References of "Unpublished conference/Abstract"
     in
Bookmark and Share    
See detailGreen synthesis of polyphosphoesters, a promising class of bioinspired degradable materials
Lecomte, Philippe ULg; Baeten, Evelien

Conference (2015, September 11)

Detailed reference viewed: 23 (4 ULg)
Peer Reviewed
See detailWill Big Data Deliver its Promised Productivity Growth?
Artige, Lionel ULg

Conference (2015, September 11)

Detailed reference viewed: 32 (0 ULg)
Full Text
Peer Reviewed
See detailTentativi di avvicinamento a Il figlio di Bakunìn (1991) di Sergio Atzeni (1952-1995)
Curreri, Luciano ULg

Conference (2015, September 11)

Detailed reference viewed: 49 (7 ULg)
Peer Reviewed
See detailPredator cues and risky habitats affect foraging activity in salamanders
Melotto, Andrea; Ficetola, Gentile Francesco; Denoël, Mathieu ULg et al

Conference (2015, September 11)

Detailed reference viewed: 14 (0 ULg)
Full Text
See detailNumerical crashworthiness analysis of an offshore wind turbine monopile impacted by a ship
Bela, Andreea ULg

Conference (2015, September 11)

Detailed reference viewed: 17 (8 ULg)
See detailTable ronde : Qu'est-ce que l'image fait à l'histoire ?
Servais, Amandine ULg

Conference (2015, September 11)

L'AISV abordait, dans le cadre de son XIe congrès, la problématique : Theorein. Ce que les images font au savoir et inversement. Cette rencontre s'est clôturée par une table ronde - portant sur l'agence ... [more ▼]

L'AISV abordait, dans le cadre de son XIe congrès, la problématique : Theorein. Ce que les images font au savoir et inversement. Cette rencontre s'est clôturée par une table ronde - portant sur l'agence des images au sein de la discipline historique. Avec la participation de Ralph Dekoninck, Maud Hagelstein, Carl Havelange, Thierry Lenain et Amandine Servais. [less ▲]

Detailed reference viewed: 10 (1 ULg)
See detailDéception et incertitude en démocratie
Jamin, Jérôme ULg

Conference (2015, September 10)

Detailed reference viewed: 16 (1 ULg)
Full Text
Peer Reviewed
See detailNumerical simulations on embedded solids : integration of CAD and eXtended Finite Element Analysis
Duboeuf, Frédéric ULg; Béchet, Eric ULg

Conference (2015, September 10)

The aim of this communication is to propose a procedure in order to dissociate the geometric description of the field’s approximation within the extended finite element method (X-FEM) and with non ... [more ▼]

The aim of this communication is to propose a procedure in order to dissociate the geometric description of the field’s approximation within the extended finite element method (X-FEM) and with non-matching meshes. Implicit and explicit approaches are combined in order to represent with accuracy all the CAD entities regardless of their dimension. The choice of appropriate tools such as Level Sets technique allows to describe evolving interfaces with great flexibility. The design of a dedicated P1 functional space is achieved by decimating the traces of standard finite element (FE) shape functions, thanks to a new algorithm, especially when the problem domain is embedded in a space of a higher dimension. An analysis of the approximation properties of the P1 FE trace spaces on hyper-surfaces is available in the literature and applied for solving PDEs on closed surfaces without boundary. Dirichlet boundary conditions are applied using a convenient choice of stable Lagrange multiplier space, according to a new generalized algorithm. That extends the existing solutions to every combination of the space domain and boundary dimensions. In terms of solvers, the introduction of double Lagrange multipliers can be used to recover the positive definiteness of the bilinear form. This approach allows to treat any embedding, i.e. 1, 2, or 3D problems embedded in 2 or 3D background meshes. The possibility of applying the methodology to beams is investigated, with a potential application to through-thickness reinforced composites in a mixed-dimensional modelling framework. [less ▲]

Detailed reference viewed: 52 (15 ULg)
Full Text
See detailChallenges for Scale-Up of Batch Phase Separation
Pfennig, Andreas ULg; Becker, Karsten; Bach, S. et al

Conference (2015, September 10)

Bi-phasic phase separations in batch processes often are operations which influence cycle times and production capacity. A realistic assessment of phase separation time for technical scale is important ... [more ▼]

Bi-phasic phase separations in batch processes often are operations which influence cycle times and production capacity. A realistic assessment of phase separation time for technical scale is important with respect to defining vessel sizes, process step-time planning and an optimized adaption to further process steps. This requires a rating of batch mixing & phase-separation at an early step of chemical-process development in laboratory and a robust scale-up to the technical scale. Currently available methods for design and optimization of such batch phaseseparations show gaps in knowledge and in transfer from laboratory to technical scale. Up to now it is not possible to trustfully predict mean drop diameter or dropsize distribution for technical relevant bi-phasic systems in technical scale based on laboratory tests. These are one of the key inputs to describe phase separation behavior, i.e. sedimentation and coalescence. The prediction of drop-size distribution after scale-up is important, since a remaining turbidity is significantly influenced by these. In addition systems with higher viscosity show wider drop-size distributions and tendency of turbidity will increase. The specific industrial demand for a safe and validated scale-up method will be discussed. Aspects are an integral general scale-up method for batch mixing and phase separation, starting with standardized characterization of mixing and phaseseparation behavior in lab and development of a scale-up method in order to evaluate relevant aspects as equipment and mixing device, energy input, mixing time, phase separation time, height of dispersion etc. For modelling the performance of a batch settling accounting for polydisperse dropsize spectra, the model of Henschke has been chosen as starting point, which accounts for different average drop sizes. The Henschke model has been extended as to include the sedimentation of drops with polydisperse drop-size distribution according to the ReDrop approach (representative drops) by modelling an ensemble of individual drops as they sediment and reach the close-packed layer. In principle coalescence of the sedimenting droplets could be accounted for in this approach, but this has been neglected in this first step. The Henschke model already accounts for the time- and height-dependent average drop sizes in the close-packed layer. This has been extended as to allow taking the different drop sizes into account of those drops that are arriving at the close-packed layer over time. The coalescence in the close-packed layer is described with the approach used already by Henschke, which has been validated in principle by Kopriwa. The results show that the polydispersity can well be described by this approach (see Fig. 1). Especially – as is to be expected – the major phase separation occurs relatively quickly leaving behind fine droplets in the continuous phase. Since this remaining turbidity has a relatively low holdup, the sedimentation of the fine dispersion occurs essentially with the sedimentation velocity of droplets in infinitely extended medium. As a consequence the remaining turbidity as function of settling time can be estimated with relatively good accuracy from the fraction of the fine droplets in the original dispersion and their individual sedimentation velocity. It can also be seen that the close-packed layer disappears after a certain settling time and after that the rate of the arriving droplets is smaller than the time for their coalescence. The open questions remaining will finally be addressed, namely the prediction of the drop-size distribution after the mixing step, the detailed drop behavior within the close packed layer as well as the influence of large-scale fluid dynamics within the settler. [less ▲]

Detailed reference viewed: 40 (3 ULg)
Peer Reviewed
See detailNewts skip aquatic life and forego reproduction in response to alien fish introduction
Winandy, Laurane ULg; Darnet, Elodie; Denoël, Mathieu ULg

Conference (2015, September 10)

Detailed reference viewed: 17 (1 ULg)
Full Text
See detailOsteopontin as a new target in glioblastoma progression and resistance to radiotherapy
Henry, Aurélie ULg; Bellahcene, Akeila ULg; Castronovo, Vincenzo ULg et al

Conference (2015, September 10)

Glioblastoma (GBM) is the most aggressive and common solid human brain tumor. Because of GBM heterogeneity, location and aggressiveness, none of the available treatment is curative. These treatments ... [more ▼]

Glioblastoma (GBM) is the most aggressive and common solid human brain tumor. Because of GBM heterogeneity, location and aggressiveness, none of the available treatment is curative. These treatments include maximal surgical resection, radiotherapy and concomitant or adjuvant chemotherapy with Temozolomide (TMZ). However, the prognosis of adult patients with GBM remains poor and the survival outcome after treatment does not exceed 15 months. Glioblastoma-composing cells have developed many strategies to counteract these current therapies. Among the wide hallmarks acquired to survive, osteopontin (OPN) ranks correlates with lower overall and disease-free/relapse-free survival in all tumors combined, as well in brain cancer. OPN expression is largely considered as a molecular cancer marker associated with poor prognosis for patients with cancer. Our preliminary works (Lamour V and Henry A, IJC 2015) have demonstrated the role of OPN in the tumorigenicity of glioblastoma cells and its importance in the maintenance of the stem charachters. Within the continuance of this work, our recent studies focused on the potential role of OPN in the resistance of glioblastoma cells to radiotherapy and its implication in the initiation of Double Strand Breaks (DSBs) repair mechanism. In this context, U251-MG and U87-MG cells were used to assess the role of OPN in the initiation of the DSBs repair mechanism after an exposure to gamma-irradiation (γ–IR). The transient transfection of both cell lines with siRNA directed against OPN shown a lower induction of γ–H2AX compared to control (irrelevant siRNA). The survival of U251-OPN depleted cells was also affected after an exposure to γ–IR (based on clonogenic assays). However, the sole depletion of OPN in U87 cells affected their survival (independently of the γ–IR). To prove that the secreted form of OPN is necessary to survive after γ–IR, conditionned medium of U87-shSCR clones (rich in OPN) was used to treat U87shOPN clones before an exposure to γ–IR. By immunofluorescence, we observed that the γ–H2AX staining was higher in U87 shOPN clones than when treated with their own conditionned medium (poor in OPN). Currently, we are investigating the in vivo implication of OPN in the initiation of DSBs repair mechanism after an exposure of mice to γ–IR (whole brain exposure). For this purpose, IPTG-inducible U87 shRNA clones (SCR and OPN) have been generated and validated for an orthotopic xenograft model in NOD-SCID mice. The survival after a radiotherapy of 10 Gy (2Gy per day for 5 days) will be assessed in OPN-positive and –negative tumor-bearing mice. Taken together, these datas suggest that OPN could represent an important pronostic factor for patient response to radiotherapy in the context of GBM. [less ▲]

Detailed reference viewed: 111 (27 ULg)
Peer Reviewed
See detailRegards croisés sur la représentation énonciative des genres dans les BD féminines contemporaines : le cas d’une BD africaine et d’une BD occidentale
Goufo Zemmo, ULg

Conference (2015, September 10)

La problématique des «Gender Studies » fait l’objet de multiples questionnements dans l’ensemble des études depuis quelques années. La question des genres a, d’une manière ou d’une autre, fait le tour de ... [more ▼]

La problématique des «Gender Studies » fait l’objet de multiples questionnements dans l’ensemble des études depuis quelques années. La question des genres a, d’une manière ou d’une autre, fait le tour de tous les arts. La bande dessinée (BD), elle aussi, n’a pas échappé à ce problème. En effet, si les BD ont longtemps été créées par les hommes (Hergé, Goscinny, Uderzo …) les femmes, de plus en plus aussi, ont investi ce médium. On assiste aujourd’hui à un véritable regain de créations dites « féminines » sur tous les continents ; bien entendu, le continent africain n’en fait pas exception. En effet, la question des genres y est encore plus aigüe, d’autant plus que, la femme y a toujours été marginalisée. Ce qui nous intéresse ici ce n’est pas de comprendre comment la BD donne à réfléchir sur les genres en en donnant des caractéristiques ou des outils de compréhension de la société moderne, mais de montrer comment cette dernière devient militante dès lors qu’elle réclame la parité au sein même des représentations. En d’autres termes, comment les bédéistes féminines au travers de ce médium interrogent-elles les normes de genres par l’image et mettent en place leur subversion ? Nous sommes tentés de répondre que tout est mis en jeu pour que les rôles actantiels les plus significatifs soient portés par des acteurs féminins. De plus, le dessin en lui-même, les cadrages et différentes perspectives ne sont plus que des instruments au service du dessinateur. Leur rôle servant à la réorganisation cognitive des informations présentes dans les mémoires collectives. Nous prendrons appui sur la sémiotique de l’énonciation, dans une approche greimassienne, qui part du registre narratif pour comprendre les procédures sous-jacentes aux démarches de notre pensée à travers le registre logico-sémantique. Nous nous appuierons sur deux bédéistes, issues d’un univers culturel différent, pour comprendre comment l’une à travers la disposition spatiale des personnages (masculin/ féminin) sur la vignette et l’autre par la répartition des rôles actantiels créent un flou énonciatif visant à réorganiser les clivages et redonner aux femmes une place qui leurs aurait été déniée depuis bien longtemps. [less ▲]

Detailed reference viewed: 16 (0 ULg)
See detailPractical training session on virus discovery from High Throughput Sequencing data
Massart, Sébastien ULg

