existing sign-lists suffer from the fact that they are (1) unstructured, (2) unreferenced, and (3) non-described. Based on our experience with respect to the encoding of hieroglyphic spellings in the Ramses corpus (Polis et al. 2013; Polis & Winand 2013), we present a beta version of the Thot sign-list, which has the following features (see the discussion in Polis & Rosmorduc 2013): 1. The sign-list is structured: each hieroglyph of the sign-list belongs to one of the three following categories: grapheme, class and shape (from the more abstract to the more concrete, see also Meeks 2013). 2. Signs are referenced: each sign is accompanied by at least one reference to a publication in which the hieroglyph is used in context. For this purpose, the unpublished lists of hieroglyphic signs compiled by Hornung and Schenkel have been instrumental. We are much grateful to both of them for sharing this material with us and allowing us to use it in this context. 3. Signs are described at two levels: a. The functions that each hieroglyph can fulfill (Polis & Rosmorduc in press), with illustrative examples for each function. b. The salient iconic features of each hieroglyph, based on a controlled vocabulary. Practically, the Thot sign-list is a Wiki, i.e., a web application that allows collaborative modification of its content and structure. Thanks to the Semantic Mediawiki extension, one can create links between any signs sharing a given property. The goal is obviously to allow any Egyptologist to enrich the structured sign-list Thot with new signs, references and descriptions. [less ▲]

Detailed reference viewed: 131 (2 ULg)
Full Text
See detailElicitor screening to protect wheat against Zymoseptoria tritici
Le Mire, Géraldine ULg; SIAH, ALI; Deleu, Magali ULg et al

Conference (2015, August 27)

Plants face an array of biotic and abiotic stresses in their environment, making it necessary to use various chemical inputs to maintain satisfactory yield. Today, conventional agriculture is evolving ... [more ▼]

Plants face an array of biotic and abiotic stresses in their environment, making it necessary to use various chemical inputs to maintain satisfactory yield. Today, conventional agriculture is evolving towards more sustainable practices, out of respect for human health and the environment. Elicitors are considered as promising biological control tools and draw major interest in IPM strategies. These plant-immunity triggering compounds, also called “stimulators of plant natural defenses”, induce a general and systemic resistance in the plant to various diseases. Although numerous elicitors have already been identified and some of them reached the market since the late 1970s, further investigations are still required to better understand the mode of action of these molecules in the plant and ensure a consistent efficiency under various field conditions. Few elicitors have yet been successfully tested and formulated to protect monocotyledonous crop plants such as wheat, which is cultivated over large areas in Europe. This study focuses on the screening of ten potential elicitor products of various origins and structures to protect winter wheat against the fungal pathogen Zymoseptoria tritici. Greenhouse trials were carried out to measure the ability of the different products to reduce disease foliar symptoms (necrosis, chlorosis and pycnidia). Topical spraying treatments with 3 different concentrations of each product were carried out 5 days before pathogen inoculation. Disease severity (% of symptoms on the total surface of the third leaf) was then scored every 2 days up to 28 days post-inoculation. In addition, phytotoxicity and biocide activity of these products was evaluated under greenhouse and laboratory conditions, respectively. The corresponding results will be presented and discussed with the perspective to choose the best elicitor candidates and to undertake investigations on the signaling pathway and the influence of environmental parameters on the elicitation capacity. [less ▲]

Detailed reference viewed: 51 (9 ULg)
Full Text
Peer Reviewed
See detailRamses goes Online. An annotated corpus of Late Egyptian texts in interaction with the Egyptological community
Polis, Stéphane ULg; Rosmorduc, Serge; Winand, Jean ULg

Conference (2015, August 27)

The Ramses project was first introduced to Egyptologists in 2008, during the 10th interna-tional congress of Egyptologists held in Rhodes (Winand et al. in press). After eight years of IT developments ... [more ▼]

The Ramses project was first introduced to Egyptologists in 2008, during the 10th interna-tional congress of Egyptologists held in Rhodes (Winand et al. in press). After eight years of IT developments (under the responsibility of S. Rosmorduc) and of annotation of Late Egyptian texts (Polis et al. 2013; Polis & Winand 2013), the data can now progressively be made available online. After an introduction providing general information about the annotated corpus (510 000+ tokens; 65 000+ hieroglyphic spellings; 10 000+ lemmata; 4000+ texts), this paper will focus on three main aspects: 1. Description of the functionalities of the annotating tool (the TextEditor), with a special attention to the metadata that are used for describing the documents and texts that are integrated in the corpus. This section will include proposals regarding the creation of shared thesauri for describing (written) Egyptian material. 2. Discussion of the solution that has been designed for handling the evolution of the database (see already Rosmorduc 2013), both as regards its content — namely, any change that affects texts, lemmata, inflexions, spellings, etc. — and its structure — types and structure of the metadata, evolution of the texts representation format, etc. In a nutshell, the new database will use the technique of event sourcing, where the database is seen as a sequence of editing events, which allows both “time travel” in the database history, and easy fix of editing mistakes. 3. Presentation of the first Online version of Ramses. Several corpora of Late Egyptian texts (the so-called Tomb Robberies, the Late Egyptian Stories, the Late Ramesside letters and a selection of ostraca from Deir el-Medineh) will be made available for the first time at the occasion the 11th International Congress in Florence. The website will of course allow users to browse the annotated texts and lexemes, and to make simple or complex queries. Besides, we will also encourage Egyptologists to interact directly with the data, e.g., by flagging inaccuracies or signaling alternative analysis. [less ▲]

