References of "Scientific congresses and symposiums"
     in
Bookmark and Share    
Peer Reviewed
See detailMolecular phylogeography of the common dormouse, Muscardinus avellanarius, in Europe
Mouton, Alice ULg; Grill, Andrea; Krystufek, Boris et al

Conference (2009, September)

The common dormouse, Muscardinus avellanarius is naturally rare in Europe. Recently, natural scarcity has been exacerbated by anthropogenic environmental damages. This specie is now regarded as rare or ... [more ▼]

The common dormouse, Muscardinus avellanarius is naturally rare in Europe. Recently, natural scarcity has been exacerbated by anthropogenic environmental damages. This specie is now regarded as rare or endangered, attracting conservation related research and active habitat management to assist its survival. Furthermore, obligatory thermophilous species are probably more affected by cold phases than cold-tolerant organisms. The evolutionary history of the common dormouse would therefore show significant differences compared to other species. To better understand the genetic variation and structure of this species, we developed a phylogeographic study based on sequences of 700 base pairs of the mitochondrial DNA cytochrome b gene from 102 specimens collected throughout its palearctic distribution. The obtained dataset was analysed using different phylogenetic reconstruction as well as other methods adapted to phylogeography. The analysis of the mtDNA reveals a number of surprises. The results show two major genetic lineages: the first corresponding to the Western and Italian populations; the second comprising the Balkan and the Northern populations. Furthermore, the analyses tend to propose a scenario of multiple refugia in the Italian peninsula. This pattern of ‘refugia within-refugia’ has important implications in interpreting the distribution patterns of genetic diversity within the southern peninsulas. The Calabria region and Sicily could be “hot spots” of intraspecific biodiversity of Muscardinus avellanarius. These regions would thus deserve attention when deciding Evolutionary Significant Units (“ESU) for conservation of this species. [less ▲]

Detailed reference viewed: 90 (5 ULg)
Full Text
See detailRecovery of γ-decalactone produced by Rhodotorula aurantiaca from the culture broth using Macronet resins
Alchihab, Mohamed; Aldric, Jean-Marc ULg; Aguedo, Mario ULg et al

in New Biotechnology (2009, September), 25S

Detailed reference viewed: 12 (2 ULg)
Full Text
Peer Reviewed
See detailThe Role of Void Evolution on the bendability of Steel Sheets
Ben Bettaieb, Mohamed ULg; Lemoine, Xavier; Duchene, Laurent ULg et al

in Oñate, E.; Owen, D. R. J. (Eds.) Computational plasticity X. Fundamentals and applications (2009, September)

In the present contribution, an advanced Gurson model is developed and implemented in the Lagamine finite element code[1. This model is used to simulate the bending process and to predict the bendability ... [more ▼]

In the present contribution, an advanced Gurson model is developed and implemented in the Lagamine finite element code[1. This model is used to simulate the bending process and to predict the bendability of the studied sheet. [less ▲]

Detailed reference viewed: 145 (24 ULg)
Peer Reviewed
See detailHow can we predict difficulty in PISA reading items ? The process of describing item difficulty
Lumley, T.; Mendelovits, J.; Searle, D. et al

Conference (2009, September)

Detailed reference viewed: 28 (2 ULg)
Peer Reviewed
See detailA study of levitation forces in MEMS devices
Sari, Ibrahim; Cardwell, C.; Kraft, Michaël ULg

in MME 2009 (2009, September)

Detailed reference viewed: 6 (0 ULg)
Peer Reviewed
See detailPISA Student Non Response Adjustment Procedures
Rust, K.; Krawchuk, S.; Monseur, Christian ULg

Conference (2009, September)

Detailed reference viewed: 8 (0 ULg)
Peer Reviewed
See detailLa gliceraldehido-3-fosfato deshidrogenasa plastidial es esencial para el desarrollo de polen maduro en Arabidopsis thaliana
Muñoz-Bertomeu, Jesús; Cascales - Miñana, Borja ULg; Flores-Tornero, Maria et al

Poster (2009, September)

Detailed reference viewed: 17 (0 ULg)
Peer Reviewed
See detailWorld Federation of Neurosurgical Societies
Martin, Didier ULg

Conference (2009, August 30)

Detailed reference viewed: 10 (0 ULg)
Full Text
See detailAssociations among BCS, milk production and days-open in Walloon primiparous dairy cows
Massart, Xavier; Laloux, Laurent; Bastin, Catherine ULg et al

Conference (2009, August 27)

Detailed reference viewed: 23 (7 ULg)
See detailPepLook Scale-Up Prediction of protein structures
Crowet, Jean-Marc ULg; Lins, Laurence ULg; Brasseur, Robert ULg

Poster (2009, August 27)

Besides experimental approaches for peptide structures determination which results often differ with assay conditions, there is, to our knowledge, only three in silico methods available for the prediction ... [more ▼]

Besides experimental approaches for peptide structures determination which results often differ with assay conditions, there is, to our knowledge, only three in silico methods available for the prediction of peptide structures: Pepstruct, Rosetta and PepLook. The latter was developed by the CBMN (1, 2) based on the fact that any protein PDB model can be re-constructed in silico using a restricted subset of φψ couples of angles (3). As PepLook was able to predict conformation of peptides and protein fragments, like cell penetrating peptides (CPPs) (1) and the hydrophobic segment of DGKє (4) with good accuracy, we are testing whether PepLook could be used for the prediction of complete protein structures. To reach this goal, PepLook is used to predict the conformation of peptidic fragments along the protein sequences. The sequence is scanned with different sizes of windows shifted along the sequence from the first to the last residue. For each sequence window, the 99 PepLook models of structure are analysed and compared to the PDB model. PepLook scans are running for five proteins, α-synuclein (1XQ8), a Zinc endoprotease (1C7K), Ubiquitin (1UBQ), Cytochrome b562 (256B) and Lysozyme (3LZT, 1AM7), using different window lengths (7, 9, 11, 15, 17, 21, 23 and 27 residues) by sliding steps of 1 residue. Since this approach requires huge calculation time, we present here the preliminary results. [less ▲]

Detailed reference viewed: 25 (2 ULg)
Full Text
See detailHet Leerdercorpus Nederlands in theorie en in de praktijk
Perrez, Julien ULg; Degand, Liesbeth

Conference (2009, August 24)

Detailed reference viewed: 62 (1 ULg)
Full Text
Peer Reviewed
See detailTriangle Inequality Violation Avoidance in Internet Coordinate Systems
Liao, Yongjun ULg; Leduc, Guy ULg

Poster (2009, August 24)

Detailed reference viewed: 98 (15 ULg)
See detailThe Danish Model: The case of partnership dissolution in cross national comparison
Gavray, Claire ULg; bould, sally; Schmaus, Gunther

Conference (2009, August 21)

Detailed reference viewed: 22 (3 ULg)
Peer Reviewed
See detailStakeholders’ involvement as a social construct process, A use of the Actor Network Theory
El Abboubi, Manal ULg; Cornet, Annie ULg