Conference (2015, September 09)

Detailed reference viewed: 11 (0 ULg)
Peer Reviewed
See detailReevaluating IUCN Red List assesment on European amphibians
Crnobrnja-Isailović, Jelka; Cogalniceanu, Dan; Denoël, Mathieu ULg et al

Conference (2015, September 09)

Detailed reference viewed: 28 (0 ULg)
Peer Reviewed
See detailStudy of the impact of school average ability on career expectations
Dupont, Virginie ULg

Conference (2015, September 09)

Detailed reference viewed: 22 (2 ULg)
See detailUn musée du Moyen Age à Namur
George, Philippe ULg

Conference (2015, September 09)

Detailed reference viewed: 16 (0 ULg)
Peer Reviewed
See detailWhat do they mean? Listening to babies communicating in the daily setting in ECEC service
Pirard, Florence ULg; Legrand, Anne; Michel, Aurore ULg

Conference (2015, September 09)

The main aim of the study was to gain understanding of how babies communicate in ECEC services. Previous literature indicates that babies can interact and communicate precociously, not only with adults ... [more ▼]

The main aim of the study was to gain understanding of how babies communicate in ECEC services. Previous literature indicates that babies can interact and communicate precociously, not only with adults (Stern, 2005; Threvarten, 2011), but also with other children (Tomasello et al., 2005). The ECEC service can be considered as a setting where interaction and communication between peers can be sustained by practitioners who observe them, document what happens, analyse together the educational condition to guarantee and regulate their action (Stambak et al., 1983). The study involved qualitative and action research initiated by Cresas and IEDPE (self-regulating participatory assessment, Ballion et al., 1988), combined with an analysis of activity approach focused on contextualised process. An action researcher has gathered practitioners, trainers and researchers from France, Spain, Croatia, Italy and Belgium to analyse educational daily practice in ECEC services and their effect on communication between peers. Videos have been used to document and analyse the practice (EADAP, 2011). The ethical considerations taken in this study involved collaborative perspectives that give an active place to all participants (researchers, trainers, practitioners? parents and children). Informed consent and authorization for using video in the research are guaranteed. Participants identify and document communication processes between very young children observed in natural setting (ECEC services). These processes are characterised by several aspects: duration, emotional expression and meaningful linking of observed behaviours between babies. A shared meaning from the video documentation can be co-constructed like some narrative stories. Participants consider the activity of babies as meaningful stories that they should understand and sustain with interest. We discuss implications for professionalisation of the workforce (initial training and professional development). [less ▲]

Detailed reference viewed: 26 (5 ULg)
See detailPremières notes pour l'ethnographie d'un projet européen en situation embarquée
Thoreau, François ULg

Conference (2015, September 08)

Detailed reference viewed: 13 (0 ULg)
Peer Reviewed
See detailComparison of 3 diffractive IOLs: one monofocal (achromatic), one bifocal and one trifocal lens implant
Gatinel, Damien; Loicq, Jerôme ULg; Pagnoule, Christophe et al

Conference (2015, September 08)

Purpose: To describe the optical performance of 3 types (monofocal, bifocal and trifocal) of diffractive hydrophobic intraocular lenses (IOLs). Setting: Fondation Rothschild, Paris, France Methods: An ... [more ▼]

Purpose: To describe the optical performance of 3 types (monofocal, bifocal and trifocal) of diffractive hydrophobic intraocular lenses (IOLs). Setting: Fondation Rothschild, Paris, France Methods: An achromatic monofocal, a bifocal and trifocal diffractive IOLs were measured with an optical bench, designed to measure Modulation transfer function (MTF) and point spread function (PSF) of diffractive intraocular lenses. The measurements were performed at 3 wavelengths (480 nm, 546 nm and 650 nm), using an aberration free cornea and an aspherical artificial cornea generating a +0.28 µm of positive spherical aberration (ISO 11979-2 guideline). The through-focus MTF was recorded with the 3 IOLs for various pupil apertures. The evaluation of the magnitude of the halos was performed from PSF measurement obtained at each focal spot location. Results: The monofocal and the two bifocal IOLs were presenting 2 peaks on the through-focus MTF in the green: for intermediate vision (at 1.75D) for the monofocal achromatic lens, and for far and for near vision( at +4D) for the bifocal IOL of the same material. Three peaks were recorded with the trifocal IOL at any wavelength. The achromatic monofocal was monofocal for far in the red and monofocal for near in the blue. The amount of energy allocated to each focal point was not very different for the three IOLs except for smaller apertures where the distance vision with the trifocal IOL had a significant lower peak than the two other IOLs. The amount of halos were comparable between lenses. Conclusions: The diffractive and refractive optics generated opposite chromatic aberration. A achromatic diffractive IOL behaves like a bifocal IOL with an intermediate addition The bifocal and trifocal IOL induce similar chromatic effects for the near (bifocal, trifocal) and intermediate (trifocal) foci. The tested diffractive patterns wee not efficient to correct the chromatic aberration at the distance foci for all tested IOLs. [less ▲]

Detailed reference viewed: 27 (1 ULg)
Full Text
Peer Reviewed
See detailEthylene polymerization mediated by nickel(II) covalently anchored to silica xerogels
Lambert, Stéphanie ULg; Sacco, Luigi

Conference (2015, September 08)

Heterogeneous catalysis is generally widely preferred for industrial applications thanks to the well-known advantages of easier product-catalyst separation and recovery of the catalyst process and, often ... [more ▼]

Heterogeneous catalysis is generally widely preferred for industrial applications thanks to the well-known advantages of easier product-catalyst separation and recovery of the catalyst process and, often, to the enhanced stability of the catalyst. But in terms of selectivity, homogeneous catalysis usually provides better results. From this point of view, the grafting of homogeneous catalysts onto a solid support seems the ideal combination in order to achieve the advantages of both heterogeneous and homogeneous catalysis, allowing the developing of more environmentally friendly and economical processes with potential application in the industry. Further, to covalently link a homogeneous onto silica (a support which is thermally, chemically and mechanically resistant, with a well defined structure) is the best way to limit metal leaching and sintering. Nitrogen-based ligands containing one of several Schiff bases have been reported to form active catalysts with “late-metal” (such as Fe, Pd, Ni,…) for the ethylene polymerization [1]. Moreover, substituted pyrazole-based organometallic complexes gave also promising results in this field. These facts let us suggest that the pyrazolylpyridine derivatives bearing a tethered trimethoxysilylated group synthesized in a previous work [2] are potentially good candidate to prepare hybrid catalyst (i.e. soluble organometallic complexes covalently bonded onto an insoluble support, in this case silica) with Ni-II, Fe-II or Pd-II for ethylene polymerization. [less ▲]

Detailed reference viewed: 21 (2 ULg)
Peer Reviewed
See detailProperties of a new hydrophobic diffractive trifocal intraocular lens: linear chromatic aberrations (LCA) by optical simulation and optical bench testing
Loicq, Jerôme ULg; Gatinel, Damien

Conference (2015, September 08)

Purpose: Impact of the IOL raw material Abbe number on diffractive trifocal optical outcomes in terms of light energy partition between the three foci, modulation transfer function (MTF) and linear ... [more ▼]

Purpose: Impact of the IOL raw material Abbe number on diffractive trifocal optical outcomes in terms of light energy partition between the three foci, modulation transfer function (MTF) and linear chromatic aberration (LCA). Setting: Space Center Liège (Centre Spatial de Liège), University of Liège, Liège, Belgium Methods: The difference between hydrophilic and hydrophobic materials doesn't rely on biocompatibility only, but also influence some optical properties. In order to highlight the impact of the raw material associated to Diffractive-Trifocal-IOLs, we compare certain optical properties of two Diffractive-Trifocal-IOLs associated to Physiol's Trifocal-technology and made of 26% hydrophilic and hydrophobic GF raw material. The Abbe number of the two IOL materials was measured with a refractometer. The through focus MTF curves at 3 wavelengths (480, 546 and 650 nm) and different apertures were generated by simulation in an Arizona eye model and compared with results on a PMTF optical bench. Results: The through focus MTF curves at the three wavelengths shows that the diffracted light for the near vision (+3.5 D) by the trifocal optic generates chromatic aberrations of opposite sign with respect to the refracted light assigned to the Far vision. The diffracted light at the origin of the Intermediate vision (+1.75 D) does not show significant amount of LCA and can be considered as a chromatic aberration free focus. Results are similar for the two lens materials. Conclusions: Diffractive Trifocal IOLs show chromatic aberrations whose sign and amplitude depend on the add-power of the different foci (far, near or intermediate), but is basically independent of the nature of the type of raw material, hydrophilic or hydrophobic. [less ▲]

Detailed reference viewed: 21 (3 ULg)
Full Text
See detailSocial Enterprise Models in a worldwide Comparative Perspective
Defourny, Jacques ULg

Conference (2015, September 08)

Detailed reference viewed: 23 (1 ULg)
Peer Reviewed
See detailIconic virtues of diagrams. Peirce and ampliative reasoning
Leclercq, Bruno ULg

Conference (2015, September 08)

In his Critic of pure reason, Immanuel Kant notoriously claimed that, being grounded on the forms of sense intuition, arithmetical and geometrical propositions are both synthetic (i.e. informative) and a ... [more ▼]

In his Critic of pure reason, Immanuel Kant notoriously claimed that, being grounded on the forms of sense intuition, arithmetical and geometrical propositions are both synthetic (i.e. informative) and a priori. Bernard Bolzano, followed in this by the logicist movement (from Gottlob Frege to Rudolf Carnap), answered that the generality and necessity of mathematical propositions and proofs can only be grounded on conceptual analysis. Even though, just like Frege, he is one of the fathers of formal logic, Charles Sanders Peirce provides some semiotic reasons to think that Kant was right: diagrams do convey general meanings and provide some knowledge which is necessary yet non-trivial. Unlike logical analysis, visual presentation of concepts in schemas or diagrams helps to explore concepts by stressing some of their “side” features in such a way that new knowledge is gained: « diagrams evolve what was involved » (CP4/86). This is why, according to Kant’s notion of intuitive construction, mathematical inferences are not merely deductive but are inventive and ampliative. My talk aims at identifying some iconic virtues of diagrams which, according to Peirce, explain their epistemic productivity. A first one lies in the “formal” nature of icons, which allows them to express syntactic relations between descriptive (symbols) and demonstrative (indices) components of structured information. On this respect, even algebraic and ideographic expressions are icons exhibiting a general form – a “rheme” – in which places for indices are filled with variables “x” and “y” meaning “any individual”. For this reason, even though they are singular, diagrams are “abstractions” in the sense that they represent relations rather than their terms. Only with this in prospect can a second, and more studied, feature of diagrams matter, namely their two-dimensionality, which helps to exhibit complex relations that cannot be seen on linear linguistic expressions. Finally, a third feature of diagrams lies in their imaginary rather than referential character. Icons connote without denoting, and therefore they can be informational without this information being limited to singular individuals. Furthermore, this non referential character of icons is what makes them open to virtual exploratory manipulations that allow to consider and investigate possibilities which in turn inform us on not obvious properties of the presently visible configuration. [less ▲]

Detailed reference viewed: 38 (0 ULg)
See detailThe 4m International Liquid Mirror Telescope
Surdej, Jean ULg

Conference (2015, September 07)

The International Liquid Mirror Telescope (ILMT) consists of a 4-m diameter zenith telescope with a liquid mirror characterized by a f/2 focal ratio. It is a collaborative project between Belgium, Canada ... [more ▼]

The International Liquid Mirror Telescope (ILMT) consists of a 4-m diameter zenith telescope with a liquid mirror characterized by a f/2 focal ratio. It is a collaborative project between Belgium, Canada, India and Poland. The participating institutions are: Institute of Astrophysics and Geophysics of the Liege University (IAGL), the Royal Observatory of Belgium (ROB), six Canadian universities (British Columbia, Laval, Montreal, Toronto, Victoria and York), the Aryabatta Research Institute of Observational Sciences (ARIES, Nainital, India) and the Observatory of Poznan (UAM, Poland). This telescope is being installed at the Devasthal observatory, India (Longitude 79° 41' 04'' E, +29° 21' 40'' N, altitude 2450m), in the central Himalayas. First light should happen in early 2016. It will image every night a strip of sky having an approximate width of 27' in declination using a 4096 x 4096 pixel CCD detector that will work in the time delay integration (TDI) mode. The ILMT will thus perform a deep survey of a long and narrow strip of sky by looking at stars, galaxies, AGN, quasars, asteroids, space debris, ... crossing its field of view. It will observe in the i', r', g' SDSS spectral bands. This survey will thus be mainly dedicated to photometric and astrometric variability studies of faint objects. Among the main scientific goals, let us mention the detection and follow up of a few tens of multiply imaged quasars produced by gravitational lensing, hundreds of supernovae every year, detection of nearby brown dwarfs, white dwarfs and other faint stars based upon their trigonometric parallax and/or proper motion measurements, photometric variability studies of thousands of quasars and millions of stars as well as space debris detection at dusk and/or at dawn. Right now, numerous data sets have already been obtained of the ILMT strip of sky with smaller telescopes in the TDI mode. These will be used to carry out preliminary scientific projects and calibration of the ILMT data. A pipeline and database are presently in construction at the Poznan Observatory. Some videos and recent photographs will illustrate the present status of the ILMT project. [less ▲]