Detailed reference viewed: 68 (2 ULg)
Peer Reviewed
See detailChallenges for the restoration of dry calcareous grasslands in quarries: does nature need help?
Pitz, Carline ULg; Piqueray, Julien; Harzé, Mélanie ULg et al

Conference (2015, August 26)

In order to maximize the biodiversity potential of dry calcareous grasslands in former quarries two options are available to managers: (i) allow species to spontaneously recolonize the site, (ii ... [more ▼]

In order to maximize the biodiversity potential of dry calcareous grasslands in former quarries two options are available to managers: (i) allow species to spontaneously recolonize the site, (ii) implement technical support for ecosystem restoration. This study aimed at characterizing the spontaneous communities established in dry area of unexploited quarries and at comparing communities encountered to the succession panel of dry grasslands. To evaluate the ecological succession in quarries, three successional stages where defined: (i) less than three years; (ii) three to 20 years; and (iii) more than 20 years after exploitation. For each successional stage, six parcels were selected and 20 1m2 plots were randomly marked in each parcel. All selected parcels presented dry grasslands abiotic conditions: filtering and stony soils and south orientation. During the 2014 vegetation period, percentage cover of higher plant species was recorded in each plot. Explaining environmental variables including coordinates, altitude, slope (degrees), soil depth, exposure, maximum vegetation height, bare ground cover, moss cover, and shrub cover (%) were measured. Our main results showed that, over decades of time, the ecological succession in dry area of unexploited quarries does not approach a typical formation of dry calcareous grassland. Most recolonizations tended to form meadows communities, except for three sites belonging to a specific landscape context. Potential implications for future quarries restoration will be discussed. [less ▲]

Detailed reference viewed: 50 (9 ULg)
Full Text
See detailAnthropogenic landscape change: synthesis of the concepts and quantification methods
Andre, Marie ULg; Vranken, Isabelle ULg; Mahy, Grégory ULg et al

Conference (2015, August 26)

Anthropogenic disturbances impact the whole biosphere, at least indirectly, and are of major concern in various disciplines and policies. To tackle it, most studies, specific to their thematic, create ... [more ▼]

Anthropogenic disturbances impact the whole biosphere, at least indirectly, and are of major concern in various disciplines and policies. To tackle it, most studies, specific to their thematic, create their own reference framework without connection with related purposes in other disciplines. This results in a plethora of terms and concepts that in turn impedes addressing that issue on a comprehensive way as well as complementarity between studies. Here, we clarify and synthesize the most frequently employed terms to characterise human impact on the environment (anthropisation, naturalness, hemeroby, novel ecosystem, analogous ecosystem, climax, etc.), their synonyms, the nuances and relationships between each of them, as well as the concepts used to designate the responses given by humans to environmental disturbances (restoration, management, conservation). We go on reviewing the methods used to assess anthropogenic changes, exploring different branches of ecology and geography. The strengths and weaknesses of the existing approaches are then used as a basis to develop a new analytical framework: we propose an action-oriented type of naturalness, and we develop a general methodology to quantify landscape anthropisation. Our methodology combines object-oriented and gradient analyses. Moreover, it is based on the assessment of ecosystem disturbance, landscape configuration and dynamics as well as on easily acquired data sets. Our integrated approach of the concern could be at the basis of land planning, environmental restoration and management practices as well as policies. [less ▲]

Detailed reference viewed: 78 (9 ULg)
Full Text
Peer Reviewed
See detailThe harmonic balance method for bifurcation analysis of large-scale nonlinear mechanical systems
Detroux, Thibaut ULg; Renson, Ludovic ULg; Masset, Luc ULg et al

Conference (2015, August 26)

The harmonic balance (HB) method is widely used in the literature for analyzing the periodic solutions of nonlinear mechanical systems. The objective of this paper is to extend the method for bifurcation ... [more ▼]

The harmonic balance (HB) method is widely used in the literature for analyzing the periodic solutions of nonlinear mechanical systems. The objective of this paper is to extend the method for bifurcation analysis, i.e., for the detection and tracking of bifurcations of nonlinear systems. To this end, an algorithm that combines the computation of the Floquet exponents with bordering techniques is developed. A new procedure for the tracking of Neimark-Sacker bifurcations that exploits the properties of eigenvalue derivatives is also proposed. As an application, the frequency response of a structure spacecraft is studied, together with two nonlinear phenomena, namely quasiperiodic oscillations and detached resonance curves. This example illustrates how bifurcation tracking using the HB method can be employed as a promising design tool for detecting and eliminating such undesired behaviors. [less ▲]

Detailed reference viewed: 21 (1 ULg)
Full Text
See detailOutils d’aide à la réussite dans le cadre du cours de Biologie en Premier bachelier en Faculté des Sciences à l’Université de Liège : présentation et analyse
Thiry, Marc ULg; Rigo, Pierre ULg; Poffé, Corentin ULg

Conference (2015, August 26)

A l’Université de Liège, les cours du premier quadrimestre sont communs à certaines sections du premier bachelier de la Faculté des Sciences. Le programme de ce quadrimestre commun reprend un cours de ... [more ▼]

A l’Université de Liège, les cours du premier quadrimestre sont communs à certaines sections du premier bachelier de la Faculté des Sciences. Le programme de ce quadrimestre commun reprend un cours de biologie. Depuis plusieurs années, le titulaire de ce cours de biologie met en place diverses actions visant à favoriser la transition secondaire-université : séminaires, remédiations, aides à l’étude, forum, livre de référence, etc. Ces différentes actions font l’objet d’un suivi didactique, permettant un monitoring précis et une régulation au fil du temps. Dans un premier temps, la communication présentera l’état des lieux des outils mis à la disposition des étudiants en vue de favoriser leur réussite pour le cours de biologie, mais aussi pour les autres cours, par transfert des compétences acquises. Dans un second temps, le dispositif de suivi didactique des séances d'aide à l'étude et ses principaux résultats seront présentés. [less ▲]