Conference (2009, August 11)

We address the question of how organisations can gain the involvement of their stakeholders in CSR certifications projects. Applying the stakeholder theory and the actor network theory, we conceptualize ... [more ▼]

We address the question of how organisations can gain the involvement of their stakeholders in CSR certifications projects. Applying the stakeholder theory and the actor network theory, we conceptualize stakeholder involvement in the certification process of a diversity label. We also delineate the potential of our framework for future managerial applications. [less ▲]

Detailed reference viewed: 87 (16 ULg)
See detailRecurrent Energization of Plasma in the Midnight-to-Dawn Quadrant of Saturn's Magnetosphere, and its Relationship to Auroral UV and Radio Emissions
Mitchell, D.; Krimigis, S.; Paranicas, C. et al

Poster (2009, August 11)

Detailed reference viewed: 9 (1 ULg)
See detailVolition and planned behaviour theory: How to fill the gap between intention and performance?
Broonen, Jean-Paul ULg

Conference (2009, August 06)

This study evaluated the contribution of implementation intentions over the constructs of the theory of planned behaviour (TPB) in testing a confirmatory model explaining the relationships between ... [more ▼]

This study evaluated the contribution of implementation intentions over the constructs of the theory of planned behaviour (TPB) in testing a confirmatory model explaining the relationships between antecedents of academic achievement for university students. It was found that the effects of intention to perform and its classic antecedents on exams performance were mediated by implementation intentions with a considerable increase of amount of explained variance above the contribution of the constructs of TPB. [less ▲]

Detailed reference viewed: 91 (9 ULg)
Full Text
Peer Reviewed
See detailFamiliar person recognition: Is autonoetic consciousness more likely to accompany face recognition than voice recognition?
Barsics, Catherine ULg; Brédart, Serge ULg

in Dubois, Daniel (Ed.) COMPUTING ANTICIPATORY SYSTEMS, CASYS'09 - Ninth International Conference, Liège, Belgium, 3-8 August 2009 (2009, August 05)

Detailed reference viewed: 37 (3 ULg)
Full Text
Peer Reviewed
See detailAcademies of Science in 18th-Century Europe and the Application of Scientific Methods on Exploration. A Comparative Study.
Vandersmissen, Jan ULg

Conference (2009, August 01)

In the 18th century, exploration witnesses a growing tendency towards a systemization of the observation and registration of scientific data overseas. Explorers come under the influence of scientists who ... [more ▼]

In the 18th century, exploration witnesses a growing tendency towards a systemization of the observation and registration of scientific data overseas. Explorers come under the influence of scientists who want to intervene in the practice of scientific travelling by formulating specific guidelines for field investigation. These scientists themselves are subject of the growing demand of central state governments for verified knowledge on the utility of new discoveries in the field of geography and natural history. Exploration enters a new phase in its development and becomes the instrument of a utilitarian state directed scientific policy. Each of the imperial powers of Europe has an Academy of science or a learned society that plays a crucial role in this development. Nonetheless, we witness some remarkable differences in approach between these nations and hence between these learned societies. In this paper I make a comparative analysis of the instruction texts addressed to explorers by the Academies of science of 18th-century Europe, from the Parisian Académie royale des Sciences to the Royal Society of London and the Imperial Academy of Sciences in Saint Petersburg. [less ▲]

Detailed reference viewed: 33 (1 ULg)
See detailThe evolution of magnetic fields in early B-type stars
Hubrig, S.; Briquet, Maryline ULg; Scholler, M. et al

in Revista Mexicana de Astronomia y Astrofisica Conference Series (2009, August 01)

To date, only a small number of O and early B-type stars have been investigated for magnetic fields, and as a result, only about a dozen magnetic early B-type stars and only few magnetic O stars are known ... [more ▼]

To date, only a small number of O and early B-type stars have been investigated for magnetic fields, and as a result, only about a dozen magnetic early B-type stars and only few magnetic O stars are known. The lack of information on the existence, origin and role of magnetic fields in massive stars is especially disturbing because magnetic fields may have paramount influence on the stellar evolution of high-mass stars. Our study focuses on the magnetic fields in early B-type stars with a stronger emphasis on beta Cep and SPB stars. Weak longitudinal magnetic fields (up to Ë 300 G) have been recently detected using FORS 1 in a few beta Cep and SPB stars, proving that these types of massive B-type stars can no longer be considered as non-magnetic. [less ▲]

Detailed reference viewed: 12 (2 ULg)
Full Text
Peer Reviewed
See detailLiver transplantation (LT) from donation after cardiac death (DCD) donors: Multicenter Belgian experience 2003-2007
Detry, Olivier ULg; Donckier, Vincent; Lucidi, Valerio et al

in Transplant International (2009, August), 22(S2), 62-234

Detailed reference viewed: 54 (12 ULg)
Full Text
See detailIntraspecific biodiversity in South East asian rodents: new insights for their conservation
Latinne, Alice ULg; Rivière, Taiana; Pagès, Marie ULg et al

Poster (2009, August)

Detailed reference viewed: 12 (1 ULg)
Full Text
Peer Reviewed
See detailCrystal plasticity prediction of Lankford coefficient using the MULTISITE model: influence of the critical resolved shear stresses
Hammami, Walid ULg; Delannay, Laurent; Duchene, Laurent ULg et al

in International Journal of Material Forming (2009, August), 2(Supplément 1), 65-68

The MULTISITE model [1] is based on polycrystalline plasticity and the underlying hypotheses of the model are (i) that the deformation of each grain is significantly influenced by the interaction with a ... [more ▼]

The MULTISITE model [1] is based on polycrystalline plasticity and the underlying hypotheses of the model are (i) that the deformation of each grain is significantly influenced by the interaction with a limited number of adjacent grains, and (ii) that local strains deviate from their macroscopic average according to specific “relaxation modes”. The LAMEL model [2] is reformulated into the more general elastic-viscoplastic MULTISITE model permitting various relaxation modes. This model has been validated for cubic materials but hexagonal close-packed (HCP) crystals usually demonstrate larger anisotropy than cubic crystals. The model was used to simulate uniaxial tensile tests performed on rolled sheets made of Ti-6Al-4V. The Lankford coefficients (r) calculated in various directions in the plane of the sheet were analysed. In this study, different grain interaction hypotheses were tested. Besides, it appeared that the value of the critical resolved shear stresses (CRSS) of the different slip system families of the HCP metal had significant effects on the results. Their influence as well as the influence of the strain rate sensitivity parameter was examined. [less ▲]

Detailed reference viewed: 223 (47 ULg)
Full Text
See detailEstimates of genetic parameters among body condition score and calving traits in first parity Canadian Ayrshire cows
Bastin, Catherine ULg; Loker, Sarah; Gengler, Nicolas ULg et al

in Book of Abstracts of the 60th Annual Meeting of the European Association for Animal Production (2009, August)

Detailed reference viewed: 23 (8 ULg)
Peer Reviewed
See detailCours sur les ingéniéries didactiques
Schneider-Gilot, Marguerite ULg

Conference (2009, August)

Detailed reference viewed: 15 (0 ULg)
Full Text
Peer Reviewed
See detailThermal modelling of the cooling ceiling system as a commissioning tool.
Fonseca, N.; Andre, Philippe ULg; Cuevas, Ch.