Detailed reference viewed: 23 (4 ULg)
See detailDiasporic Experience and Music in Caryl Phillips’s Crossing the River
Mascoli, Giulia ULg

Conference (2015, September 07)

This paper deals with Caryl Phillips who has incessantly represented diasporic experience in his work where he evokes complex identities at the crossroads between Africa, the Caribbean and Europe. My ... [more ▼]

This paper deals with Caryl Phillips who has incessantly represented diasporic experience in his work where he evokes complex identities at the crossroads between Africa, the Caribbean and Europe. My proposal is to concentrate on Phillips’s novel Crossing the River (1993) which extensively explores the theme of the African diaspora and which, interestingly, has also been described as his most jazzy text. This narrative not only addresses diasporic themes, such as uprootings and lost origins, but very much like jazz -- which is for Brathwaite “a cry from the heart of the hurt man” (277) – it gives a voice to the victims of history, to shattered individuals in pain whose tragic fate is viewed at once as personal and collective. Benítez-Rojo draws attention to the importance of rhythm in this text, but he only provides a limited analysis with no specific examples of how this significant feature of the work is achieved or the purposes it serves. In this paper I will try to demonstrate that Phillips’s thematic and formal use of music, including the references to classic themes of the African American musical tradition or the recurrent and creative use of repetitions, has a performative role and reenacts the duty of remembering inherent in the diasporic experience. [less ▲]

Detailed reference viewed: 25 (3 ULg)
See detailImmunoglobulin E enhances host resistance to venoms.
Marichal, Thomas ULg

Conference (2015, September 07)

Detailed reference viewed: 9 (1 ULg)
See detailLa perte comme identité : le cas des familles post-séparation et post-divorce.
D'Amore, Salvatore ULg

Conference (2015, September 07)

Detailed reference viewed: 25 (1 ULg)
Full Text
Peer Reviewed
See detailBrazil-EU Relations: Strategic Partner or Competitors?
Santander, Sébastian ULg

Conference (2015, September 07)

Detailed reference viewed: 33 (5 ULg)
See detailA Stylistic Analysis of Caryl Phillips's "Made in Wales"
Tunca, Daria ULg

Conference (2015, September 07)

Detailed reference viewed: 59 (4 ULg)
Full Text
Peer Reviewed
See detailCitizens abroad and Regional Elections: A diffusionist Perspective
Lafleur, Jean-Michel ULg; Arrighi, Jean-Thomas

Conference (2015, September 06)

In this paper we shift the focus away from the state to the regional demos with the aim to introduce the notion of scale in the study of external voting. It is divided into three parts. Following a ... [more ▼]

In this paper we shift the focus away from the state to the regional demos with the aim to introduce the notion of scale in the study of external voting. It is divided into three parts. Following a preliminary discussion on the external franchise from a sub-state perspective, we proceed with a comparative overview of the rules of acquisition and loss of the franchise in regional elections and show that the extension of the franchise to ‘regional expatriates’ is a relatively exceptional practice. We then identify factors that in our view are key to understand the absence of a vertical diffusion of the external franchise to lower levels of government, in sharp contrast with its rapid horizontal diffusion at the state level. The second part examines the debates surrounding the inclusion and exclusion of the franchise in three cases of protracted nationalist mobilization that translated into far reaching territorial autonomy: Catalonia, Scotland and Flanders. The third and final section contrasts the similarities and differences that can be found between our three cases and reflects upon the lessons that can be drawn from them. [less ▲]

Detailed reference viewed: 35 (0 ULg)
Full Text
Peer Reviewed
See detailBinge Drinking at young age
Gavray, Claire ULg

Conference (2015, September 05)

discussion théorique et méthodologique sur le concept et la mesure du binge drinking. Présentation des facteurs liés à cette pratique chez les adolescents filles et garçons. Analyse des résultats à la ... [more ▼]

discussion théorique et méthodologique sur le concept et la mesure du binge drinking. Présentation des facteurs liés à cette pratique chez les adolescents filles et garçons. Analyse des résultats à la lumière des opportunités historiques sexuées en évolution.données ISRD3-Belgique [less ▲]

Detailed reference viewed: 39 (6 ULg)
See detailAge-related modulations in cognitive functions and its cerebral underpinnings
Collette, Fabienne ULg

Conference (2015, September 04)

Detailed reference viewed: 14 (1 ULg)
Full Text
See detailFrom Aleph to Alma: Fulfillment, feel it fully
Van Ruymbeke, Muriel ULg; Lhoest, Rémy ULg; Thirion, Paul ULg

Conference (2015, September 04)

If it is well prepared, migrating from Aleph to Alma brings users a lot of advantages. To reach the go live day with as less worries as possible, ULg Library's preparation consisted in two things: a deep ... [more ▼]

If it is well prepared, migrating from Aleph to Alma brings users a lot of advantages. To reach the go live day with as less worries as possible, ULg Library's preparation consisted in two things: a deep understanding of Alma new concepts and a simplification of our physical fulfillment policy. This presentation, based on our experience, will aim at describing the main differences between Aleph and Alma regarding fulfillment concepts and their significant consequences on implementation and migration jobs. On a fulfillment point of view, what distinguishes Aleph from Alma is that, in Aleph, the circulation policy is based on item status. On the contrary in Alma it is based on the location, and its traffic rules built by a set of terms of uses (TOU). Numerous other idioms complete the Alma toolkit and allow physical item’s fulfillment customizing. But to really enjoy the new possibilities given by Alma, it is important to fully feel the necessary changes… at the very beginning ! [less ▲]

Detailed reference viewed: 84 (6 ULg)
Full Text
See detailMagnetic shielding properties of tubular bulk superconductors subjected to stray magnetic fields
Hogan, Kevin ULg; Fagnard, Jean-François ULg; Wera, Laurent ULg et al

Conference (2015, September 04)

Superconducting materials act as efficient magnetic shields thanks to their intrinsic magnetic properties. The vast majority of studies on superconducting shields has been conducted in homogeneous ... [more ▼]

Superconducting materials act as efficient magnetic shields thanks to their intrinsic magnetic properties. The vast majority of studies on superconducting shields has been conducted in homogeneous magnetic field configurations. Only few works have been done concerning inhomogeneous magnetic field configurations while those are representative of practical situations. Moreover, those configurations are non-trivial given the magnetic hysteretic behaviour of type-II superconductors. In the present work, we aim at investigating and understanding the magnetic response of a superconducting hollow cylinder made of Bi-2223 subjected to the magnetic stray field of various magnetic sources. Thanks to a bespoke 3D mapping system and a three-axis Hall probe, we measure the magnetic flux density distribution in the vicinity of the cylinder when the latter is subjected to those stray fields. All experiments are carried out in liquid nitrogen. Our experimental data allow us to apprehend the magnetic field penetration inside the superconductor in inhomogeneous field configurations and to compare those to results obtained with homogeneous fields. Then we compare our results to a finite element model of an infinite tube subjected to an inhomogeneous magnetic field in order to gather information on the magnetic field penetration and the current density distribution inside the superconductor. [less ▲]

Detailed reference viewed: 39 (9 ULg)
Full Text
See detailUne féminité en métamorphose: Représentation de la féminité noire dans le cinéma black-British
Herbert, Emilie ULg

Conference (2015, September 03)

Le long-métrage "Burning an illusion", réalisé par Menelik Shabazz, met en scène l'éveil politique d'une jeune femme noire, Pat (Cassie McFarlane) lorsqu'elle fait l'expérience du racisme et de la ... [more ▼]

Le long-métrage "Burning an illusion", réalisé par Menelik Shabazz, met en scène l'éveil politique d'une jeune femme noire, Pat (Cassie McFarlane) lorsqu'elle fait l'expérience du racisme et de la violence dans les rues de Londres. "Burning an illusion" est l'un des premiers films black British à prendre pour personnage principal une femme et Shabazz décrit la conscientisation politique de Pat en termes ouvertement féminins : sa transformation intellectuelle passe en effet par une métamorphose physique. A travers une africanisation de son apparence (son maquillage disparaît, ses vêtements changent et ses cheveux, soigneusement lissés au début du film, reprennent leur apparence naturelle), Pat manifeste son rejet des codes de beauté occidentaux qui annihilent les femmes noires en imposant la blancheur comme point de référence. Ce long-métrage, réalisé en 1981, met en avant une notion développée par un féminisme noir qui s'éveille à la même époque en Grande-Bretagne : celle de la (re)conquête de la féminité noire à travers la création d'une identité black British fluide qui reconnaît la nature fragmentée des identitées hybrides, racialisées et genrées (Mirza, 1997). L'analyse d'un corpus de plusieurs films du mouvement du black British Cinema des années 1980 et 90 à travers une approche intersectionnelle, féministe et de genre nous permettra de comprendre ce processus de redéfinition de la féminité noire, jusqu'alors rendue invisible au sein du cinéma britannique blanc (Bourne, 2001). Les films étudiés encouragent en effet la revalorisation de la beauté naturelle du corps féminin noir, permettant ainsi son mouvement d'objet à sujet (Weekes, 1997), en passant par un processus de métamorphose physique. Le corps y est fragmenté (Coly, 2010) afin d'en déconstruire l'image socialement et culturellement produite (Jordan-Zachery, 2013) et de créer ainsi une nouvelle syntaxe qui permet d'articuler et de comprendre le corps féminin noir différemment (Doane, 1981). [less ▲]

Detailed reference viewed: 53 (9 ULg)
See detailWildflowers sown at field margins have positive and negative effects on pests and parasitoids
Hatt, Séverin ULg; Uyttenbroeck, Roel ULg; Chevalier Mendes Lopes, Thomas ULg et al

Conference (2015, September 03)

Wildflower strips are sown at field margins throughout Europe to support insect conservation in agricultural areas. Among other insects, parasitoids may favor a biological regulation of pests. On an ... [more ▼]

Wildflower strips are sown at field margins throughout Europe to support insect conservation in agricultural areas. Among other insects, parasitoids may favor a biological regulation of pests. On an experimental field of the research platform AgricultureIsLife in Gembloux (University of Liège, Belgium), three replications of five wildflower seed mixtures were sown in strips adjacent to crops in spring 2013. Insect pests and their parasitoids were pan-trapped in spring 2014 in both wildflower strips and oilseed rape crops and identified at the species level. Flower species and cover were monitored in the strips using 1 m² quadrats, before mowing. Meligethes spp. were found abundantly in crops when oilseed rape was blooming. Meligethes’ parasitoids occurred later and their abundance was positively correlated with that of Meligethes in the flower strips. At the crop ripening stage, weevils Ceutorhynchus spp. occurred and were followed by an increase in abundance of their parasitoids in both crops and flowers. Positive as well as negative correlations were found between the abundance of these pests, their parasitoids and different flower species blooming at this time. The link between these results with flower species’ functional traits will be discussed. [less ▲]

Detailed reference viewed: 47 (14 ULg)
Full Text
Peer Reviewed
See detailImpact of a one-day preventive voice program for teachers : A longitudinal study
Remacle, Angélique ULg; Gerber, Silvain; David, Claire et al

Conference (2015, September 02)

I. INTRODUCTION Teachers are professional voice users, i.e. people who rely on a consistent, special, or appealing voice quality to achieve their job. If afflicted with dysphonia or aphonia, they would ... [more ▼]