Detailed reference viewed: 14 (0 ULg)
Full Text
See detailGeophysical Investigation of the Pb-Zn deposit of Lontzen-Popplsberg, Belgium
Evrard, Maxime ULg

Conference (2015, August 26)

Detailed reference viewed: 39 (4 ULg)
Full Text
See detailperrénité et mutations des familles : approche sociologique
Gavray, Claire ULg

Conference (2015, August 26)

remise en cause des clichés concernant l'évolution de La Famille ; discussions autour des enjeux contemporains et futurs qui concernent les familles

Detailed reference viewed: 30 (4 ULg)
Peer Reviewed
See detailL’appropriation du jeu vidéo: le cas des créateurs amateurs
Hurel, Pierre-Yves ULg

Conference (2015, August 25)

"Notre communication, basée sur les résultats de ces entretiens en cours, se concentrera sur les questions liées au début de l’activité des amateurs car ces dernières révèlent les étapes successives du ... [more ▼]

"Notre communication, basée sur les résultats de ces entretiens en cours, se concentrera sur les questions liées au début de l’activité des amateurs car ces dernières révèlent les étapes successives du processus d’appropriation d’un média généralement perçu comme lointain, complexe, hors de portée. Notre intervention montrera que la découverte d’un logiciel d’aide est vécue comme un évènement majeur du parcours de l’amateur, notamment parce qu’elle s’inscrit dans un processus d’appropriation qui était déjà en cours." [less ▲]

Detailed reference viewed: 27 (3 ULg)
Full Text
See detailDoes combining a wheat and pea mixture with methyl salicylate reduces aphid populations in both crops?
Chevalier Mendes Lopes, Thomas ULg; Fassotte, Bérénice ULg; Hatt, Séverin ULg et al

Conference (2015, August 25)

Aphids are important pests of wheat and pea. Among the alternative methods to control them with less reliance on insecticides, crop associations already proved to be efficient. However, if increasing the ... [more ▼]

Aphids are important pests of wheat and pea. Among the alternative methods to control them with less reliance on insecticides, crop associations already proved to be efficient. However, if increasing the chemical and structural complexity of vegetation can disrupt their host plants location, the searching efficiency of predators and parasitoids can also be reduced. Therefore, these beneficials may not always be more abundant in such systems. Combining crop associations with attractive semiochemicals for natural enemies can be interesting to solve this problem. In this research, we compared the effect of a wheat and pea pure stand, wheat and pea mixture, and wheat and pea mixture combined with methyl salicylate (MeSA) formulated in alginate gel beads, on the abundance and diversity of aphids and their natural enemies. These were weekly observed on plants during 2013 and 2014 growing seasons. Over these two years, significantly higher numbers of pea aphids (Acyrthosiphon pisum (H.)) were observed in the pure stand of pea compared with both mixtures (with and without MeSA). No significant differences were observed between treatments for wheat aphids (Sitobion avenae (F.), Metopolophium dirhodum (W.) and Rhopalosiphum padi (L.)), which were significantly less abundant than pea aphids. Aphid natural enemies were mainly observed on pea plants. Hoverfly larvae abundance was not significantly different between treatments during both years. The same phenomenon occurred with hoverfly pupae in 2013, while these were significantly more abundant in both mixtures compared with the pure stand in 2014. However, their number did not differ significantly between the mixture with and without MeSA. Few ladybirds and lacewings were observed. No significant differences were observed between treatments for parasitoid mummies in 2013. Their abundance was significantly higher in the pure stand of pea compared with both mixtures in 2014. Results from this study show that mixing wheat and pea is an efficient method to maintain aphid populations at a very low level on pea. The use of MeSA did not show significant effects on natural enemies. However, mixing these crops may be enough to reduce aphid populations under an acceptable threshold. [less ▲]

Detailed reference viewed: 50 (14 ULg)
Full Text
Peer Reviewed
See detailPromoting quarries biodiversity through partnerships: a Belgian case study
Seleck, Maxime ULg; Harzé, Mélanie ULg; Pitz, Carline ULg et al

Conference (2015, August 25)

Throughout the life cycle of quarries, a large diversity of temporary habitats is generated, sometimes left to evolve to more permanent ones. In many cases, the biological roles of quarries are neglected ... [more ▼]

Throughout the life cycle of quarries, a large diversity of temporary habitats is generated, sometimes left to evolve to more permanent ones. In many cases, the biological roles of quarries are neglected though they are playing a significant role as stepping-stones and regulating green infrastructure in landscapes. In highly urbanized and controlled landscapes, quarries are an exceptional opportunity to maintain rare and threatened transient habitats hosting fugitive species. Such ephemeral biodiversity is hard to manage through a site legal protection status. As exploitation progresses, more permanent, biodiverse habitats settle in abandoned areas but the biologic potential could also be maximized by optimized groundwork through the whole exploitation process. Exploitation plans taking into consideration biodiversity could allow maximizing quarry biodiversity hosting capacity during the exploitation phase and in further rehabilitation schemes. Since 2012 Gembloux Agro-Bio Tech (University of Liège) provides support to FEDIEX - the Belgian federation of extractive industries – in its implementation of a sectorial charter on “Quarries and Biodiversity” that aims at i) raising members’ awareness; ii) promoting the integration of practical recommendations for the protection and management of biodiversity in exploitation plans; iii) quarries’ personnel trainings. Our presentation will trace realizations undertaken under this collaboration, among which the “Mr/Ms Biodiversity” training organized in 2013, 2014 and 2015, the publication of folders popularising the management and enhancement of nature in active quarries and the collaboration in the redaction of a “LIFE in Quarries” project (LIFE Biodiversity) submitted for the 2014 LIFE call. [less ▲]