(2009, August)

This paper presents the results of a study performed to develop a computational model of cooling ceiling systems. This one has to be used in situ, as diagnosis tool in commissioning process in order to ... [more ▼]

This paper presents the results of a study performed to develop a computational model of cooling ceiling systems. This one has to be used in situ, as diagnosis tool in commissioning process in order to determine the main operating conditions of the system in cooling mode. The model considers the cooling ceiling as a fin. Only the dry regime is considered. From ceiling and room dimensions, material description of the cooling ceiling and measurement of supply water mass flow rate and air and water temperatures, the model calculates the cooling ceiling capacity, ceiling surface average temperature and water exhaust temperature. Fin efficiency, mixed convection close to the cooling ceiling (generated by the ventilation system) and panel perforations influence are studied. A series of tests and experimental results on four types of cooling ceilings are used in order to validate the model. [less ▲]

Detailed reference viewed: 40 (8 ULg)
Full Text
See detailAdding value to test-day data by using modified best prediction method
Gillon, Alain ULg; Abras, Sven; Mayeres, Patrick et al

in Book of Abstracts of the 60th Annual Meeting of the European Association for Animal Production (2009, August)

Computation of lactation yields from test-day yield has lost much of its importance for genetic evaluations as <br />the use of test-day models is rather widespread. At the same time its importance for ... [more ▼]

Computation of lactation yields from test-day yield has lost much of its importance for genetic evaluations as <br />the use of test-day models is rather widespread. At the same time its importance for intra-farm management <br />increases at farms as a base for advanced management tools. The most common official method to compute <br />lactation yield is the Test Interval Method (TIM). Alternative methods for computing cumulated productions <br />were developed. These methods can be considered as improvements of TIM as the interpolation method, <br />or completely different methods as multiple-trait prediction (MTP) and best prediction (BP). Research <br />in this field has shown the potential to compute lactation parameters (e.g., cumulated production) with <br />test-day models. The aim of this study was to develop a new method which takes into account advantages <br />and disadvantages of existing methods, and to test its potential to provide useful tools to help farmers to <br />make management decisions. The second objective was to compare the accuracy and the robustness of this <br />method with those of BP and TIM. Because of its similarities with BP, the method developed here was <br />called mBP, for modified-BP. The main difference from BP is the definition of the standard lactation curve. <br />To minimize bias, components of standard lactation curves proper to each herd are computed jointly with <br />random individual effects. Recently a new version of mBP was tested that puts expectations of constant <br />animal effects to observed average values using Bayesian prediction, a feature also used by MTP. [less ▲]

Detailed reference viewed: 84 (22 ULg)
See detailA search for rotational and pulsational variability in three HgMn stars
Briquet, Maryline ULg; Gonzalez, F.; Korhonen, H. et al

Poster (2009, August)

Detailed reference viewed: 7 (1 ULg)
Full Text
Peer Reviewed
See detailCertified Internet Coordinates
Kaafar, Mohamed Ali; Mathy, Laurent ULg; Barakat, Chadi et al

in ICCCN '09 Proceedings (2009, August)

We address the issue of asserting the accuracy of coordinates advertised by nodes of Internet coordinate systems during distance estimations. Indeed, some nodes may lie deliberately about their ... [more ▼]

We address the issue of asserting the accuracy of coordinates advertised by nodes of Internet coordinate systems during distance estimations. Indeed, some nodes may lie deliberately about their coordinates to mount various attacks against applications and overlays. Our proposed method consists in two steps: 1) establish the correctness of a node’s claimed coordinate (which leverages our previous work on securing the coordinates embedding phase using a Surveyor infrastructure); and 2) issue a time limited validity certificate for each verified coordinate. Validity periods are computed based on an analysis of coordinate inter-shift times observed on PlanetLab, and shown to follow a long-tail distribution (lognormal distribution in most cases, or Weibull distribution otherwise). The effectiveness of the coordinate certification method is validated by measuring the impact of a variety of attacks on distance estimates. [less ▲]

Detailed reference viewed: 24 (0 ULg)
Full Text
Peer Reviewed
See detailDo Higher Education syllabi and oral course introduction affect student’s motivation to study ? Measuring the impact of syllabi from specifically trained Faculties on students’ perceptions of controllability, course value and competency
Leduc, Laurent ULg

Conference (2009, August)

As defined by Altman and Cashin (1992), “the primary purpose of a syllabus is to communicate to one’s students what the course is about, why the course is taught, where it is going, and what will be ... [more ▼]

As defined by Altman and Cashin (1992), “the primary purpose of a syllabus is to communicate to one’s students what the course is about, why the course is taught, where it is going, and what will be required of the students for them to complete the course with a passing grade”. According to several authors, one of the functions of the syllabus is to motivate students: it “conveys enthusiasm for the subject and sparks student interest and motivation” (Hammons & Shock, 1994), “warm syllabi explain expectations in a clear and friendly fashion, encourage and motivate students” (Slattery & Carlson, 2005), “the course syllabus should generate interest and motivate students to take responsability to learn the contents of the course” (Johnson, 2006), “we studied teachers who have enormous success in helping and encouraging their students to achieve remarkable learning and found they usually produce a certain kind of syllabus” (Bain, 2004). Some researchers (Thompson, 2007) have also pointed out different oral strategies used by teachers when presenting their courses for the first time to students in order to positively affect them on this aspect. But the question is: can this very early written / oral transmission of information really impact students’motivation for learning in some courses? In the University of Liège, professors have to submit every year for each of their courses a one page (at least) standardized syllabus (called engagement pédagogique). In addition, they usually start their first lesson with introductory speeches that plays the same role. In 2008, IFRES (Institute for Training and Research in Higher Education) has delivered pedagogical training and guidelines to new faculties in order to promote these two kinds of motivating communications especially with their freshmen and sophomores audiences. As the person in charge with that training, I focused on Viau’s model of motivation dynamics (1997). The specific suggestions I gave consisted in taking into account various kinds of students’ perceptions (1) of competency (“a perception that a student has about him(her)self and through which he/she assesses his/her ability to suitably accomplish an activity that he/she is not sure to carry off”), (2) of controlability (“the perception of the control that a student has on the course of an activity and on its consequences”) and (3) of activities value (“the opinion that a student expresses on the interest and the usefulness of a pedagocical activiy according to the goals he/she pursues”) in one’s written and oral communication with students about pedagogical and practical aspects of a course. At the beginning of the academic year following the delivery of those guidelines and training sessions, the wording of syllabi and oral speeches produced by 10 of those new faculties was analysed from their motivational potential’s point of view. In the same time, questionnaires were submitted to the 1400 students of their 12 introductory courses, in order to investigate the corollary impact of those information transmissions on learners’ motivational dynamics. Before and after their reception of the oral and written messages from their respective teachers, student’s levels of perception concerning the value of the course, concerning their own competency to succeed in it and concerning their controlability, have been compared in order to measure hypothetical gains due to syllabi and face-to-face course introduction. We have studied relations between students who have actualy read / not read syllabi, or who have actually listened / not listened to oral presentation of the course, and their level of perception of Viau’s three motivational factors. Other relations between variables like students’ perceptions of their own teacher (resulting from the content and tone of his/her messages) or the presence / absence of a rationale for some particular items of information have also been studied. [less ▲]