I. INTRODUCTION Teachers are professional voice users, i.e. people who rely on a consistent, special, or appealing voice quality to achieve their job. If afflicted with dysphonia or aphonia, they would generally loose motivation at work and seek alternative employment [1]. Teachers represent the largest group of professionals complaining of dysphonia: they represent 20% to 25% of the treatment-seeking workers [2, 3]. Voice disorders impact both physical and psychological health. They represent a public health problem, since they have considerable economic consequences in terms of treatment and replacement of professionals who suffer from these problems [4]. Moreover, they have been shown to interfere with quality of life, emotional state, job satisfaction, performance and attendance [4, 5]. Finally, a teacher’s dysphonia adversely impacts students’ comprehension and learning [6]. These negative effects of teachers’ voice disorders motivate to develop prevention programs and test their efficacy. This study aims to evaluate the impact over a five-month period of a one-day prevention program for female teachers. This program includes both direct and indirect methods. II. METHODS A. Participants Twenty-two female kindergarten and elementary schoolteachers with less than 5 years of experience participated in this study. Half of them (test group) took part in a one-day prevention program in October, while the other half (control group) received no counseling on the use of the voice. B. Assessments For each participant, five sustained /a/ vowels and the reading of a text were recorded (1) at two times of the workday (morning and evening), and (2) at three times of the year: October (T0), December (T1) and February (T2). For the sustained vowels, we measured maximum phonation time (MPT), mean fundamental frequency (F0), values of jitter, shimmer and harmonics-to-noise ratio (HNR). For the texts, we measured mean F0, standard deviation in F0 and intensity, and parameters related to speech rate (number of syllables per second, number of pauses and mean duration of pauses). For each parameter, a repeated-measures ANOVA (2 groups * 2 times of day * 3 times of year) was carried out. Participants also completed a questionnaire on voice use and comfort at the three test sessions. III. RESULTS A. Time of day effect The main effect of time of day showed an increase in the mean F0 of the vowels and the text following a workday (p<.01). MPT and HNR also increased (p<.01), while jitter and shimmer decreased at the end of the day (p<.05). The speech rate measures showed that the teachers tended to pause less often while reading the text at the end of the day, and their pauses were shorter (p<.05). B. Time of year effect The main effect of time of year showed an increase in the mean F0 of the vowels and the text during the year (p<.01), with the highest values observed in December (T1). The speech rate measures also showed an increase in the number of syllables per second (p<.01) and a tendency for speakers to pause less often later in the year. C. Group effect Several acoustic parameters showed that voice changed during the day and during the year in significantly different ways in the two groups. Thus, the MPT increased more during the year for the control group than for the test group. The elevation of mean F0 during the day increased to a similar degree for both groups between T0 and T1, but continued to increase until T2 for the control group, while it decreased for the test group. Jitter and shimmer decreased significantly following a workday for both groups at T0, and this decrease was more marked for the test group at T1 and T2. Finally, analysis of the questionnaires showed a very strong deterioration in teachers’ self-evaluations of vocal comfort and control at T1; nevertheless there were significantly fewer complaints from the group that received the prevention program. IV. DISCUSSION AND CONCLUSION For both groups, the changes in the observed parameters suggested an increase in vocal fatigue and hyperfunctional phonation during the day and during the year. The results showed greater vocal deterioration in December than at the other points in the school year (October and February). For several acoustic parameters, the comparison of the two groups showed a less severe vocal deterioration for subjects who received the preventive program. Moreover, the questionnaires showed that the prevention program had a significantly positive impact on the changes in the teachers’ perception during the year. These results encourage to offer such preventive interventions to teachers before or during their career, since they have a positive impact on teachers’ perception and vocal comfort. V. REFERENCES [1] Titze IR, Lemke J, Montequin D. (1997). Populations in the U.S. workforce who rely on voice as a primary tool of trade: A preliminary report. Journal of Voice, 11(3), 254-259. [2] Van Houtte, E., Van Lierde, K., D'Haeseleer, E., & Claeys, S. (2010). The prevalence of laryngeal pathology in a treatment-seeking population with dysphonia. Laryngoscope, 120(2), 306-312. [3] Remacle, A., Petitfils, C., Lejeune, L., Finck, C., & Morsomme, D. (2014). Quel est le profil professionnel des patients consultant en phoniatrie ? 70e Congrès de la Société Française de Phoniatrie, Paris, France. (October 13, 2014). [4] Roy, N., Merrill, R. M., Thibeault, S., Parsa, R. A., Gray, S. D., & Smith, E. M. (2004). Prevalence of voice disorders in teachers and the general population. Journal of Speech, Language, and Hearing Research, 47(2), 281-293. [5] Chen, S. H., Chiang, S.-C., Chung, Y.-M., Hsiao, L.-C., & Hsiao, T.-Y. (2010). Risk factors and effects of voice problems for teachers. Journal of Voice, 24(2), 183-190. [6] Morsomme, D., Minel, L., & Verduyckt, I. (2011). Impact of teachers’ voice quality on children’s language processing skills. Vocologie: Stem en Stemstoornissen, 4, 9-15. [less ▲]

Detailed reference viewed: 115 (5 ULg)
Full Text
Peer Reviewed
See detailMilk biomarkers to detect ketosis and negative energy balance using MIR spectrometry
Grelet, Clément ULg; Bastin, Catherine ULg; Gelé, Marine et al

Conference (2015, September 02)

Detailed reference viewed: 38 (11 ULg)
See detailDevelopment of photo- or thermo-reversible cross-linked recyclable shape-memory materials
Defize, Thomas ULg; Riva, Raphaël ULg; Thomassin, Jean-Michel ULg et al

Conference (2015, September 01)

Shape-memory polymers (SMPs) are remarkable materials able to switch from a stressed deformed state (temporary shape) to their initial relaxed state (permanent shape) by the application of a stimulus ... [more ▼]

Shape-memory polymers (SMPs) are remarkable materials able to switch from a stressed deformed state (temporary shape) to their initial relaxed state (permanent shape) by the application of a stimulus, such as heat or light. Typically, the shape-memory property is generally observed for chemically or physically cross-linked polymers that exhibit an elastomeric behavior above a phase transition, e.g. glass or melting transition. As an example, cross-linked semi-crystalline poly(ε-caprolactone) (PCL) is widely studied for the development of SMPs. As most of SMPs are irreversibly cross-linked material, their reprocessing is impossible preventing any recycling. Thereby, reversible reactions, allowing the formation/cleavage of the network, raise tremendous interest for the development of new SMPs. Recently, we reported the preparation reversibly cross-linked PCL-based SMP using the Diels-Alder (DA) reaction between furan and maleimide end-groups of 4-arm star-shaped PCL, well-known to create reversible bonds. After implementation, this shape-memory material was demonstrated to be recyclable, and was characterized by excellent fixity and recovery before and after recycling experiments. However, the relatively low retro DA temperature of the furan-maleimide adducts led to an inelastic deformation during shape-memory tensile cycles. In order to get rid of this drawback, an alternative approach was investigated. The substitution of the DA reaction by a photo-reversible reaction, typically the photo-induced (2+2) cycloaddition of coumarins, was proposed to prepare cross-linked PCL matrix presenting one-way and two-way memory properties, since photolabile adducts are supposed to be stable during shape-memory tensile cycles. [less ▲]

Detailed reference viewed: 66 (5 ULg)
See detailRelationship between Stroke Volume and Pulse Wave Velocity
Kamoi, Shun; Pretty, Christopher; Chiew, Yeong Shiong et al

Conference (2015, September 01)

Stroke Volume (SV) measurements are essential for evaluating patient hemodynamic status and response to therapy. However, current methods for monitoring SV require either invasive or non- invasive ... [more ▼]

Stroke Volume (SV) measurements are essential for evaluating patient hemodynamic status and response to therapy. However, current methods for monitoring SV require either invasive or non- invasive additional measurements. This study investigates the relationship between SV and Pulse Wave Velocity (PWV) to examine whether the value of PWV can capture the changes in SV. The analysis was performed using data from six porcine experiments (N=6 Pietrain Pigs, 20-29 kg) in which left ventricular volume, aortic arc pressure, and descending aortic pressure waveforms were measured simultaneously. From the measured data, correlation coefficients were determined between absolute value of aortic PWV, SV and trend value ‘PWV – mean PWV’, ‘SV – mean SV’ during periods when changes in SV were induced from preload changes, as well as infusion of dobutamine. The results showed good correlation (r = 0.59) for trend value, however, the correlation coefficient were poor with r = 0.028 for absolute value across all pigs. The analysis showed that value of PWV is reliable for capturing trend value of SV in preload changes. However, it is unreliable for capturing absolute value of SV or changes in SV made from dobutamine. [less ▲]

Detailed reference viewed: 69 (0 ULg)
See detailL'emploi du conjonctif en kirundi
Tuyubahe, Pascal ULg

Conference (2015, September 01)

The verb in the conjuctive mood accompagnies always an other verb (auxiliary verb or verb in subordinate clause (valencielle or not) not introduced by a linking word. It is marked by an initial high tone ... [more ▼]

The verb in the conjuctive mood accompagnies always an other verb (auxiliary verb or verb in subordinate clause (valencielle or not) not introduced by a linking word. It is marked by an initial high tone on the first vowel after the first consonnant. After an auxiliary, the high tone disappears in the presence of -ra- morpheme in the present tense. Auxiliaries trigger raising from subject to subect and distinguish two type of morpheme -ra- in the conjunctive verb: -ra- determined syntactically and -ra- determined lexically. [less ▲]

Detailed reference viewed: 16 (2 ULg)
See detailCross-linked polymer micelles made of polyphosphate containing amphiphilic copolymers for drug delivery
Riva, Raphaël ULg; Vanslambrouck, Stéphanie ULg; Ergül, Zeynep ULg et al

Conference (2015, September 01)

In the pharmaceutical field, amphiphilic block copolymers are of great interest for the nanovectorization of active principles in Drug Delivery. Indeed, new drugs are synthesized each day but in too many ... [more ▼]

In the pharmaceutical field, amphiphilic block copolymers are of great interest for the nanovectorization of active principles in Drug Delivery. Indeed, new drugs are synthesized each day but in too many cases, their high hydrophobicity makes them useless because of the absence of an appropriated administration method. Typically, amphiphilic block copolymers present the remarkable property to self-assemble in water with formation, in most cases, of spherical micelles characterized by a hydrophobic core and a hydrophylic corona. Rapidly, their ability to encapsulate a hydrophobic drug in their hydrophiobic core was investigated to increase the solubility of the drug in aqueous media, prevent its degradation and decrease its toxicity. However, polymer micelles suffer of the main drawback to be unstable in diluted medium, leading to a premature release of the drug, when the concentration falls down the critical micellar concentration (CMC), which it is rapidly observed after intravenous injection. This work aims at reporting on the development of a drug delivery device based on a new amphiphilic block copolymers made of degradable polyphosphate and bioeliminable poly(ethylene oxide). Thanks to their biocompatibility, biodegradability and their structure similar to natural biomacromolecules, polyphosphates are appealing polymers for biomedical applications. In contrast to aliphatic polyesters, polyphosphate properties and functionality are easily tuned via the chemical nature of the lateral chains R. In order to get rid of the CMC, the crosslinking of the micelle’s core was realized by UV radiation, in order to fulfill the increasingly stringent requirements of biomedical applications. For this purpose, photo-cross-linkable groups were introduced on the polyphosphate backbone. The effect of the crosslinking rate on the drug loading and the drug release was evaluated using doxorubicin as model drug. [less ▲]

Detailed reference viewed: 320 (8 ULg)
Full Text
See detailModel-Based Stressed Blood Volume is an Index of Fluid Responsiveness
Pironet, Antoine ULg; Dauby, Pierre ULg; Chase, J. Geoffrey et al

Conference (2015, September 01)

Fluid therapy is frequently used to manage acute circulatory failure. This therapy aims to restore cardiac output by fluid administration, which increases the quantity of fluid in the circulation. However ... [more ▼]

Fluid therapy is frequently used to manage acute circulatory failure. This therapy aims to restore cardiac output by fluid administration, which increases the quantity of fluid in the circulation. However, it has been shown to be effective only in certain cases, leading to the need for indices of fluid responsiveness. Total stressed blood volume has recently been shown to be such an index of fluid responsiveness. However, the current methods to determine this parameter require specific procedures. In this work, a more straightforward method is developed using data available in the intensive care unit. A simple three-chamber cardiovascular system model is used, of which total stressed blood volume is a parameter. All model parameters (including total stressed blood volume) are adjusted to pig experimental data during fluid administrations. The resulting value of total stressed blood volume is always negatively associated with the relative change in cardiac output after fluid administration. This finding confirms that total stressed blood volume is an index of fluid responsiveness. Another finding of this study is that the response curves are subject-specific. The method developed in this work can be applied to humans, since the data required is typically available in an intensive care unit. [less ▲]

Detailed reference viewed: 24 (2 ULg)
Peer Reviewed
See detailFitness evaluation and molecular characterization of a recombinant murine norovirus (MuNoV) during serial passages in cell culture
Ferreira de Oliveira Filho, Edmilson; Di Felice, Elisabetta; Toffoli, Barbara et al

Conference (2015, September 01)

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a ... [more ▼]