Detailed reference viewed: 43 (8 ULg)
See detailCouvents de femmes en réseaux sur la Dorsale catholique
Henneau, Marie-Elisabeth ULg

Conference (2015, August 25)

Detailed reference viewed: 11 (1 ULg)
See detailHow can an embryo become a prophet?
Swennen, Philippe ULg

Conference (2015, August 24)

Both Vedic and Avestan sacrifices show us how a sacrificer tries to make contact with his gods in the context of complex liturgical ceremonies implying the presence of priests who offer several kinds of ... [more ▼]

Both Vedic and Avestan sacrifices show us how a sacrificer tries to make contact with his gods in the context of complex liturgical ceremonies implying the presence of priests who offer several kinds of gifts, for instance poems, libations or slaughtered cattle. In both cases the religious doctrine justifying the liturgical process explains that the sacrificial ground and space correspond to the beginning of Time, but the definitions given to these beginnings are extremely divergent. This is surprising, because Indo-Iranian linguistics strongly suggests that both religious systems should be genetically very close. In Vedic India, the sacrificer represents an embryo, which should have been a god, but begets the human race. In Iran, he renews the first perfect ceremony achieved by Zarathushtra, the so-called prophet who chose to revere Ahura Mazda. How did one similar doctrine produce two so different products? [less ▲]

Detailed reference viewed: 12 (1 ULg)
See detailTuta absoluta (Lepidoptera: Gelechiidae) development on wild and cultivated plant species
Bawin, Thomas ULg; Dujeu, David ULg; Fagan, Maud et al

Conference (2015, August 24)

Introduction: The tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae), is a widespread invasive species damaging economically important solanaceous crop plants, including tomatoes and potatoes ... [more ▼]

Introduction: The tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae), is a widespread invasive species damaging economically important solanaceous crop plants, including tomatoes and potatoes. Little is known about the ability of the microlepidoptera to encounter and develop on alternative wild and agricultural plant species. These plants could provide refuges and have to be identified for more efficient integrated management strategies. Objectives: In the present study, we assessed under laboratory conditions the ability of T. absoluta to develop on such plant species referred as potential hosts in the literature, including Solanaceae, Chenopodiaceae, Convolvulaceae, Fabaceae, and Malvaceae. Materials and methods: For each plant species, fitness tests were performed in Petri dishes by isolating single individuals with excised leaf. Two choice behavioral assays were performed in flying tunnels. Volatile organic compounds released by solanaceous plants were trapped using a dynamic collection system, and analyzed by GC-MS. Results: We found that Solanum species allowed higher larval survivability and shorter development time (from egg to adult emergency) compared to the other plants. Non-solanaceous plants were not able to sustain T. absoluta larvae. Two choice behavioral assays revealed that adult distribution and female oviposition did not differ between Solanum species, which were preferred to other tested solanaceous plants. The hypothesis that female host plant choice is influenced by plant volatile organic compounds was tested. Solanum volatile profiles showed similarities, and were presenting quantitative and qualitative differences with the other tested solanaceous plants, providing some explanations in the observed behavioral discrimination. Further electrophysiological and behavioral assays are required to confirm the effect of specific chemicals on the choice of the oviposition site in T. absoluta. Conclusion: It can be concluded that Solanum species are the more suitable hosts for T. absoluta development. Other solanaceous plant species could be opportunistically colonized with little incidence but care should be taken in these results as genetic variability in insects and plants, as well as plant physiological state, might have an impact on the pest survivability. [less ▲]

Detailed reference viewed: 41 (8 ULg)
Full Text
Peer Reviewed
See detailSpecial seminar "Quaternary Prevention (P4) or First do not harm "
Jamoulle, Marc ULg; Widmer, Daniel; Wagner, Hamilton et al

Conference (2015, August 23)

Quaternary prevention (P4), an answer of family doctors facing overmedicalization aims to protect the patient or population against the dangers of medicine. Harmful effects can appear with preventive ... [more ▼]

Quaternary prevention (P4), an answer of family doctors facing overmedicalization aims to protect the patient or population against the dangers of medicine. Harmful effects can appear with preventive activities (example: prostate cancer screening by PSA) such as by therapeutic interventions (example: disruptive medicine). P4 promoted by the Wonca (World Organization of Family Doctors) is practiced in different ways around the world. The seminar should present examples of teaching and application of P4 in different countries. 6 short talks (total 45 min) will be followed by an open roundtable about the philosophical aspects of P4, where the audience can participate. Asking the question: « is acting always justified in medicine? », P4 opens our thinking to a philosophy of action. Questioning the best way to reduce uncertainty, P4 is rooted in a philosophy of knowledge. How to decide action or abstention? How to appreciate the danger of both? How to accompany a patient without harmful effects (primum non nocere)? More about P4 on [less ▲]

Detailed reference viewed: 119 (13 ULg)
Full Text
Peer Reviewed
See detail"Additive Layer Manufacturing for Space Instrumentation and subsystems"
Rochus, Pierre ULg

Conference (2015, August 22)