Detailed reference viewed: 62 (1 ULg)
Full Text
Peer Reviewed
See detailInnovative development and validation of an HPLC/DAD method for the qualitative and quantitative determination of major cannabinoïds in cannabis plant material
De Backer, Benjamin ULg; Debrus, Benjamin ULg; Lebrun, Pierre ULg et al

Poster (2009, August)

GC is commonly used for the analysis of cannabis samples, e.g. in forensic chemistry. However, as this method is based on heating of the sample, acidic forms of cannabinoids are decarboxylated into their ... [more ▼]

GC is commonly used for the analysis of cannabis samples, e.g. in forensic chemistry. However, as this method is based on heating of the sample, acidic forms of cannabinoids are decarboxylated into their neutral counterparts. Converely, HPLC permits the determination of the original composition of plant cannabinoids by direct analysis. Several HPLC methods have been described in the literature, but most of them failed to separate efficiently all the cannabinoids or were not validated according to general guidelines. By use of an innovative methodology for modelling chromatographic responses, a simple and accurate HPLC/DAD method was develop [less ▲]

Detailed reference viewed: 236 (65 ULg)
Peer Reviewed
See detailDamping material characterization and modeling: an industrial case-study
Poncelet, Fabien ULg; Bernay, Bruno; Kerschen, Gaëtan ULg et al

in International Design Engineering Technical Conferences & Computers and Information in Engineering Conference (IDETC/CIE 2009), San Diego, 2009 (2009, August)

Turbojet engines contain potential nonlinearity sources such as geometric nonlinearities due to the slenderness and the length of modern blades, contacts between the blades and the shrouds, friction in ... [more ▼]

Turbojet engines contain potential nonlinearity sources such as geometric nonlinearities due to the slenderness and the length of modern blades, contacts between the blades and the shrouds, friction in the connections, and material nonlinearities. This paper focuses on the damping material which can be found in some stator stages of low-pressure compression parts. This material makes the shroud and all the blades of the stage interdependent, providing damping and fluid vein airtightness. The objective is to propose a characterization and a numerical modeling methodology that could easily be integrated within an industrial process. Nonlinearity characterization tests, based on the Restoring Force Surface method, are presented as well as viscoelastic characterization. Finally the proposed viscoelastic modeling, based on the Modal Strain Energy method, is validated against experimental data. [less ▲]

Detailed reference viewed: 79 (7 ULg)
Full Text
See detailGenetic evaluation considering phenotypic data and limited molecular information using a novel equivalent model: Case study using effect of the mh locus on milk production in the dual-purpose Belgian Blue breed
Colinet, Frédéric ULg; Gengler, Nicolas ULg

Conference (2009, August)

The introduction of molecular information into genetic evaluation systems is currently under research. Based on an equivalent method, we developed from existing theory a new alternative strategy for the ... [more ▼]

The introduction of molecular information into genetic evaluation systems is currently under research. Based on an equivalent method, we developed from existing theory a new alternative strategy for the prediction of gene effects and especially their smooth integration into genetic evaluations. Underlying hypothesis were based on the idea that knowledge of genotypes will not affect overall additive genetic variance but only change expected values of genetic effects for animals with known genotypes. However, all animals could not be genotyped. Thus, the developed equations were modified to allow the integration of the known genotype for a portion of the population. This strategy was tested for the mh locus (responsible for the double-muscling phenotype) in dual-purpose Belgian Blue cattle. The genotype was determined for 123 bulls and 1940 cows (+/+ 19.5, mh/+ 39.3 and mh/mh 41.2%). These animals had 11,150 daughters with test-day (TD) records. The genotypes were incorporated into a modified genetic evaluation based on the current routine multi-trait multibreed test-day model used in the Walloon Region (Belgium). Data used included 12,829,309 TD records for 689,057 dairy cows in production. The pedigree file contained 1,606,024 animals (cows with TD records and ancestors). Computation of the modified mixed model equations was done solving iteratively two systems of equations, one for the polygenic effects and one for the gene effect until the relative differences in the gene solutions were below 10-5. A linear extrapolation was also used to speed up the convergence of gene effects. As expected, the mh locus exerts negative effects on milk production traits. For the first three lactations, the average estimated allelic substitution effects were -158.7 kg milk, -8.93 kg fat and -5.64 kg protein per lactation (305 days). [less ▲]

Detailed reference viewed: 18 (11 ULg)
Peer Reviewed
See detailAphid-ant mutualism: How do aphids focus ant foraging?
Verheggen, François ULg; Detrain, Claire; Diez, Lise et al

Conference (2009, August)

The mutualistic relationships that occur between myrmecophilous aphids and ants are based on the rich food supply that honeydew represents for ants and on the protection they provide against aphid natural ... [more ▼]

The mutualistic relationships that occur between myrmecophilous aphids and ants are based on the rich food supply that honeydew represents for ants and on the protection they provide against aphid natural enemies. While aphid predators and parasitoids actively forage for oviposition sites by using aphid semiochemicals, scouts of aphid-tending ant species would also benefit from locating honeydew resources by orienting toward aphid pheromone sources. The present study aims to identify the chemical factors that attract ants and that maintain their mutualistic relationships with aphids. The perception and behavioral impact of Aphis fabae alarm pheromone, namely (E)-β-farnesene, on Lasius niger were firstly investigated using electroantennography and a four-arm olfactometer. Aphis fabae honeydew sugar composition was subsequently analyzed while the foraging and recruiting behaviour of L. niger scouts towards each of the identified sugars was studied. Clear electrical depolarisations were observed from L. niger scout antennae to stimulations of A. fabae alarm pheromone. Scouts were significantly attracted toward (E)-β-farnesene in the four-arm olfactometer, suggesting for the first time that the latter compound is a key chemical in the establishment of the mutualism. Aphis fabae honeydew consisted of 9 identified mono-, di- and tri-saccharides and 8 hydrocarbons that could not be identified. The main identified sugars were sucrose, fructose, glucose and melezitose. L. niger scouts showed the following drinking preferences for the tested sugars: melezitose = sucrose = raffinose > glucose = fructose > maltose = trehalose = melibiose = xylose, with a recruitment launched toward the first three sugars. Therefore, ant scouts may use aphid semiochemicals to locate at distance an aphid colony and subsequently estimate honeydew quality by tasting it before recruiting conspecifics and establishing a mutualistic relationship. [less ▲]