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a recombinant Wu20/CW1 strain was obtained after in vitro coinfection of RAW264.7 cells with parental MuNoV strains CW1 and Wu20 (Mathijs et al 2010). The recombinant strain showed reduced plaque size compared to the parental strains and it was suggested that this was due to modified virulence properties in vitro. The aim of this study was to observe and molecularly characterize the natural genetic evolution of the recombinant MuNoV strain across in vitro replications. Methods: MNV strains used in this study were CW1, WU20 (Thackray et al., 2007, kindly provided by prof. H. Virgin) and Rec MNV (Mathijs et al., 2010). RAW 264.7 cells (ATCC TIB-71) grown in Dulbecco’s modified Eagle’s medium (Invitrogen) complemented (DMEMc) with 10 % heat inactivated FCS (BioWhittaker), 2 % penicillin (5000 U /ml) and streptomycin (5000 mg/ml) (PS; Invitrogen) and 1 % HEPES buffer (1 M; Invitrogen). The recombinant strain was serially replicated in vitro in RAW264.7 cells (up to 14 passages). RAW 264.7 (Mouse leukaemic monocyte macrophage) cells were infected with MNV for 72 hours and afterwards lysed by freeze and thaw and viruses purified by ultracentrifugation of both cells and supernatant. Viral plaque sizes of early and late progenies (30 for each virus) were compared with the Image J software. The experiment was repeated two times. RNA was extracted from 140 ml purified suspension 1:5 diluted using the QIAamp Viral RNA Mini KitTM (Qiagen) according to the manufacturer’s instructions. cDNA was generated using a poly-A primer tagged GCCAACGACCGGGAGGCCAGC(T)20 previously described (Müller et al 2007) using superscript ii reverse transcriptase kit (Invitrogen®) treated with RNase H or with other antisense primers using iScript select kit (Bio-Rad®). For the genetic characterization two different studies were conducted. The first study aimed to develop a sequencing strategy in order to obtain the complete genome of the recombinant MNV. Then, in the second study, sequences obtained from different viral passages into RAW cells (e.g. P5 and P14) were compared in order to study the viral adaptation. Primers were designed using the Primer Express® software and netprimer® (Premier biosoft). PCR was performed using taq polymerase with thermopol buffer (new England biolabs) as per manufacturer’s instructions. Afterwards, fragments were excised from agarose gel and DNA purified using the QIAquick Gel Extraction KitTM (Qiagen) and cloning using the PGEM T easy cloning kit (Promega) plasmid DNA was transferred to sequencing by GATC Biotech (Koblenz, Germany). Results: The size of the lysis plaque surface of P2 and P14 showed a considerable divergence. The average plaque size increased from the earlier to the later progenies (from 0.1 mm2 to around 0.5 mm2). A significant difference was demonstrated between them with the Mann and Whitney non parametric statistical test. The genetic characterization of the recombinant strain obtained in vitro was previously based on partial genomic sequences, which provided limited information. Accordingly to our initial molecular analysis of 1.5 kb partial genomic sequence comprising the part of the RdRp and the part of the VP1 did not show any genetic modifications between passage 4 (accession number HM044221) and passage 14 recMNV. Therefore, a strategy for sequencing the complete genome of the different MNV strains was established. The genome of the recombinant MNV was divided into seven regions and the amplification was performed using either new designed or previous published primers. Molecular analysis using the nearly complete genome of the recombinant MNV passage 14 and the two parental strains (CW1 and WU20) showed nine modifications in the genome, comprising three aminoacid changes. Accordingly, two modification were in the RdRp region aa position 1384 Glycine (G) instead of Aspartic acid (D) and aa position 1393 Serine (S) instead of Asparagine (N) and one modification was in the capsid region one modification on aa position 296 Glutamic Acid (E) instead of Lysine. Conclusion: Even preliminary, our data provide evidence of virus adaptation to a new environment (here a cell culture system) after a recombination event. In order to specify whether these hints of genetic mutations could explain fitness modifications during in vitro evolution we need to compare the sequences of passage 14 and the previous viral cellular passages. In addition, two other parameters of in vitro virulence modification will be investigated: (i) virus production and (ii) growth kinetics. The data should provide interesting information about genetic evolution in the genus Norovirus, especially regarding recombination events and explain how a recombinant strain, first disadvantaged compared to its parental strains, could regain fitness by genetic evolution. [less ▲]

Detailed reference viewed: 33 (4 ULg)
See detailSea ice in the global biogeochemical cycles: How much do we care?
Vancoppenolle, M.; Moreau, S.; Bopp, L. et al

Conference (2015, September)

Large changes in the state and seasonality of sea ice are expected for this century in both hemispheres. The impact of these changes on marine biogeochemical cycles and ecosystems is difficult to predict ... [more ▼]

Large changes in the state and seasonality of sea ice are expected for this century in both hemispheres. The impact of these changes on marine biogeochemical cycles and ecosystems is difficult to predict. Will the polar oceans be more or less biologically productive? Will they take up more or less carbon? At this stage, the answers to these key questions are not obvious. Marine biogeochemical cycles in the sea ice zone are characterized by specific processes that have been unravelled over the last 20 years or so. They involve active biological and chemical processes within the sea ice, the modulation of heat and gas exchanges by the ice cover; and the impact of growing and melting sea ice on the water column stratification and vertical exchanges in the water. To understand how sea ice influences marine biogeochemical cycles, the sea ice biogeochemical community focuses on: (i) the synthesis of existing data and the interpretation of robust large-scale patterns; (ii) the introduction of new representations of sea ice processes into large-scale models of the Earth System and the study of their impact; (iii) the evaluation of existing observation methods and the development of new ones. In this talk, I will review and synthesize recent research activities in these lines of thought. [less ▲]

Detailed reference viewed: 42 (0 ULg)
Full Text
Peer Reviewed
See detailModelling Agents’ Behavior in the Context of River Floods: An Ant Colony based Approach
Saadi, Ismaïl ULg; El Saeid Mustafa, Ahmed Mohamed ULg; Teller, Jacques ULg et al

Conference (2015, September)

This paper presents a model for understanding short-term travelers’ behavior in the context of river floods. In several cities, river floods are considerably affecting urban transportation systems. In ... [more ▼]

This paper presents a model for understanding short-term travelers’ behavior in the context of river floods. In several cities, river floods are considerably affecting urban transportation systems. In this regard, decision makers need comprehensive models to define efficient risk management strategies. The dynamic nature of this problem requires an algorithm able to deal with traffic redirecting during the micro-simulation process. Furthermore, a transportation network contains a significant number of links and nodes which lead to large computation times. In this regard, an Ant Colony Optimization (ACO) algorithm is proposed to solve such combinatorial problems. In a basic ACO, some ants/agents might push the algorithm to converge toward non-optimal solutions. In this context, a MAX-MIN Ant System (AS) approach is included in the algorithm to stimulate the best solutions. In addition, the discrete choice model is adapted to allow more behavioral reactions regarding simulated river floods. [less ▲]

Detailed reference viewed: 22 (10 ULg)
Full Text
See detailBifacial serrated technology in the southern African Still Bay: new data from Sibudu Cave, Kwazulu-Natal
Schmid, Viola; Porraz, Guillaume; Rots, Veerle ULg et al

Conference (2015, September)

Detailed reference viewed: 34 (4 ULg)
Full Text
See detailRèglement EU 650/2012 sur les successions et planification successorale
Wautelet, Patrick ULg

Conference (2015, September)

Detailed reference viewed: 39 (0 ULg)
Peer Reviewed
See detailAssessing the anti-androgenic activities of chemicals and surface waters using Brachionus calyciflorus and the anti-YAS test
Joaquim-Justo, Célia ULg; Bellisai, Giulia; Chalon, Carole et al

Conference (2015, September)

It has been shown over the past decade that Brachionids are sensitive to some vertebrate hormones and environmental contaminants with endocrine disrupting properties in vertebrates. Several Brachionus ... [more ▼]

It has been shown over the past decade that Brachionids are sensitive to some vertebrate hormones and environmental contaminants with endocrine disrupting properties in vertebrates. Several Brachionus species have been shown to be particularly sensitive to progestagens and anti-androgens. Institutions in charge of the monitoring and the management of the environment, need to constantly update their tools to ensure optimal detection of hazardous chemicals and to achieve adequate protection of the environment. With that intent, we compared the results obtained when testing the androgenic and anti-androgenic activity of substances and surface water samples/effluents with the YAS and anti-YAS tests and by sexual reproduction tests with Brachionus calyciflorus. Respective sensitivities and feasibilities of both these types of tests have been assessed and will be discussed. [less ▲]

Detailed reference viewed: 9 (0 ULg)
Full Text
See detailThe use of the Vadose Zone Experimental Setup as an innovative in situ characterization method for the vadose zone: a case study at an industrial contaminated site in Belgium
Fernandez de Vera, Natalia ULg; Beaujean, Jean ULg; Jamin, Pierre ULg et al

Conference (2015, September)

The development of protection and remediation plans for contaminated soil and groundwater require a detailed understanding of the transport of pollutants in the subsurface. However, such understanding is ... [more ▼]

The development of protection and remediation plans for contaminated soil and groundwater require a detailed understanding of the transport of pollutants in the subsurface. However, such understanding is affected by the lack of spatial and temporal coverage provided by the current in situ characterization technologies. A new system has been developed in order to overcome such limitations. The vadose zone experimental setup is a new development combining cross-hole geophysics and the Vadose Zone Monitoring System (VMS). In cross-hole geophysics, an injection of an electrical current using electrodes installed in vertical boreholes is triggered. From measured potential differences, spatial patterns related with subsurface heterogeneities, water content and solute concentrations are inferred. The VMS allows continuous measurements of water content at different depths of the vadose zone, as well as water sampling. The system is formed by a flexible sleeve containing monitoring units along its depth which is installed in a slanted borehole. The system was installed at a former industrial site in Belgium, where soil and groundwater are contaminated with BTEX, PAH, and heavy metals. Two VMS were installed in two slanted boreholes on site, together with four vertical boreholes containing electrodes for geophysical measurements. The site was initially monitored under natural recharge conditions. Water content sensors located along the VMS registered fast wetting and draining reactions to rainfall events followed by the activation of water transport through fractures. Results from soil water samples show continuous evolution of water chemistry with depth, due to disequilibrium between infiltrated water and the hydrochemical conditions in the unsaturated zone. Subsequently, a saline tracer was injected in the surface. The transport of the tracer in the subsurface was monitored via cross-hole and surface geophysics. Results from imaging reflect the evolution of a plume through vertical and lateral transport and dilution. [less ▲]

Detailed reference viewed: 107 (14 ULg)
Full Text
See detailTwinkling Lights in the Nightside Upper Atmosphere: How Nightglow Contributes to our Understanding of Global Dynamics
Brecht, Amanda; Bougher, S.; Stiepen, Arnaud ULg et al

Conference (2015, September)

Upper atmospheres of planets continuously emit photons in the UV, Visible, and IR regions of the electromagnetic spectrum. Some of these emissions are classified as airglow, which includes dayglow and ... [more ▼]

Upper atmospheres of planets continuously emit photons in the UV, Visible, and IR regions of the electromagnetic spectrum. Some of these emissions are classified as airglow, which includes dayglow and nightglow. There are several mechanisms to create these emissions, but this presentation will focus on nightglow emissions resulting from photochemistry of neutral components. These neutral components originate on the dayside and are transported from the dayside to the nightside of a planet, where they subsequently undergo chemical reactions yielding nightglow. Nightglow emissions serve as effective tracers for planetary middle and upper atmosphere global wind systems due to their variable peak brightness and spatial distributions. The main planetary focus for this presentation will be on Mars and Venus’ atmospheres, due to the similar chemical constituents which populate their upper atmospheres. Currently, NO UV nightglow has been observed (e.g. Venus Express, Mars Express) on both Venus and Mars, while O2 IR nightglow has only been observed on Venus but is predicted to be seen on Mars. The observations show variations in time and location (latitude, local time, and altitude). The locations of the maximum nightglow intensities on each planet are different, but are supportive of the general picture of these two planet’s global circulation patterns. Model implications for both nightglows on both planets can provide valuable insight and understanding of the dynamical and chemical processes creating the nightglow emission variability. Two three-dimensional general circulation models will be utilized: the Venus Thermospheric General Circulation Model (VTGCM) and the Mars Global Ionosphere-Thermosphere Model (MGITM). The model output will be compared to nightglow datasets for each planet individually and planet to planet, to contrast the variations of the nightglow features and the underlying drivers for those variations. [less ▲]

Detailed reference viewed: 43 (5 ULg)
Peer Reviewed
See detailThe materiality of Intangible Cultural Heritage: food and social encounters.
Mescoli, Elsa ULg

Conference (2015, September)

Following the patrimonialization process of the Mediterranean diet, some gastronomies found themselves involved within a common framework of food traditions. Some regional practices, indicated as ... [more ▼]