Detailed reference viewed: 39 (4 ULg)
See detailDissensus, Unclosure, and Agonistic Appraisal: Reconceiving of Technology Assessment and Consensus Conferences as Forms of Social Experimentation
Van Oudheusden, Michiel ULg

Conference (2015, August 20)

In this paper, I inquire into two public deliberative formats that aim to render scientific and technological practices more socially robust: the consensus conference and participatory technology ... [more ▼]

In this paper, I inquire into two public deliberative formats that aim to render scientific and technological practices more socially robust: the consensus conference and participatory technology assessment (pTA). Drawing on experiences in the US National Institute of Health Consensus Conferences and in a Flemish pTA on nanotechnologies, I make explicit how these formats enact a strong appeal to consensus; thereby delegitimizing conflict and disagreement among deliberating parties. By perceiving of these formats as social experiments that typically elicit undecided procedures and tentative, “unclosed” outputs, it is possible to: (a) pinpoint how conflict pervades deliberative engagements in science and technology, and (b) revalue conflict dynamics as a useful heuristic that encourages (rather than hampers) the expression of disagreement. I argue that deliberately seeking out conflict in deliberation is both morally responsible and epsitemically fruitful, as it obliges participants to refine their worldviews in confrontation with competing truth claims and enables them to articulate their personal or group needs. To further develop these lines of reasoning, I propose three conceptions that contrast with the consensus ideal: dissensus, unclosure, and (ant)agonistic learning. I conclude by offering suggestions on how to build critical reflection about the ethical, political, and epistemic implications of social experimentation into processes of science and technology governance. [less ▲]

Detailed reference viewed: 8 (0 ULg)
Raty, Jean-Yves ULg

Conference (2015, August 18)

Aging phenomena are common to all amorphous structures, but of special importance in phase change materials (PCM) since it impedes the realization of multi-level memories. Different interpretations have ... [more ▼]

Aging phenomena are common to all amorphous structures, but of special importance in phase change materials (PCM) since it impedes the realization of multi-level memories. Different interpretations have been proposed, but we focus here on the structural relaxation of amorphous GeTe, chosen because it is the simplest system that is representative of the wider class of GST alloys, lying along the GeTe-Sb2Te3 composition line of the GeSbTe phase diagram. The direct melt-and-quench DFT based Molecular Dynamics approach leads to models with a few hundred atoms, and, hence a small number of atomic environments. Here we sample a large number of local atomic environments, and bonding schemes, by chemically substituting different alloys to favor different local atomic structures. This enables spanning a larger fraction of the configuration space relevant to aging. GST alloys are known to display complex bonding that does not follow the chemist’s “octet-rule”. This lead to many controversies, especially concerning the local structure around Ge atoms. We overcome this problem by using state of the art non local DFT-MD, including the so-called van der Waals corrections. This leads to more clearly defined environments that are thoroughly analyzed. We can then identify their fingerprints in the available structural experimental data and assess their stability to find the driving forces leading to the structural relaxation. The calculated electronic properties nicely match the most recent photothermal deflection spectroscopy experiments. Our results support a model of the amorphous phase and its time evolution that involves an evolution of the local (chemical) order towards that of the crystal (by getting rid of homopolar bonds), and an evolution of its electronic properties that drift away from those of the crystal, driven by an increase of the Peierls-like distortion of the local environments in the amorphous [1]. [1] J.Y Raty, W. Zhang, J. Luckas, C. Chen, R. Mazzarello, C. Bichara and M. Wuttig, Nature Comm. To appear. [less ▲]

Detailed reference viewed: 33 (3 ULg)
See detailOrganometallic-mediated radical polymerization for the precision design of novel poly(ionic liquid) copolymers in water
Cordella, Daniela ULg; Kermagoret, Anthony; Debuigne, Antoine ULg et al

Conference (2015, August 18)

In recent years, poly(ionic liquid)s (PIL)s were found to take an enabling role in important fields of polymer chemistry and material science. PILs combine the unique properties of ionic liquids with the ... [more ▼]

In recent years, poly(ionic liquid)s (PIL)s were found to take an enabling role in important fields of polymer chemistry and material science. PILs combine the unique properties of ionic liquids with the flexibility and properties of macromolecular architectures giving rise to a new family of functional polymers that opens new area of applications such as polymer electrolytes in electrochemical devices, powerful dispersants and stabilizers, absorbing membranes, precursors for carbon materials, porous polymers, etc. Controlled radical polymerization techniques have recently emerged as powerful tools for the precision design of novel PILs architectures and functionalities, enabling a considerable extension of the applications of PILs with the emergence of new properties. Many efforts are devoted to tentatively control the radical polymerization of ionic liquid monomers (ILs) that directly leads to PILs without requiring further polymer derivatization. Poly(vinyl imidazolium)s belong to a class of PILs of high interest but the control radical polymerization of their corresponding monomer is touchy due to the high reactivity of their propagating radical. In this communication, we will report on the implementation of organometallic-mediated radical polymerization (OMRP) technique for the precision synthesis of unprecedented PILs (co)polymers by direct polymerization of ILs in water. We will first discuss how a commercially available cobalt complex can efficiently control the growth of poly(vinyl imidazolium) chains and lead to PILs with predicted molar masses and low dispersities under mild experimental conditions. The efficiency of the process will then be illustrated by the one-pot synthesis of vinyl imidazolium-based block copolymers in aqueous media. This OMRP technique, highly compatible to water and active under moderate temperatures (30-40°C), is unique for providing well-defined vinyl imidazolium based-copolymers and novel PILs assemblies, and open new application fields. [less ▲]