Detailed reference viewed: 178 (12 ULg)
Full Text
See detailComparison of bovine colostrum whey and defatted bovine colostrum supplementation on piglet post-weaning growth check
Boudry, Christelle ULg; Gauthier, Vincent ULg; Buldgen, André

in Book of the Abstracts of the 60th Annual Meeting of the European Association for Animal Production (2009, August)

Detailed reference viewed: 31 (3 ULg)
Peer Reviewed
See detailBiting midges (Ceratopogonidae: Culicoïdes) in Belgium: a comparison between indoor and outdoor trapping in cattle and sheep farms.
Losson, Bertrand ULg; Robert, Nancy ULg; Paternostre, Julien ULg et al

Conference (2009, August)

Bluetongue, a vector born disease of ruminants, was identified for the first time in Northern Europe in 2006. The vectors are insects of the family Ceratopogonidae, genus Culicoides. In Belgium, no recent ... [more ▼]

Bluetongue, a vector born disease of ruminants, was identified for the first time in Northern Europe in 2006. The vectors are insects of the family Ceratopogonidae, genus Culicoides. In Belgium, no recent data were available about the biology of these insects including their feeding habits and behaviour. The present study was carried out in order to evaluate the indoor and outdoor activity of these Diptera in 5 different cattle or sheep farms in 2008. Two sheep and 3 cattle farms were selected in the Province of Luxembourg, Belgium. In each farm 2 Onderstepoort Veterinary Institute (OVI) traps were installed respectively inside and outside the animal accommodation. Trapping was carried out twice a week from 17:00 until 24:00.The collecting vials were replaced every hour. A portable suction trap (BackTrap® U.S.A) was used twice on each visit to collect midges on the animals. In each farm the study was carried out for 6 successive weeks, 2 farms being monitored together. The study began on July 28th and ended on November 30th 2008. A total of 2591 culicoides were trapped. A majority of those (88.76%) were trapped indoors whereas 10.03% were trapped outdoors and 1.21% directly on the animals. The ambient temperature had a marked effect very few culicoides being trapped below 13°C. Three main species or species complex were identified both indoors and outdoors: C. obsoletus/scoticus, C. dewulfi, C. chiopterus. They represented 98.93% and 85.03% indoors and outdoors respectively. On the animals only C. obsoletus/scoticus and C. dewulfi were found. [less ▲]

Detailed reference viewed: 170 (51 ULg)
Full Text
See detailEffect of bovine colostrums of 1st, 2nd and 3rd milking on growth performance and the immune system of newly-weaned piglets after an E. coli LPS challenge
Gauthier, Vincent ULg; Boudry, Christelle ULg; Buldgen, André

in Book of the Abstracts of the 60th Annual Meeting of the European Association for Animal Production (2009, August)

Detailed reference viewed: 31 (8 ULg)
Full Text
Peer Reviewed
See detailspecialist committee V.3 entitled "Fabrication Technology" of the 17th International Ship and Offshore Structure Congress
Okada, T.; Caprace, Jean-David ULg; Estefen, S. F. et al

(2009, August)

The committee shall give an overview about new developments in the field of ship and offshore materials and fabrication techniques with focus on trends which are highly relevant for practical applications ... [more ▼]

The committee shall give an overview about new developments in the field of ship and offshore materials and fabrication techniques with focus on trends which are highly relevant for practical applications in the industry in the recent and coming years. Particular emphasis shall be given to the impact of welding and corrosion protection techniques on structural performance, on the development of lighter structures and on computer and IT technologies and tools, which are meant to link design and production tools and to support efficient production. [less ▲]

Detailed reference viewed: 65 (6 ULg)
Full Text
See detailGenetic evaluation considering phenotypic data and limited molecular information using a novel equivalent model: Case study using effect of the mh locus on milk production in the dual-purpose Belgian Blue breed
Colinet, Frédéric ULg; Gengler, Nicolas ULg

in Book of Abstracts of the 60th Annual Meeting of the European Association for Animal Production (2009, August)

The introduction of molecular information into genetic evaluation systems is currently under research. Based on an equivalent method, we developed from existing theory a new alternative strategy for the ... [more ▼]

The introduction of molecular information into genetic evaluation systems is currently under research. Based on an equivalent method, we developed from existing theory a new alternative strategy for the prediction of gene effects and especially their smooth integration into genetic evaluations. Underlying hypothesis were based on the idea that knowledge of genotypes will not affect overall additive genetic variance but only change expected values of genetic effects for animals with known genotypes. However, all animals could not be genotyped. Thus, the developed equations were modified to allow the integration of the known genotype for a portion of the population. This strategy was tested for the mh locus (responsible for the double-muscling phenotype) in dual-purpose Belgian Blue cattle. The genotype was determined for 123 bulls and 1940 cows (+/+ 19.5, mh/+ 39.3 and mh/mh 41.2%). These animals had 11,150 daughters with test-day (TD) records. The genotypes were incorporated into a modified genetic evaluation based on the current routine multi-trait multibreed test-day model used in the Walloon Region (Belgium). Data used included 12,829,309 TD records for 689,057 dairy cows in production. The pedigree file contained 1,606,024 animals (cows with TD records and ancestors). Computation of the modified mixed model equations was done solving iteratively two systems of equations, one for the polygenic effects and one for the gene effect until the relative differences in the gene solutions were below 10-5. A linear extrapolation was also used to speed up the convergence of gene effects. As expected, the mh locus exerts negative effects on milk production traits. For the first three lactations, the average estimated allelic substitution effects were -158.7 kg milk, -8.93 kg fat and -5.64 kg protein per lactation (305 days). [less ▲]

Detailed reference viewed: 41 (16 ULg)
See detailHow to combine pedigree and marker information into a single estimator for the calculation of relationships?
Bömcke, Elisabeth ULg; Soyeurt, Hélène ULg; Szydlowski, Maciej et al

in Book of Abstracts of the 60th Annual Meeeting of the European Association for Animal Production (2009, August)

Relationship coefficients are particularly useful to improve genetic management of endangered populations. These coefficients are traditionally based on pedigree data. In case of incomplete or missing ... [more ▼]