Following the patrimonialization process of the Mediterranean diet, some gastronomies found themselves involved within a common framework of food traditions. Some regional practices, indicated as representative of national food cultures, were chosen to illustrate a shared heritage that historically took a shape around the Mediterranean sea. This heritage, still concretely performed, needed to be stated and preserved against the globalization of food practices. Institutional and political dynamics, occurring on a transnational level, triggered this process, which is nevertheless not detached from the communities involved. Common people played a fundamental role not only in promoting the patrimonialization process itself, but above all in concretely perpetuating some traditions and in spreading them in the contemporary world. In particular, some different cultural groups that found themselves living a common territory and social context thanks to migration, began dialoguing about their own food traditions, starting from some shared elements. As a consequence, some gastronomies interact through people’s practices and define in relation one to the other. This is the case, among others, of Moroccan and Italian cuisine. Throughout a doctoral research conducted within a group of Moroccan women living in the North of Italy, I collected an amount of ethnographic materials showing how social encounters developed through food. The influence of the patrimonialization process on these encounters made people try to find similarities among different traditional practices or to describe some ways of reinterpreting them in reason of the new context. My presentation will focus on these dynamics, thus proving that the Intangible Cultural Heritage is indeed grounded on materiality, that is, in this case, the concrete performance of food practices and their pragmatic effects on relations among humans. [less ▲]

Detailed reference viewed: 57 (2 ULg)
Full Text
Peer Reviewed
See detailInvestigation of volatile mixture emit by human tissues degradation
Stefanuto, Pierre-Hugues ULg; Dubois, Lena; Lloyd, Rebecca et al

Conference (2015, September)

Human rescue dog unit are the more efficient tool to locate cadaver or people trap after a natural disaster. However, the dog training process is long and expensive. Dog trainers are always looking for a ... [more ▼]

Human rescue dog unit are the more efficient tool to locate cadaver or people trap after a natural disaster. However, the dog training process is long and expensive. Dog trainers are always looking for a better understanding of the dog olfaction matching to improve their training methods (1). During these training sessions, dogs are usually trained to locate body pieces due to the difficulty to obtain a full cadaver. Moreover, some training aid solution are available but their compositions and their efficiencies are not worldwide recognized (2). To answer these questions, this project is monitoring the headspace human organs during the decomposition process. Five different organs are used: heart, lung, liver, kidney and blood. Every organs are sampled in triplicates and let to decompose in glass jar. Regularly, the headspace of the jar is sample by dynamic pumping to sorbent tubes that will further be injected on comprehensive two-dimensional gas chromatography system (GC×GC). GC×GC is a powerful analytical tool that allows the complete resolution of “the smell of death”, i.e. the decomposition odor (3-4). The compounds identified in the organs headspace can be compared with the one coming from decomposition studies on full bodies to establish a biomarkers list that will further be used for dog training solution elaboration. References 1. Hoffman et al. FSI (2009) 186, 6-13. 2. Stadler et al. J. Chrom. A. 1255, 202-206. 3. Stefanuto et al. CPC (2014) 79, 786-789. 4. Perrault et al. J. Sep. Sci. (2015) 38, 73-80. [less ▲]

Detailed reference viewed: 78 (14 ULg)
See detailIUVS observations of Nitric Oxide nightglow
Stiepen, Arnaud ULg; The IUVS team

Conference (2015, September)

Detailed reference viewed: 23 (4 ULg)
Full Text
See detailLes premières forêts communautaires du Gabon - Le film - Bonus 1
Meunier, Quentin; Boldrini, Sylvie; Federspiel, Michèle et al

Conference (2015, September)

Detailed reference viewed: 7 (4 ULg)
Full Text
See detailFirst Results From MAVEN’s Imaging UV Spectrograph
Schneider; McClintock; Stewart et al

Conference (2015, September)

We report the first results from The Imaging Ultraviolet Spectrograph (IUVS) aboard the Mars Atmosphere and Volatile and EvolutioN (MAVEN) spacecraft orbiting Mars. The instrument is accomplishing its ... [more ▼]

We report the first results from The Imaging Ultraviolet Spectrograph (IUVS) aboard the Mars Atmosphere and Volatile and EvolutioN (MAVEN) spacecraft orbiting Mars. The instrument is accomplishing its goals of characterizing the atmospheric composition and structure, enabling studies of atmospheric escape that will contribute to our understanding of Mars’ atmospheric evolution. In addition, the instrument has made unexpected discoveries concerning meteor showers, aurora and nightglow on Mars. [less ▲]

Detailed reference viewed: 33 (0 ULg)
See detailObservations of Mars aurorae
Gérard, Jean-Claude ULg; Soret, Lauriane ULg; Libert, Ludivine ULg et al

Conference (2015, September)

We present recent results obtained by combining remote sensing observations and in situ measurements of the Martian aurora made from Mars Express.

Detailed reference viewed: 35 (9 ULg)
Full Text
See detailDiscovery of Diffure Aurora on Mars
Stiepen, Arnaud ULg; Schneider; Jain et al

Conference (2015, September)

The Imaging Ultraviolet Spectrograph (IUVS, McClintock et al., 2014) onboard the MAVEN spacecraft has discovered diffuse aurora in Mars’ northern hemisphere spanning a wide range of geographic latitudes ... [more ▼]

The Imaging Ultraviolet Spectrograph (IUVS, McClintock et al., 2014) onboard the MAVEN spacecraft has discovered diffuse aurora in Mars’ northern hemisphere spanning a wide range of geographic latitudes and longitudes (Figure 1). This widespread aurora differs from the small auroral patches discovered by the SPICAM instrument onboard the Mars Express spacecraft (Bertaux et al., 2005; Leblanc et al., 2008; Gérard et al., submitted; Soret et al., submitted) restricted to regions of crustal magnetic fields in the southern hemisphere. Furthermore, the northern diffuse aurora appears to peak at altitudes below 100 km, while the crustal field aurora peaked around 120 km. [less ▲]

Detailed reference viewed: 40 (1 ULg)
Full Text
See detailStudy of the Crystallization Behavior and the Subsequent Martensitic Transformation in a High Chromium Cast Steel submitted to Different Austenitization Temperatures
Tchuindjang, Jérôme Tchoufack ULg; Habraken, Anne ULg; Lecomte-Beckers, Jacqueline ULg

Conference (2015, September)

The crystallization behavior a High Chromium Cast Steel (HCCS) has been determined under Equilibrium conditions with ThermoCalc® software, and under non-Equilibrium conditions through Differential Thermal ... [more ▼]

The crystallization behavior a High Chromium Cast Steel (HCCS) has been determined under Equilibrium conditions with ThermoCalc® software, and under non-Equilibrium conditions through Differential Thermal Analyses (DTA). The results are compared to each other and the differences between the predicted solidification path and the actual one obtained from DTA (Figure 1) are highlighted. The microstructure in the as-cast conditions is characterized while using both scanning electron microscopy (SEM) and hardness measurements. The SEM analysis involves a combination of methods such as backscattered electron observation, energy dispersive spectrometry and backscattered-electron diffraction with X rays, which ensure proper identification of complex solidification carbides and the matrix made of martensite and retained austenite (Figure 2a). Solid state transformations occurring during the heating stage up to the austenitization temperature are studied towards both DTA and dilatometry, especially the dissolution/precipitation reactions. Different austenitization temperatures are considered prior to cooling down to room temperature during dilatometry tests to determine the starting points (Ms) for martensite transformation. In addition a cryogenic quenching within liquid nitrogen is performed which allows the completion of the martensitic transformation (Figure 2b) and help determining the critical point for the end of the martensitic reaction (Mf points). An enhanced discussion based on the influence of the cooling rate and the undercooling is developed to explain the differences that are observed between equilibrium and non-equilibrium conditions, which are mainly related to the solidification sequence and the carbides formed. The influence of the austenitization temperature and the matrix composition/supersaturation on both Ms and Mf points is also discussed. [less ▲]

Detailed reference viewed: 23 (3 ULg)
Full Text
Peer Reviewed
See detailSilurian acritarchs and associated freshwater and marine microfloras from Saudi Arabia: comprehensive review and new insights
Le Hérissé, A.; Steemans, Philippe ULg; Breuer, P. et al

Conference (2015, September)

Detailed reference viewed: 31 (5 ULg)
Full Text
Peer Reviewed
See detailAlkali injuries may lead to errors of diagnosis and mistreatment (161)
JACQUEMIN, Denise ULg

Conference (2015, September)

Detailed reference viewed: 12 (0 ULg)
Full Text
See detailThermal-vacuum and vibration test campaigns that led to the OUFTI-1 nanosatellite being fully qualified by ESA for launch and operation in Earth orbit
De Dijcker, Sébastien ULg; Werner, Xavier ULg; Broun, Valery ULg et al

Conference (2015, September)

OUFTI-1’s test campaigns were divided into two phases. The goal of Phase 1 is to demonstrate that the different functionalities of the satellite work as intended. The goal of Phase 2 is to subsequently ... [more ▼]

OUFTI-1’s test campaigns were divided into two phases. The goal of Phase 1 is to demonstrate that the different functionalities of the satellite work as intended. The goal of Phase 2 is to subsequently demonstrate that the satellite can withstand the launch into orbit, and then work properly in the conditions of space. The corresponding tests thus involve both thermal-vacuum environmental tests (in appropriate test chambers) and vibration tests (on appropriate vibration pods). The conditions simulated during these tests are as close as possible to those that the satellite will encounter during its mission, covering as many cases as possible, amid uncertainties, since neither the launcher nor the orbit were known prior to the tests. Both phases involve the flight model (FM), in accordance with the so-called "protoflight" approach. [less ▲]

Detailed reference viewed: 102 (6 ULg)
See detailControlling factors and occurrence of inorganic and organic compounds in groundwater of urban and industrial areas
Gesels, Julie ULg; Dollé, Fabien ULg; Leclercq, Julie et al

Conference (2015, September)

A relatively extensive survey of groundwater contaminants is performed in urban and industrial contexts, at the regional scale (Walloon Region of Belgium), outside spots of contamination related to ... [more ▼]

A relatively extensive survey of groundwater contaminants is performed in urban and industrial contexts, at the regional scale (Walloon Region of Belgium), outside spots of contamination related to contaminated sites. More specifically, the most detected inorganic trace elements and organic contaminants are identified and their levels of occurrence are described statistically. Mechanisms that can explain their occurrence in groundwater are discussed. From a more pragmatic point of view, the data set has been also used to derive upper limits of pollutant background concentrations to be used in decision-making related to the management of contaminated groundwater in urban and industrial environments. The results presented are based on 243 samples from 8 sectors located in different geological contexts and different urban and industrial contexts. Each groundwater sample was analyzed for 19 inorganic trace elements, 61 organic micro-pollutants and 10 major and minor elements. Five physico-chemical parameters were measured in the field, at the time of sampling to determine the environmental conditions prevailing in groundwater. For comparison, existing groundwater analyses in natural context, available for the entire Walloon Region, were compiled from several databases. Cumulative distribution function plots allow comparing the distributions of inorganic trace elements in urban and industrial sectors to those obtained at the scale of the entire Walloon region. Cumulative distribution function plots are also used to compare the distribution of the inorganic trace elements in the different lithologies, in urban and industrial contexts. The composition of groundwater is altered in urban and industrial sectors with increased concentrations for most inorganic trace elements and organic contaminants. Anthropogenic influence is not limited to inputs of pollutants but also to alterations of subsurface environmental conditions, in particular redox conditions, resulting in the mobilization of pollutants. The influence of lithology is also marked in the data set. [less ▲]

Detailed reference viewed: 23 (4 ULg)
See detailNature des villes, nature des champs : Synergies et controverses. Journée de terrain à La Louvière (Belgique)
Schmitz, Serge ULg; Cornut, Pierre; Dubois, Charline ULg et al

Conference (2015, September)

Comment une ville moyenne, née du charbon et de l'industrialisation, se restructure pour s'inscrire sur la carte de Belgique et maintenir activités économiques et habitants? Entre patrimoine Unesco, Plan ... [more ▼]

Comment une ville moyenne, née du charbon et de l'industrialisation, se restructure pour s'inscrire sur la carte de Belgique et maintenir activités économiques et habitants? Entre patrimoine Unesco, Plan Communal de Développement de la Nature et Rénovation urbaine, nous analyserons les divers projets d'amélioration du cadre de vie et d'intégration de la nature tant côté ville que côté campagne. [less ▲]

Detailed reference viewed: 27 (2 ULg)
Full Text
See detailWhat can we learn about quasars and uni cation scheme with the microlensing technique ?
Sluse, Dominique ULg

Conference (2015, September)

Our understanding of the gravitational lensing phenomenon has deeply progressed since the discovery of the "first" gravitationally lensed object in 1979 by Walsh and collaborators. With more than hundreds ... [more ▼]