Detailed reference viewed: 5 (2 ULg)
Peer Reviewed
See detailPast and future distributions of Southeast Asian murine rodents: the influence of climate changes
Latinne, Alice ULg; Meynard, Christine; Morand, Serge et al

Conference (2015, August 18)

Our study, involving species distribution modelling techniques, aimed at assessing the influence of past and future climatic fluctuations on Southeast Asian small mammal distributions using two forest ... [more ▼]

Our study, involving species distribution modelling techniques, aimed at assessing the influence of past and future climatic fluctuations on Southeast Asian small mammal distributions using two forest-dwelling (Leopoldamys herberti and Leopoldamys sabanus) and one karst endemic (Leopoldamys neilli) rodent species as models. Our model predictions contradict the well-established hypothesis that Southeast Asian forest-dwelling species were confined to small refugia during the LGM. Moreover, these results suggest that the distribution of several East and Southeast Asian taxa were in their refugial state during Pleistocene interglacial periods rather than during glacial periods. This could be because of vegetation changes that may have occurred at that time as a result of the increased seasonality observed during the LIG. The two future climate change scenarios used in this study predicted that large climatically suitable areas would still be available in the future for the three species. [less ▲]

Detailed reference viewed: 42 (5 ULg)
Peer Reviewed
See detailAtmospheric metal pollution over the last 250 years inferred from speleothem geochemistry
Allan, Mohammed ULg; Fagel, Nathalie ULg; Verheyden, Sophie

Conference (2015, August 17)

Lead concentrations and isotope ratios from two speleothems from the Han-sur-Lesse cave in southern Belgium were measured in order to study the ability of speleothems to act as archives of atmospheric ... [more ▼]

Lead concentrations and isotope ratios from two speleothems from the Han-sur-Lesse cave in southern Belgium were measured in order to study the ability of speleothems to act as archives of atmospheric pollution. To address this aim we analyzed trace elemental Al and Pb compositions by LA-ICP-MS and ICP-MS as well as Pb isotopes by MC-ICP-MS. The results help to identify three Pb-enriched intervals: from 1880 to 1905 AD, from 1945 to 1965 AD, and from 1975 to 1990 AD. The speleothem record is consistent with the evolution of atmospheric pollution in Belgium. Lead isotope ratios confirm that coal and gasoline combustion, combined with regional metallurgical activities, were the predominant Pb pollution sources in the stalagmites during the last 250 years. This research underscores the importance of speleothems as a valuable tool for the discrimination between anthropogenic and natural lead contributions in the environment and consequently for quantifying the anthropogenic contribution or determining natural background values in continental settings. [less ▲]

Detailed reference viewed: 39 (3 ULg)
Full Text
See detailNi-Cu/SiO2 cogelled xerogel catalysts for selective hydrodechlorination of 1,2-dichloroethane into ethylene
Lambert, Stéphanie ULg

Conference (2015, August 13)

Hydrodechlorination of chlorinated organics is a particularly attractive alternative compared with incineration of wastes from the chlorine industry from both economic and environmental points of view ... [more ▼]

Hydrodechlorination of chlorinated organics is a particularly attractive alternative compared with incineration of wastes from the chlorine industry from both economic and environmental points of view. Several authors demonstrated the ability of bimetallic catalysts, composed of metals from Groups VIII and IB, to convert chlorinated alkanes selectively into less or not chlorinated alkenes. The purpose of this study is to measure catalytic activity and selectivities of 1,2-dichloroethane hydrodechlorination over Ni-Cu/SiO2 cogelled xerogel catalysts and to study relationships between catalytic activity and surface properties of bimetallic catalysts. To understand the mechanism of hydrodechlorination of 1,2-dichloroethane on a supported alloy, the surface composition of Ni-Cu alloy is measured from H2 chemisorption, XRD and TEM. Values obtained indicate a very pronounced surface enrichment with copper. Samples containing various amounts of nickel and copper are xerogels prepared by a one-step sol-gel procedure, which consists in the cogelation of the silica precursor, tetraethoxysilane (TEOS), with organically substituted alkoxides capable of forming chelates with nickel and copper ions. The resulting alcogels were dried under vacuum at 80°C, calcined in air at 400°C, and finally reduced in hydrogen at 450°C. For each catalytic experiment, 0.11 g of catalyst pellets were tested. The temperature was successively kept at 200, 250, 300, 350 and 300°C. While 1,2-dichloroethane hydrodechlorination over pure nickel mainly produces ethane, increasing copper content in bimetallic catalysts results in an increase in ethylene selectivity. Used alone, copper deactivates rapidly due to their covering by chlorine atoms. When nickel is present, it supplies hydrogen atoms for the regeneration of the chlorinated copper surfaces into metallic copper. The specific consumption rate of 1,2-dichloroethane decreases when copper loading increases. The turnover frequency, that is, the number of catalytic cycle per active site (nickel atom and its surrounding copper atoms) and per second, seems to be independent of surface composition of alloy particles. [less ▲]

Detailed reference viewed: 53 (0 ULg)
Full Text
Peer Reviewed
See detailLa presse vidéoludique francophone : formats (papier et numérique) et histoire
Dozo, Björn-Olav ULg

Conference (2015, August 11)

Detailed reference viewed: 15 (2 ULg)
Full Text
See detailA principle of similarity for nonlinear vibration absorbers
Habib, Giuseppe ULg; Kerschen, Gaëtan ULg

Conference (2015, August 05)

With continual interest in expanding the performance envelope of engineering systems, nonlinear components are increasingly utilized in real-world applications. This causes the failure of wellestablished ... [more ▼]