Relationship coefficients are particularly useful to improve genetic management of endangered populations. These coefficients are traditionally based on pedigree data. In case of incomplete or missing pedigree, they are replaced by coefficients calculated from molecular data when this information is available. However, genotyping a complete population for a sufficient number of markers can be impossible. The main objective of this study was therefore to develop a new method to estimate relationship by combining molecular with pedigree data. It will be useful for specific situations, where neither pedigree nor molecular data are complete. In a companion paper, the compatible coefficients were determined. In this study, based on simulations of pedigree and marker data, the method to combine the selected coefficients was determined. Various parameters were taken into account in the model: number and quality of the marker (e.g. marker informativeness), mutation rate, quality of the pedigree (e.g. generation-equivalents), … The combined estimator has several advantages. Especially, negative relationship values obtained in literature with molecular-based estimators in case of small inbred populations can be avoided. In conclusion, this combined estimator was originally developed for the management of an endangered horse population. It should also be a promising alternative to traditionally used estimators, e.g. for the management of small and/or rare breeds; especially in case of inbred populations, with both incomplete pedigree and partial molecular information. [less ▲]

Detailed reference viewed: 72 (8 ULg)
Full Text
See detailAn integrated view of technical, economic and social factors influencing sustainabiligy of sixteen local European cattle breeds
Martin-Collado, D.; Diaz, C.; Choroszy, Z. et al

in Book of Abstracts of the 60th Annual Meeting of the European Association for Animal Production (2009, August)

This study aims to identify common patterns influencing dynamics and sustainability of 16 local European cattle breeds from Belgium, Estonia, Finland, France, Holland, Ireland, Italy and Spain. A broad ... [more ▼]

This study aims to identify common patterns influencing dynamics and sustainability of 16 local European cattle breeds from Belgium, Estonia, Finland, France, Holland, Ireland, Italy and Spain. A broad range of factors related to technical (e.g. farm size, cows/ha, land ownership), economic (e.g. cattle importance on farm and family income, type of market) and social (e.g. farmers and stakeholders attitude) aspects were surveyed on a total of 401 farms. Discriminant Analysis has been used to study the implications that heterogeneity within and across countries and breeds may have in making inferences in across country or breed analyses. Thus, farms were classified according to country and breeds. Then the objective was to evaluate how all factors available allow us to distinguish such classes. The analyses provided the percentage of observations (farms) that should not be included in the pre-defined groups (country and breed) according to the variables considered. When only economic variables were considered in the analyses, 36% and 59% of farms were incorrectly assigned to their country and breed, respectively. However, considering technical variables the proportions went down to 33% and 45%. Finally, when both groups of variables were considered 20% and 35% of farms were incorrectly assigned. To what extent these mismatches may allow us to identify general patterns has to be evaluated. [less ▲]

Detailed reference viewed: 72 (11 ULg)
Full Text
See detailHiggs Exclusive Production
Dechambre, Alice ULg

Poster (2009, August)

Detailed reference viewed: 16 (2 ULg)
Full Text
Peer Reviewed
See detailLiquid load point measurement in a reactive distillation packing by x-ray tomography
Aferka, Saïd ULg; Viva, Aurora ULg; Brunazzi, Elisabetta et al

Poster (2009, August)

Detailed reference viewed: 56 (11 ULg)
See detailCalculate relationships using pedigree and marker information – What to combine into a single estimator?
Bömcke, Elisabeth ULg; Szydlowski, Maciej; Gengler, Nicolas ULg

in Book of Abstracts of the 60th Annual Meeeting of the European Association for Animal Production (2009, August)

The knowledge of relationships among individuals is an important topic in all fields of modern genetics, from selection to conservation. Estimation of relationships was traditionally based on pedigree ... [more ▼]

The knowledge of relationships among individuals is an important topic in all fields of modern genetics, from selection to conservation. Estimation of relationships was traditionally based on pedigree data. Today, molecular data can replace pedigrees. Numerous methods already exist. However, genotyping a complete population for a sufficient number of markers can be impossible, e.g., in case of local and/or rare breeds. Therefore, the idea was to combine these 2 sources of information into a new single relationship estimator. Based on simulations, the aim of this study was to determine what could be combined. Following the principle that things have to be similar to be combined, we compared first two coefficients that have the advantage to be similarly defined: the additive relationship coefficient (axy) calculated from pedigrees and the total allelic relationship (taxy) obtained from markers. The similarity between these two coefficients was measured by means of linear regression and correlations. In order to highlight the influence of inbreeding, Wright relationship coefficient (rped,xy) were also compared to taxy transformed into rmol,xy. The results showed that the correlation increases when the values are made independent from inbreeding. If the pedigree coefficients are considered as the true value, both molecular coefficients tended to overestimate the relationship among individuals. It can be expected because they do not distinguish identical-by-state and identical-by-descendent alleles. The influence of marker quality was also highlighted. In all cases, the correlation coefficient increased when only the more informative loci were used. Uninformative genetic markers potentially making animals appear more related than they were. [less ▲]

Detailed reference viewed: 52 (10 ULg)
Full Text
Peer Reviewed
See detailNetwork Virtualization Architecture: Proposal and Initial Prototype
Schaffrath, Gregor; Werle, Christoph; Papadimitriou, Panagiotis et al

in ACM SIGCOMM Workshops Proceedings (2009, August)

The tussle between reliability and functionality of the Internet is firmly biased on the side of reliability. New enabling technologies fail to achieve traction across the majority of ISPs. We believe ... [more ▼]

The tussle between reliability and functionality of the Internet is firmly biased on the side of reliability. New enabling technologies fail to achieve traction across the majority of ISPs. We believe that the greatest challenge is not in finding solutions and improvements to the Internet's many problems, but in how to actually deploy those solutions and re-balance the tussle between reliability and functionality. Network virtualization provides a promising approach to enable the coexistence of innovation and reliability. We describe a network virtualization architecture as a technology for enabling Internet innovation. This architecture is motivated from both business and technical perspectives and comprises four main players. In order to gain insight about its viability, we also evaluate some of its components based on experimental results from a prototype implementation. [less ▲]

Detailed reference viewed: 82 (1 ULg)
See detailAssociations among BCS, milk production and days-open in Walloon primiparous dairy cows
Laloux, Laurent; Bastin, Catherine ULg; Gillon, Alain ULg et al

in Book of abstracts of the 60th annual meeting of the European Association for Animal Production (2009, August)

Detailed reference viewed: 32 (11 ULg)
See detailEntanglement of random localized and multifractal states
Martin, John ULg; Giraud, Olivier; Georgeot, Bertrand

Conference (2009, August)

Detailed reference viewed: 7 (0 ULg)
Full Text
Peer Reviewed
See detailCommissioning case study of a cooling ceiling system
Fonseca, N.; Hannay, J.; Andre, Philippe ULg

in Proceedings Building Simulation 2009: BS'09, Glasgow, August 2009 (2009, August)

As a part of commissioning case study, the cooling ceiling system of a commercial building in Brussels is experimentally evaluated by means a functional test procedure and a detailed thermal model of this ... [more ▼]