Our understanding of the gravitational lensing phenomenon has deeply progressed since the discovery of the "first" gravitationally lensed object in 1979 by Walsh and collaborators. With more than hundreds of quasars known to be multiply imaged by a foreground galaxy, gravitational lensing is now a powerful astrophysical and cosmological tool. The stars located in lensing galaxies produce small deflections of the light rays coming from distant quasars which adds to the main deflection from the lensing galaxy. Because the deflection caused by the stars is small, the micro-images they produce remain unresolved. Only a flickering of the flux and spectral deformation of lensed quasars images are observed. I will explain how this micro-lensing effect, can be used to study the inner region of distant quasars. Specifically, I will zoom out from the inner accretion disc up to the torus, and give an overview of the information which can be retrieved at each of these scales. I will give a special emphasis on the constraint we can put on the orientation/geometry of the various emitting regions (i.e. disc, broad line region, torus) at each of these scales. [less ▲]

Detailed reference viewed: 18 (2 ULg)
See detailIconologies contemporaines : une compréhension symbolique de l’image est-elle toujours d’actualité ?
Hagelstein, Maud ULg

Conference (2015, September)

Le problème que je voudrais envisager ici tient à la pertinence de la compréhension symbolique de l’image. Il me semble qu’à première vue, la théorie de l’image contemporaine met en défaut ... [more ▼]

Le problème que je voudrais envisager ici tient à la pertinence de la compréhension symbolique de l’image. Il me semble qu’à première vue, la théorie de l’image contemporaine met en défaut l’interprétation symbolique de l’image. Ce débat peut être rapporté au problème de l’héritage, par les nouvelles générations de spécialistes de l’image, de la discipline de l’ICONOLOGIE et à la réception des travaux des grands historiens/théoriciens de l’art qui l’ont fondée. Depuis la fin des années 1980, de nombreuses tentatives visent à donner au concept d’iconologie un sens actuel. Au point que l’on peut – sans dénaturer cet élan théorique nouveau – parler d’« iconologies contemporaines ». La méthode iconologique vise l’interprétation du contenu symbolique des images. Elle repose donc entièrement sur une compréhension symbolique du visuel, et s’est d’ailleurs nourrie du dialogue avec la philosophie des formes symboliques d’E. Cassirer. Dans le système décrit par Cassirer, l’art se définit en tant que fonction symbolique (ce qui revient à dire = l’art est un domaine de production de significations, dont la vocation principale serait de charger de sens des éléments sensibles/matériels). Cette fonction symbolique particulière serait en outre inscrite dans un devenir historique (puisque le « contenu » des œuvres, les éléments de sens associés aux éléments sensibles, dépend fortement du contexte socio-historique d’inscription et reflète/révèle une vision du monde historiquement déterminée). Depuis la fin des années 1980, cette méthode a commencé à générer chez les théoriciens de l’art et du visuel (en général), toutes sortes de réactions d’insatisfaction – voire même d’hostilité. Les différentes réactions (je vais en détailler trois aujourd’hui : T. Mitchell, G. Didi-Huberman et G. Boehm) s’accordent (ou en tout cas pourraient s’accorder) sur le fait que l’iconologie doit être complétée : l’approche symbolique des œuvres doit par ex. pouvoir s’appuyer sur une attention soutenue à leur matérialité (c’est à cet endroit que les outils « phénoménologiques », notamment, viennent au secours de l’analyse). [less ▲]

Detailed reference viewed: 25 (1 ULg)
See detailTransparent electrodes based on silver nanowire networks: physical properties and potential applications
Lagrange, Mélanie; Sannicolo, Thomas; Langley, Daniel et al

Conference (2015, September)

Transparent electrodes (TE) constitute a key component of optoelectronic devices such as solar cells, efficient organic light-emitting diodes (OLEDs), touch screens. Currently the most widely used TE is ... [more ▼]

Transparent electrodes (TE) constitute a key component of optoelectronic devices such as solar cells, efficient organic light-emitting diodes (OLEDs), touch screens. Currently the most widely used TE is indium tin oxide (ITO), which offers low resistivity and high transparency in the visible. However the scarcity of indium and the lack of flexibility of ITO has prompted the search for alternative materials. Among emerging TE, metallic nanowire (NW) networks appear to be a promising solution since these percolating networks exhibit excellent properties with sheet resistance of a few Ω/sq and optical transparency of 90%, fulfilling the requirements for many applications. In addition, the fabrication of these electrodes involves low-temperature process steps and upscaling methods, thus making them very appropriate for future use as TE for flexible devices. Our research is focused on both the fabrication of TE based on silver NW and the optimization of their physical properties, using experimental and modelling approaches. The influence of several key parameters such as network density, silver NW dimensions as well as thermal annealing, on the networks physical properties is thoroughly explored. A comprehensive understanding of the relationship between design and main physical properties of these promising nanostructured networks will be presented. Their stability will also be discussed. Finally, we will also show that such TE can be very well adapted as transparent heaters. [less ▲]

Detailed reference viewed: 52 (3 ULg)
Full Text
Peer Reviewed
See detailA new hybrid approach for modelling groundwater flow in karst aquifers
Willems, Thibault ULg; Hakoun, Vivien ULg; Renard, Philippe et al

Conference (2015, September)

Groundwater flow modelling in karst aquifers represents a real challenge that requires adapted methods. The applicability of an innovative hybrid approach for modelling groundwater flow in karst aquifers ... [more ▼]

Groundwater flow modelling in karst aquifers represents a real challenge that requires adapted methods. The applicability of an innovative hybrid approach for modelling groundwater flow in karst aquifers, namely the Hybrid Finite Element Mixing Cell (HFEMC) method, is evaluated. The hybrid approach consists in combining a classical finite element (FE) model, to model slow flow in the rock matrix, with spatially distributed lumped reservoirs, to model fast flow in the karst conduits network. Water exchanges between the rock matrix and the conduits network are accounted for by means of an internal Fourier boundary conditions (BC). This BC (1st order exchange relation) allows to control the magnitude of water transfers between fast and slow flow domains. We tested the applicability of the HFEMC method on a schematic synthetic domain and on a real karst system. In the synthetic case analysis, we discussed dynamic processes of groundwater storage occurring in the karst system during a recharge pulse. The study focuses on the influence of selected parameters on representative variables such as the discharge curve of the karst system or pressure and mass transfers between conduits and rock matrix sub-domains. In this way, an inversion of the hydraulic gradient between karst conduits and the surrounding rock matrix is shown to occur during the recharge pulse. This phenomenon results in a temporary storage of water from conduits to the rock matrix, which impacts the modelled discharge curve. The first test performed on a real study site, the Noiraigue spring karst system (Jura mountains, Switzerland), exemplify the use of two separated lumped reservoirs for describing the conduits network, which allows to consider two base levels in the karst system. It also points out the challenges to face when modelling a complex natural karst system with the HFEMC approach. The results obtained show that the HFEMC approach is a good candidate to model groundwater flow in karst aquifers. [less ▲]

Detailed reference viewed: 83 (21 ULg)
Full Text
See detailImpact of forest transition on non-timber forest products in Central Africa
Gillet, Pauline ULg; Vermeulen, Cédric ULg; Feintrenie, Laurène

Conference (2015, September)

The objective of the study is to evaluate the impact of deforestation on non-timber forest products (NTFPs) harvest in Central Africa. The most common vegetal NTFPs are fruits, barks and leaves used as ... [more ▼]

The objective of the study is to evaluate the impact of deforestation on non-timber forest products (NTFPs) harvest in Central Africa. The most common vegetal NTFPs are fruits, barks and leaves used as complements to the staple food (cassava or plantain). Animal NTFPs such as caterpillars, worms and bush meat represent a major source of animal protein in the villagers’ diet. We analyzed the evolution of several parameters including NTFPs diversity, distance to the road, changes in land tenure rules, proportion in the alimentary bolus and in the villagers’ incomes. The research is based on field surveys, participatory mapping and geolocation of activities held in 8 villages. Three study sites are located at different stages on Mather’s forest transition curve (Mather, 1992). This curve shows the relationship between forest cover and population density. The sites represent the situations: (i) important cover of intact forest, (ii) forest partially degraded and under pressure of conversion to other land uses and (iii) small surfaces of degraded forest with a trend of plantation of useful trees on deforested land. Results show a reduction in NTFPs diversity along with the increase of deforestation. The maximum distance of collection sites to the road increases between the first and the second study site, as a consequence of the decrease in the quantity of NTFPs available. This distance decreases significantly in the third study site due to the contraction of villages’ terroir. The diversity of bush meat decreases while the hunting bag evolves from big to small species along with the forest transition. Land tenure rules to access and extract NTFPs become stricter. As a consequence, the proportion of these products reduces in the alimentary bolus and in the family cash income. This analysis establishes a strong link between Mather’s forest transition curve and the decline of the importance of NTFPs in the village production and livelihoods systems [less ▲]

Detailed reference viewed: 37 (0 ULg)
Full Text
See detailTrapped magnetic flux density and influence of crossed fields in structures combining large grain, bulk (RE)BCO superconductors and soft ferromagnetic discs
Philippe, Matthieu ULg; Ainslie, Mark D; Fagnard, Jean-François ULg et al

Conference (2015, September)

Bulk (RE)BCO superconductors are able to trap record magnetic fields and can be used as powerful permanent magnets in various engineering applications such as rotating machines and magnetic bearings. We ... [more ▼]

Bulk (RE)BCO superconductors are able to trap record magnetic fields and can be used as powerful permanent magnets in various engineering applications such as rotating machines and magnetic bearings. We combine soft ferromagnetic pieces with bulk, large grain (RE)BCO high temperature superconductors to form superconductor/ferromagnet (SC/FM) hybrid structures. We study how a ferromagnetic disc influences the trapped flux density at the surface of a SC/FM structure at 77 K and the magnetic moment of the whole structure. The flux density generated by the superconductor is shielded above the ferromagnet. The saturation of the ferromagnet by the flux of the superconductor is investigated with the help of a finite element model and a simple analytical formula is suggested to determine the saturation threshold. Finally, we show that the ferromagnetic disc lowers the relative demagnetization effect caused by the application of magnetic field cycles orthogonal to the main magnetization (crossed field configuration). [less ▲]

Detailed reference viewed: 43 (7 ULg)
Full Text
Peer Reviewed
See detailLes progrès de la foresterie sociale et communautaire
Vermeulen, Cédric ULg; Meunier, Quentin; Moumbogou, Carl et al

Conference (2015, September)

Depuis plus de dix ans, le Gabon s'est doté de lois forestières riches en promesses quant à la gestion sociale des massifs forestiers par les populations locales, à travers le concept de « forêt ... [more ▼]

Depuis plus de dix ans, le Gabon s'est doté de lois forestières riches en promesses quant à la gestion sociale des massifs forestiers par les populations locales, à travers le concept de « forêt communautaire ». C'est dans ce cadre que s'est inscrit le projet Union Européenne DACEFI, projet mis en oeuvre de 2010 à 2014 à travers un partenariat entre le Ministère en charge des Forêts, le WWF, l’association sans but lucratif belge Nature+ et le Laboratoire de foresterie tropicale et subtropicale de Gembloux Agro-Bio Tech. L'objectif était de développer la foresterie sociale et communautaire sur les plans technique, institutionnel et organisationnel. Les équipes du projet ont développé des concepts et méthodes innovantes adaptées aux contextes socio-économiques locaux. La mise en place d'un cadre réglementaire a permis la création des premières forêts communautaires du Gabon, tandis que le renforcement de capacités au niveau des communautés a permis une autonomisation et une responsabilisation nécessaire à la mise en oeuvre des premiers plans simples de gestion. DACEFI en chiffres, c’est une centaine de villages sensibilisés depuis le début du projet, 16 sites partenaires accompagnés, 8 associations villageoises reconnues et formées, 7 communautés activement engagées dans la création d’une forêt communautaire, plus de 10 écoles et plusieurs centaines d’élèves primaires sensibilisés sur la gestion durable, 10 textes de loi rédigés ou révisés pour la mise en place du cadre réglementaire régissant les forêts communautaires au Gabon, une clé de répartition des revenus construite, accompagnée d’outils ludiques pour sa mise en place et sa compréhension et enfin plus de 10 000 plants d’arbres produits en pépinières et des dizaines de sites enrichis. Un film a également été produit qui sera présenté séparément au congrès. [less ▲]

Detailed reference viewed: 36 (1 ULg)
Full Text
See detailBrain trains: scenario development to explore intermodal rail transport expansion in, from and towards Belgium
Troch, Frank; Vanelslander, Thierry; Belboom, Sandra ULg et al

Conference (2015, September)