With continual interest in expanding the performance envelope of engineering systems, nonlinear components are increasingly utilized in real-world applications. This causes the failure of wellestablished techniques to mitigate resonant vibrations. In particular, this holds for the linear tuned vibration absorber (LTVA), which requires an accurate tuning of its natural frequency to the resonant vibration frequency of interest. This is why the nonlinear tuned vibration absorber (NLTVA), the nonlinear counterpart of the LTVA, has been recently developed. An unconventional aspect of this absorber is that its restoring force is tailored according to the nonlinear restoring force of the primary system. This allows the NLTVA to extend the so-called Den Hartog’s equal-peak rule to the nonlinear range. In this work, a fully analytical procedure, exploiting harmonic balance and perturbation techniques, is developed to define the optimal value of the nonlinear terms of the NLTVA. The developments are such that they can deal with any polynomial nonlinearity in the host structure. Another interesting feature of the NLTVA, discussed in the paper, is that nonlinear terms of different orders do not interact with each other in first approximation, thus they can be treated separately. Numerical results obtained through the shooting method coupled with pseudoarclength continuation validate the analytical developments. [less ▲]

Detailed reference viewed: 60 (3 ULg)
Full Text
See detailA propos des fonctions continues qui ne sont dérivables en aucun point
Esser, Céline ULg

Conference (2015, August 03)

En 1872, Karl Weierstrass présenta non seulement une, mais toute une famille de fonctions continues et nulle part dérivables. Après la publication de ce résultat, beaucoup d'autres mathématiciens ... [more ▼]

En 1872, Karl Weierstrass présenta non seulement une, mais toute une famille de fonctions continues et nulle part dérivables. Après la publication de ce résultat, beaucoup d'autres mathématiciens apportèrent leur propre contribution en construisant d'autres fonctions continues et nulle part dérivables. Dans cet exposé, nous présenterons les fonctions de Weierstrass et nous montrerons que le théorème de Baire permet d'affirmer que l'ensemble des fonctions nulle part dérivables est dense dans l'ensemble des fonctions continues. Nous étudierons également la régularité ponctuelle des fonctions de Weierstrass en introduisant la notion d'exposant de Hölder. [less ▲]

Detailed reference viewed: 45 (7 ULg)
See detailPulsations in hot subdwarf stars: recent advances and prospects for testing stellar physics
Charpinet, Stéphane; Van Grootel, Valérie ULg; Fontaine, Gilles et al

Conference (2015, August 01)

The evolved, core helium burning, extreme horizontal branch stars (also known as hot sudwarfs) host several classes of pulsators showing either p- or g-modes, or both. They offer particularly favorable ... [more ▼]

The evolved, core helium burning, extreme horizontal branch stars (also known as hot sudwarfs) host several classes of pulsators showing either p- or g-modes, or both. They offer particularly favorable conditions for probing with asteroseismology their internal structure, thus constituting arguably the most interesting seismic window for this intermediate stage of stellar evolution. G-modes in particular have the power to probe deep inside these stars, down to the convective He-burning core boundary where uncertain physics (convection, overshooting, semi-convection) is at work. Space data obtained with CoRoT and Kepler are offering us the possibility to probe these regions in detail and possibly shed new light on how these processes shape the core structure. In this review, I will present the most recent advances that have taken place in this field and I will provide hints of the foreseen future achievements of hot subdwarf asteroseismology. [less ▲]

Detailed reference viewed: 10 (0 ULg)
See detailTesting stellar opacities with laser facilities
Le Pennec, Maëlle; TURCK-CHIEZE, Sylvaine; RIBEYRE, Xavier et al

Conference (2015, August 01)

Helio and asteroseismology (SoHo, KEPLER...) have produced observed acoustic oscillations of thousands of stars which characteristics are deeply linked to the transport of radiation inside the stars ... [more ▼]

Helio and asteroseismology (SoHo, KEPLER...) have produced observed acoustic oscillations of thousands of stars which characteristics are deeply linked to the transport of radiation inside the stars. However, the comparisons of seismic data with model predictions have led to significant discrepancies, which could be due to a bad knowledge of production and transport of energy.β-Cephei are pulsating stars, progenitor of supernovae and thus deeply linked to our understanding of stellar medium enrichment. Their study has shown some difficulty to predict the observed oscillation modes, which are directly linked to an opacity bump of the elements of the iron group (Cr, Fe, Ni) at log T=5.25 (κ-mechanism). We will show that several parameters of the stars (mass, age, metallicity) have a great influence on the amplitude of the bump, which impact their structure. We will then present the final results of an experiment conducted at LULI 2000 in 2011 on Cr, Fe and Ni compared to several opacity codes. We will show how to improve the opacity in the range of temperature around log T= 5.3.The Sun is a privilege place to test and validate physics. Since the recent update of the solar composition, there is a well established large discrepancy (Turck-Chièze et al. 2001) between solar models and seismic data, visible on the solar sound speed profile comparison.An explanation could be that the calculations of energy transport are not correctly taken into account.Unfortunately, there are very few experiments to validate these calculations (Bailey et al. 2014). That's why we are proposing an opacity experiment on a high-energy laser like LMJ, in the conditions of the radiative zone. We are exploiting in that purpose an approach called the Double Ablation Front to reach these high temperatures and densities at LTE and validate or not plasma effects and line widths. We will show the principle of this technique and the results of our simulations on several elements.In the mean time, we are also exploiting new opacity calculations thanks to the OPAS code (Blancard et al. 2012) at the conditions of the solar radiative zone. We will show the impact of these calculations on the solar model. [less ▲]