As a part of commissioning case study, the cooling ceiling system of a commercial building in Brussels is experimentally evaluated by means a functional test procedure and a detailed thermal model of this system. This one has to be used on situ, as diagnosis tool in commissioning process in order to determine the main parameters of the cooling ceiling systems. Due to the extended gazing surface of the building, the problem is the overheated zones submitted to the expected solar heat gain. The subsystems considered for commissioning process includes the fenestration, ventilation and cooling ceiling system. The interaction and individual operation conditions of each system are evaluated. A Functional Performance Testing guide (FPT) for cooling ceiling commissioning process is proposed. [less ▲]

Detailed reference viewed: 18 (2 ULg)
Peer Reviewed
See detailIncidence of winter feeding, parasitism, and housing on the growth performances of dairy heifers in Wallonia.
Picron, Pascale ULg; Foridmont, Eric

Conference (2009, August)

With a replacement rate of 30 % in dairy herds, it is essential to ensure the best rearing conditions of young cattle for the development of future dairy cows. The aim of this study was to quantify the ... [more ▼]

With a replacement rate of 30 % in dairy herds, it is essential to ensure the best rearing conditions of young cattle for the development of future dairy cows. The aim of this study was to quantify the incidence of key management aspects such as housing, parasitism and winter feeding on growth performances of dairy heifers. Thirty farmers (774 heifers), located in the main dairy regions in Wallonia, participated to the survey. Development and growth were determined using Heart Girth (HG) measurements and compared with a French reference. Feed intake was estimated from the French Fill Unit System. A prediction equation of BW from HG, related to the genetic features of Walloon dairy herds (n = 256, BW = 0,0005 HG2.6161, r² = 0,96), was developed. The results suggested that 80 % of the breeders could pretend to an early calving, at 24 – 26 month of age. For half of the others, a lack of net energy supply in the diet could explain a growth delay. On the other hand, the protein supply was too high in 90 % of the diets compared to the animal’s requirement. This was due to the large utilization of grass silage. Ventilation efficiency, estimated by the difference of hygrometry inside and outside the barns, was not optimal in 40 % of the farms. This suggested that heifers were often accommodated in less adapted barns. The parasitism management did not differ fundamentally from one farm to another. Globally, heifers were treated systematically (1 to 4 treatments/year) and did not acquire a sufficient immunity at the end of the first grazing period (estimated by blood pepsinogen measurement). They should be treated again for the next grazing season. Knowing that the treatment cost varied between 5 and 21 € in drugs per heifer and per year, a better parasitism management in the future should improve the economical and ecological performance. [less ▲]

Detailed reference viewed: 23 (14 ULg)
Full Text
Peer Reviewed
See detailTransfer of heroin profiling method from conventional GC-MS to Fast-GC-MS and UHPLC-MS/MS
Debrus, Benjamin ULg; Broséus, Julian; Guillarme, Davy et al

Conference (2009, August)

Detailed reference viewed: 34 (5 ULg)
Full Text
Peer Reviewed
See detailPotential of Dried Egg Yolk as a Source of Immunoglobulins to Control Salmonella in the Gastrointestinal Tract of the Broiler Chicken
Marcq, Christopher ULg; Portetelle, Daniel ULg; Chalghoumi, RAJA ULg et al

in 17th European Symposium on Poultry Nutrition : Proceedings & Abstracts (2009, August)

Egg yolk immunoglobulins (IgY) are considered as a promising tool of establishing passive immunity against enteric pathogens (e.g. Salmonella) in poultry (Kovacs-Nolan and Mine, 2005). In our previous ... [more ▼]

Egg yolk immunoglobulins (IgY) are considered as a promising tool of establishing passive immunity against enteric pathogens (e.g. Salmonella) in poultry (Kovacs-Nolan and Mine, 2005). In our previous works, in-feed incorporation of freeze-dried yolk powder (FYP) improved performances of Salmonella-infected broilers (Marcq et al., 2009). Nevertheless, no extra value could be attributed to the presence of specific IgY when a comparison was done between impact of hyperimmune or non immune FYP both concerning growth performances and Salmonella infection. We hypothesized that these inconclusive in vivo results were related to the sensitivity of IgY to gastrointestinal conditions. Egg yolks with high IgY titers directed against Salmonella Enteritidis and Typhimurium were obtained from laying hens immunized as previously described (Chalghoumi et al., 2008). Three feed additives derived from these eggs were produced: FYP, spray-dried yolk powder (SYP), and freeze-dried water-soluble fraction of yolk powder (WSFP). A force-feeding assay was realized on these additives with 48 five-week-old males Ross broiler chicken (Salmonella spp.-free status). Survival of undigested IgY and bioactive Fab fragments was evaluated in the intestinal tract by ELISA. Statistical analyses were done using GLM procedure of Minitab 15.1. Software. Differences were considered significant when P<0.05. As a result of the digestive process, the levels of total and specific undigested IgY found throughout the intestine were dramatically reduced for the three additives. For FYP, no difference was observed with intestinal contents of control animals (P>0.05) and for WSFP, which correspond to semi-purified IgY, the immunological activity reached the same level than that for SYP (P>0.05) whereas its initial level was almost ten times higher. The results suggest a protective effect of whole yolk on IgY with SYP but such effect was not observed with FYP. High levels of Fab fragments were identified in intestinal contents, highlighting the importance of protein digestion in the digestive tract and especially pepsin digestion. These Fab fragments conserve their immunological functionality and remained detectable in all intestinal segments including the caecum which represents the major site of Salmonella infection in poultry. These results can explain our previous challenge data and reveal that a protection treatment should be applied to dried egg yolk to improve the resistance of IgY to gastrointestinal conditions in broilers. [less ▲]

Detailed reference viewed: 130 (31 ULg)
Peer Reviewed
See detailMolecular detection of kobuviruses and recombinant noroviruses in cattle in continental europe
Mauroy, Axel ULg; Scipioni, Alexandra; Mathijs, Elisabeth et al

Poster (2009, August)

Introduction and Objectives Noroviruses (NoV) and Kobuviruses (KoV), belong to the family Caliciviridae genus Norovirus and to the family Picornaviridae genus Kobuvirus respectively. Both have a single ... [more ▼]