Detailed reference viewed: 32 (12 ULg)
Peer Reviewed
See detailEcologia funcional de campos rupestres
Negreiros, Daniel; Le Stradic, Soizig ULg; Fernandes, Geraldo Wilson

Conference (2015, September)

Detailed reference viewed: 22 (0 ULg)
Full Text
See detailDe Erfrechtverordening : wat moet elke notaris weten?
Wautelet, Patrick ULg; Goossens, Elise

Conference (2015, September)

Cette présentation offre une première approche des principes généraux qui structurent le Règlement 650/2012 relatif aux successions

Detailed reference viewed: 89 (0 ULg)
Full Text
Peer Reviewed
See detailFabriquer la nature pour la récréation des citadins : le tourisme à la ferme, la « renaturation » d’un service dénaturé ?
Dubois, Charline ULg; Schmitz, Serge ULg

Conference (2015, September)

Beaucoup de personnes associent / confondent les espaces agricoles et espaces de nature, tant au niveau des utilisateurs qu’au niveau des décideurs. A travers l’activité spécifique de l’agritourisme, nous ... [more ▼]

Beaucoup de personnes associent / confondent les espaces agricoles et espaces de nature, tant au niveau des utilisateurs qu’au niveau des décideurs. A travers l’activité spécifique de l’agritourisme, nous voulons interroger la domestication de la nature par les agriculteurs afin qu’elle colle aux représentations des clients urbains. Nous analysons les nouvelles manières de concevoir la campagne et la nature au travers d’activités de loisirs et services récréatifs à la ferme. Certains agriculteurs, voulant diversifier leurs activités, participer au développement local ou récupérer et promouvoir une image valorisante de leur métier, développent de nouveaux produits et services touristiques, culturels, gastronomiques, de bien-être et de santé à destination de la société (Watkins & Matless 2003, Poulot 2011, Aubry & Pourias 2013). Pour accueillir des touristes, les agriculteurs ne doivent-ils pas dénaturer l’activité agricole pour « renaturer » de manière urbaine l’environnement proche ? Les agriculteurs qui choisissent l’agritourisme adaptent ainsi progressivement leurs produits aux attentes des citoyens. Mais quelle limite donner à cette adaptation quand on connaît le lien entre l’activité agricole et l’activité d’accueil à la ferme ? Quelle est l’importance de l’atout nature dans cette diversification ? Nous interrogeons d’abord un corpus de 40 récits de vie auprès d’agriculteurs wallons et luxembourgeois, tenanciers d’une activité de diversification centrée sur le tourisme au sein de leur exploitation agricole (pratiques agricoles différentes, produits touristiques variés, expériences courtes et longues, motivations complexes) (Dubois 2014). Ensuite nous utilisons les résultats d’une enquête réalisée dans la rue auprès de touristes potentiels (sur les 1148 individus interrogés dans 7 pôles touristiques de Wallonie et du Grand-Duché de Luxembourg, 48% se considèrent comme urbain) (Dubois 2014). Nous utilisons enfin une analyse des exploitations agricoles visitées et de leurs abords au travers des éléments et caractéristiques (milieu physique, anthropique, humain, animaux, produits touristiques) mis en avant dans les photos prises sur le terrain et dans les images utilisées pour leur promotion touristique. Les analyses de contenu (analyses qualitatives avec NVivo®) et les analyses statistiques (analyses quantitatives avec Statistica®) font ressortir que le concept de nature mis en avant se focalise aux paysages, aux promenades et au calme : notamment des paysages que la personne peut observer depuis la terrasse, des promenades balisées de courte durée et un calme qui invite au repos et où la personne se sent en sécurité. La nature voulue par les urbains est une nature très sélective et cadrée. Mais même si les agriculteurs évoluent dans leur finage, il existe des initiatives et des stratégies différentes : la plupart des agriculteurs se contentent de domestiquer la nature au abords de la ferme pour faire paraître un cadre agréable et sécurisant, se gardant de modifier leur pratiques agricoles dans les champs avoisinants, d’autres, minoritaires, on prévu des parcours de découvertes et des activités intégrées dans la nature tels les golfs fermiers. [less ▲]

Detailed reference viewed: 44 (7 ULg)
Full Text
See detailComparison of the wear behavior of high speed steel grades obtained from conventional casting and laser cladding
Hashemi, Seyedeh Neda ULg; Lecomte-Beckers, Jacqueline ULg; Montrieux, Henri-Michel ULg et al

Conference (2015, September)

Tools Steels are alloys which withstand severe mechanical and physicochemical stresses in service. Therefore their alloying design that involved both the original chemical composition and the casting ... [more ▼]

Tools Steels are alloys which withstand severe mechanical and physicochemical stresses in service. Therefore their alloying design that involved both the original chemical composition and the casting route is crucial in order to achieve a tailored microstructure exhibiting enhanced wear performances. Tools steels obtained from conventional casting processes had received lot of attention so far as they yield typical microstructure composed of a quasi-continuous network of coarse grain boundary carbides with grain size ranging between 20 to 200 µm. Direct energy deposition applied to Tools Steels represents a new emerging technique that may allow ultrafine grained microstructures due to the higher cooling rates achieved especially in the solidification range. In this paper, four tool steels grades were studied, one of them being obtained from a conventional casting process and the other ones originated from the direct energy deposition. Differential Thermal Analysis helps enhancing the solidification sequence of the studied alloys, while their microstructure after subsequent heat treatment was characterized by the means of both optical and electron microscopes together with hardness measurements. Tribological tests carried out at room temperature and at high temperature were performed while using a “pin-on-disc” device. Based on the friction coefficient and the wear rate, the wear performances of the tool steel were determined and compared with one another. The influence of metallurgical features (the grain size, or the nature, the size and the distribution of carbides) on the wear behavior was also enhanced. The setting of the wear test parameters together with the microstructure of the studied materials seems to strongly influence the subsequent abrasion and wear mechanisms. [less ▲]

Detailed reference viewed: 39 (8 ULg)
Full Text
See detailThe Number of Structures Compatible with any Specified Correlation Function
Gommes, Cédric ULg

Conference (2015, September)

Detailed reference viewed: 13 (1 ULg)
Full Text
See detailChallenging ourselves: three benchmarks for nonlinear system identification
Schoukens, Maarten; Noël, Jean-Philippe ULg

Conference (2015, September)

Detailed reference viewed: 10 (2 ULg)
Full Text
Peer Reviewed
See detailCadaveric VOC profiling from human internal cavity
Stefanuto, Pierre-Hugues ULg; Varlet, Vincent; Grabherr, Silke et al

Conference (2015, September)

The processes tacking place during body decomposition is not yet totally understood. Soon after death, the different parts of a body start to decompose. This phenomenon conduct to the production of gases ... [more ▼]

The processes tacking place during body decomposition is not yet totally understood. Soon after death, the different parts of a body start to decompose. This phenomenon conduct to the production of gases inside or around the different organs. These gases reservoirs can be located using imaging tools as post-mortem computed tomography (PMCT) and subsequently sample (1). The analysis of very volatile compounds inside these internal cavities already provides useful information for legal medicine investigations (2). It gives valuable information about the potential cause of death avoiding the invasiveness of the autopsy procedure. This project wanted to perform an untargeted screening of this internal cavity in order to monitor the decomposition process taking place inside a cadaver. The analytical method was base on previously used techniques for complete decomposition analysis (3-4). This study wanted to investigate the volatile organic compounds (VOC) mixture present in these cavities. To achieve this task, we applied solid phase micro-extraction (SPME) combined with two-dimensional gas chromatography coupled to high-resolution time of flight mass spectrometer (GC×GC-HRTOFMS). The first point was to demonstrate the ability of GC×GC-HRTOFMS to detect these VOC. The combination of different statistical approaches conducted to establishment of potential biomarkers list. Base on these biomarkers identification, different decomposition stages were observed for different organs in the same body. The cardiac area seems to decompose faster than the other tissues studied in this project. References 1. Levy A.D. et al., Am. J. Forensic Med. Pathol. (2010) 31, 12-17. 2. Varlet V. et al., Anal. Chim. Acta (2013) 784, 42-46. 3. Stadler S. et al., Anal Chem (2013) 85, 998–1005. 4. Stefanuto et al. CPC (2014) 79, 786-789. [less ▲]

Detailed reference viewed: 62 (12 ULg)
Full Text
See detailProperty rights, freedom of testation and protection of family members under the EU Succession Regulation
Wautelet, Patrick ULg

Conference (2015, September)

Cette présentation synthétise les possibilités offertes par le Règlement succession afin de protéger les proches du défunt contre la volonté de celui-ci de les priver des droits réservataires qui ... [more ▼]

Cette présentation synthétise les possibilités offertes par le Règlement succession afin de protéger les proches du défunt contre la volonté de celui-ci de les priver des droits réservataires qui pourraient leur revenir. [less ▲]

Detailed reference viewed: 54 (0 ULg)
Peer Reviewed
See detailImpact of the trophic strategy on the eco-functional diversification of a coral reef fish family
Gajdzik, Laura ULg; Aguilar-Medrano, Rosalia; Parmentier, Eric ULg et al

Conference (2015, September)

The analyses of the role of trophic strategies as promoter or constraint on processes of diversification remain understudied, especially in fish. The Pomacentridae (damselfishes), a species-rich (394 ... [more ▼]

The analyses of the role of trophic strategies as promoter or constraint on processes of diversification remain understudied, especially in fish. The Pomacentridae (damselfishes), a species-rich (394 species) and worldwide distributed reef fish family, include three main trophic guilds: (1) pelagic zooplankton feeders, (2) benthic feeders grazing on turf algae or biting polyps and (3) an intermediate group feeding on zooplankton, small benthic invertebrates and algae. Our study aims to analyze the role of the trophic strategies in the eco-functional diversity of Pomacentridae. Due to its feeding versatility, we hypothesize that the intermediate trophic group is the most successful group in terms of eco-functional diversity through evolutionary time. To target our aim, we compiled detailed dietary, environmental and behavioral data for 201 pomacentrid species, and compared the eco-functional diversity among trophic guilds. Various metrics, such as functional entity (i.e. unique combinations of functional traits) and functional richness revealed that the intermediate trophic group exhibited the lowest diversity. Then, we used time-calibrated phylogenies and comparative methods to evaluate the impact of trophic strategies on the tempo of ecological diversification. Results were consistent and the lowest rate of diversification was found for the intermediate trophic group. Our study shows that a generalist trophic strategy does not promote ecological diversification but being specialized may increase the ability to evolve greater diversity. [less ▲]

Detailed reference viewed: 27 (4 ULg)
Peer Reviewed
See detailFish as aquatic "sniffer dogs": Olfactory-mediated behaviors and conditioning of common carps to cadaver odors
Jamandre, Brian Wade ULg; Ferrari, Frederic; Joseph, Jean-Ronald et al

Conference (2015, September)

Even with the aide of modern technology, the search for cadaver or human remains underwater is still assisted by sniffer dogs mainly because of their superior sense of olfaction. However, dogs rely on ... [more ▼]

Even with the aide of modern technology, the search for cadaver or human remains underwater is still assisted by sniffer dogs mainly because of their superior sense of olfaction. However, dogs rely on volatile organic compounds in the air and that this may constraint their ability when searching for submerged cadavers. On the other hand, it has long been recognized that fishes use olfaction to sample odors from their surroundings to accomplish a task and are capable of acquiring new skills through training or conditioning. Despite decades of experimental and observational studies of the olfactory sensitivities of fishes, its potential application to forensic sciences has never been truly explored. In this pioneering research, we explore the possibility of using fish olfaction in detecting cadaver odors (porcine origin), using common carps Cyprinus carpio as model species in a series of experiments under laboratory conditions. We first observed the innate behavior of carps towards cadaver odors. Afterwards, the carps were trained in two-choice chamber experimental tanks by appetitive olfactory conditioning and odor masking methods. We also experimented on the effects of cadaver odors by early exposure using eggs and larval impregnation techniques, and observing the behaviors when they develop to early juveniles. In general, we found out that common carps are naturally repelled to cadaver odors. However using our devised conditioning protocol, results show that the conditioned carps were able to learn to be attracted to cadaver odors despite their innate aversion. The development of fish for cadaver detection is a simple but innovative idea and that it may present a cost-effective and reliable solution for the shortcomings of the existing methods in underwater cadaver search. We anticipate that this research will open up a variety of different studies in pursuit of developing fishes as biosensors and its application to forensic sciences. [less ▲]

Detailed reference viewed: 121 (11 ULg)
Full Text
Peer Reviewed
See detailDelinquent youth groups in Belgium: representations of their realities
Witvrouw, Line ULg

Conference (2015, September)

Detailed reference viewed: 26 (3 ULg)