Detailed reference viewed: 18 (1 ULg)
See detailOpacities in the massive stellar envelopes
Le Pennec, Maëlle; TURCK-CHIEZE, Sylvaine; Salmon, Sébastien ULg et al

Conference (2015, August 01)

Helio and asteroseismology (SoHo, CoRoT, KEPLER...) have produced observed acoustic oscillations of thousands of stars. The characteristics of these oscillations are deeply linked to the transport of ... [more ▼]

Helio and asteroseismology (SoHo, CoRoT, KEPLER...) have produced observed acoustic oscillations of thousands of stars. The characteristics of these oscillations are deeply linked to the transport of radiation inside the stars. However, the comparisons of seismic data of Sun and stars with model predictions have led to significant discrepancies, which could be due to a bad knowledge of production and transport of energy.We will focus here on the case of β-Cephei.β-Cephei are pulsating stars, progenitor of supernovae and thus deeply linked to our understanding of stellar medium enrichment. Their study has shown some difficulty to predict the observed oscillation modes, which are directly linked to a bump of the opacity of the elements of the iron group (Cr, Fe, Ni) at log T=5.25 through their pulsating mechanism called the κ-mechanism. We will show that the different parameters of the stars (mass, age, metallicity) have a great influence on the amplitude of the bump, and then on the structure of the considered star.The mastery of the κ-mechanism that produces the pulsation of these stars supposes a fine determination of the peak opacity of the iron group in their envelope. We will present the final results of an experiment conducted at LULI 2000 in 2011 on Cr, Fe and Ni and compare them to OP and ATOMIC, SCO-RCG codes. We will show how to improve the opacity in the range of temperature around log T= 5.3. [less ▲]

Detailed reference viewed: 25 (0 ULg)
Full Text
Peer Reviewed
See detailNew insight in lymnaeid snails (Mollusca, Gastropoda) as intermediate hosts of Fasciola hepatica (Trematoda, Digenea) in Ecuador
Caron, Yannick ULg; Celi-Erazo, Maritza; Hurtrez-Boussès, Sylvie et al

Conference (2015, August)

Fasciolosis is a widely distributed disease in livestock in South America but knowledge about the epidemiology and the intermediate hosts are scarce in Ecuador. During 3 months, lymnaeid snails were ... [more ▼]

Fasciolosis is a widely distributed disease in livestock in South America but knowledge about the epidemiology and the intermediate hosts are scarce in Ecuador. During 3 months, lymnaeid snails were sampled (n=1482) in Pichincha province in two sites located in a highly endemic area. The snails were identified (based on morphology and ITS2 sequences) and the infection status was established through microscopic dissection and a multiplex PCR-based technique. If morphologic-based techniques were not useful to accurately named the one species collected, alignment study ascribed it to L. schirazensis. Rediae were observed in 1.75 % (26/1482) and Fasciola sp. DNA was detected in 6% (89/1482) of the collected snails. The COX1 region permitted the parasite species identification: F. hepatica. The relative sensitivity and specificity of the microscope related to the PCR results was 25.84% and 99.78% respectively. The mean size of the snails recorded positive for F. hepatica through crushing and microscopy was significantly higher than the mean size of negative snails. There was not such difference in PCR positive snails. The role of G. schirazensis as an intermediate host of F. hepatica in Ecuador is discussed and a hypothesis of an adaptation of the snail to the trematoda is formulated. For the first time, an epidemiological survey, based on molecular biology-based techniques assessed the role of lymnaeid snail in the epidemiology of fasciolosis in Ecuador. [less ▲]

Detailed reference viewed: 58 (4 ULg)
See detailMid-winter surveys for sea ice biogeochemistry in bi-polar oceans
Nomura, D.; Delille, Bruno ULg; Dieckmann, G. et al

Conference (2015, August)

Sea ice has rarely been considered in estimates of global biogeochemical cycles, especially gas exchanges, because of the assumption that, in ice-covered seas, sea-ice acts as a barrier for ... [more ▼]

Sea ice has rarely been considered in estimates of global biogeochemical cycles, especially gas exchanges, because of the assumption that, in ice-covered seas, sea-ice acts as a barrier for atmosphere–ocean exchange. However, recent work has shown that sea ice and its snow cover play an active role in the exchange of gases between the ocean and atmosphere [1] [2]. Our results provide a useful reference for future studies as the ongoing drastic changes in polar climate and sea ice extent are likely to alter the biogeochemical cycles in polar ocean–sea ice–atmosphere system. However,, the lack of information for the winter-time sea ice biogeochemistry was pointed out, due to the difficulty to acquire data under harsh weather conditions. In this presentation, we will present our recent winter-time sea ice surveys of sea ice biogeochemistry on the R/V Aurora Australis off East Antarctica (SIPEX-II) in 2012 and the midwinter sea ice cruise on the R/V Polarstern in the Weddell Sea, Antarctica (AWECS) in 2013. In addition, we will also show the ongoing project of Norwegian Young sea ICE cruise (NICE2015) on the R/V Lance drifting for half a year in Arctic sea ice north of Svalbard in 2015. [1] Nomura et al. (2013) J. Geophys. Res. Oceans 118, 6511- 6524. [2] Delille et al. (2014) J. Geophys. Res. Oceans 119, 6340-6355. [less ▲]

Detailed reference viewed: 14 (0 ULg)
Full Text
See detailSinging accuracy, listeners’ tolerance, and pitch analysis
Larrouy, Pauline ULg; Devaney, Johanna

Conference (2015, August)

Detailed reference viewed: 26 (0 ULg)