Introduction and Objectives Noroviruses (NoV) and Kobuviruses (KoV), belong to the family Caliciviridae genus Norovirus and to the family Picornaviridae genus Kobuvirus respectively. Both have a single stranded positive-sense RNA genome. They both infect the gastrointestinal tract of different animal species including human beings. Two NoV and one KoV prototype strains have been already identified in the bovine (Bo) species: Jena virus (JV) and Newbury 2 (NB2) for BoNoV; U1 for BoKoV. Genogroup (G) III gathers all BoNoV strains and is further subdivided into two genotypes where viruses genetically related to JV and NB2 are assigned to the genotype 1 and 2 respectively. Recombination is a common event in NoV and is usually reported near the overlapping region between open reading frame (ORF) 1 (end of the polymerase gene) and ORF2 (beginning of the single capsid protein gene). Two GIII.1/GIII.2 BoNoV recombinant strains have been described including the recombinant strain Bo/NoV/Thirsk10/00/UK (Thirsk10), identified in the year 2000 in Great Britain. To our knowledge, no other genetically related strains have been reported since [1]. Bovine KoV were detected by RT-PCR in stool samples of healthy calves from Japan, in samples from diarrhoeic calves from Thailand [2] and were also identified very recently in Hungary. Bovine NoV prevalence studies performed in different areas have shown the predominance of the GIII.2 genotype but this could reflect a GIII.1 specificity failure in the RT-PCR methods. The aim of this study was to screen cattle stool samples with two primer sets targeting the polymerase and the capsid region. The primer pair targeting the capsid region was designed based on a GIII.1 sequence in order to improve their detection. Materials and methods A stool bank (n=300) was created with calf and young stock diarrhoeic samples from five provinces in Belgium (Hainaut, Liège, Namur, Luxembourg, Walloon Brabant) and received from a Belgian diagnostic laboratory through the year 2008. Viral RNA extraction was performed and one step RT-PCR was carried out on 2 µl of each viral RNA extraction using the CBECu-F/R primers (nucleotidic position on JV: 4543-4565 and 5051-5074) and a primer pair, named AMG1-F/R, designed from the JV genomic sequence (F: tgtgggaaggtagtcgcgaca, nucleotidic position on JV: 5012-5032; R: cacatgggggaactgagtggc, 5462-5482). Combined approaches with the CBECu-F and AMG1-R primers, additional internal primers (F2: atgatgccagaggtttcca, position on JV: 4727-4745; R2: gcaaaaatccatgggtcaat, 5193-5211) or CBECu-F and a polyTVN-linker were also carried out on some positive samples. RT-PCR products were directly sequenced twice or cloned before sequencing. Sequencing was carried out at the GIGA facilities of the University of Liège with BigDye terminator kit. Nucleotidic sequences were analysed with the BioEdit software. Nucleotidic similarity with the NCBI genetic database was assessed using the BLAST tool. Phylogenetic inference was performed with the MEGA software. Phylogenetic tree was constructed by neighbour-joining analysis where evolutionary distances were computed using the Maximum Composite Likelihood method. The confidence values of the internal nodes were calculated by performing 1,000 replicate bootstrap values. Genetic recombination was analysed with the Simplot software and the Recombinant Detection Program. Results Twenty-eight positive samples were identified in the 300 samples: 24 and 23 BoNoV sequences with the CBECu and AMG1 primer pairs respectively, giving a combined apparent molecular prevalence of 9.33% (CI 95%: [9.27; 9.38%]). Using BLAST, three sequences amplified with CBECu-F/R (BV164, BV362, and BV416) were genetically more related to the GIII.1 JV and Aba Z5/02/HUN sequences and one (BV168) to the recombinant strain Thirsk10. The others were genetically related to GIII.2 BoNoV. All the sequences amplified with AMG1-F/R but one genetically matched with GIII.2 BoNoV. The AMG1-amplicon of the BV416 sample matched with the recombinant strain Thirsk10. A 2410 nucleotide (nt)-large genomic sequence was obtained from BV416 with CBECu-F/TVN linker, which was a recombinant sequence genetically related to the Thirsk10 strain. This result was confirmed by phylogenetic and by Simplot analysis. The potential recombination breakpoint of BV416 was located near or within the ORF1/ORF2 overlapping region depending on the bioinformatic program used. Comparison between its different genomic regions and the JV, Newbury2 and Thirsk10 genomic sequences showed that the polymerase region of BV416 was genetically more related to the GIII.1 than to the recombinant strain. F2/R2 amplicons from BV164 and BV362 were genetically related to GIII.2 and GIII.1 BoNoV respectively. Surprisingly, three amplicons obtained with the combined primer pair CBECu-F/AMG1-R on BoNoV positive samples at the expected molecular weight did not match genetically with BoNoV but did so with different genomic regions of the BoKoV U1 strain (86%, 92% and 93% of nucleotidic identity by BLAST for BV228, 250 and 253 respectively on sequences of about 500-700 nt). Discussion and conclusions In this study, very few genotype 1 BoNoV were identified (BV362 was the sole GIII.1 sequence obtained in the ORF1/2 overlapping region), confirming results reported in a previous study on BoNoV infection in the same area [3]. A recombinant status was clarified for BV416. Co-infection with GIII.1 and GIII.2 BoNoV was evidenced in the BV164 sample but could not be excluded in the BV168 sample because an overlapping sequence could not be obtained, although genetic analyses related its CBECu-F/R sequence to the Thirsk10 sequence. These results raise issues about the genetic characterization by primers targeting either the polymerase region or the capsid region. By exclusion of the potential recombination breakpoint, these primers can lead to the misclassification of strains and to the underestimation of circulation of recombinant strains. Multiple alignment and bioinformatic analysis performed with JV, Aba Z5, NB2, Thirk10 and BV416 sequences has suggested a recombination breakpoint for BV416 located near the ORF1/ORF2 overlapping region and one quite similar to those determined for the Thirsk10 strain. Nevertheless the greater similarity of BV416 with the Jena and Aba Z5 viruses in the polymerase region and the exact localization of the recombination breakpoint suggest another origin or genetic evolution than the Thirsk10 strain. The identification, in geographically and temporally different samples, of sequences that could be genetically related to the recombinant Thirsk10 strain suggests at least that Thirsk10-related strains circulate in the north European cattle population. Furthermore, the low detection rate of GIII.1 BoNoV could reflect an evolution of the viral population pattern to the benefit of the Thirsk10-related and genotype 2 strains in the studied region. To date, BoKoV-related sequences have been very rarely identified, and in only three countries (namely Japan, Thailand and Hungary). Their detection in another European country suggests their wider distribution, making them at least emerging bovine viruses in the studied region. In conclusion, prevalence studies on BoNoV using RT-PCR assays, even targeting relatively well conserved genomic regions, need to take into account in their protocols both their high genetic variability and their relative genetic proximity with other viruses, in order to maximize sensitivity and specificity. This study also showed that recombination events could lead to emerging strains in the BoNoV population, as already found for HuNoV. The molecular detection of bovine kobuvirus-related sequences in the studied area extends the distribution of these viruses in Europe. [less ▲]

Detailed reference viewed: 48 (0 ULg)
Full Text
See detailExpressing female fertility in the Walloon region of Belgium: how to do?
Vanderick, Sylvie ULg; Bastin, Catherine ULg; Gengler, Nicolas ULg

Conference (2009, August)

Since September 2007, the Walloon Region of Belgium has used a genetic evaluation system for pregnancy rate in Holsteins and has participated in 3 of the 5 MACE trait INTERBULL runs for female fertility ... [more ▼]

Since September 2007, the Walloon Region of Belgium has used a genetic evaluation system for pregnancy rate in Holsteins and has participated in 3 of the 5 MACE trait INTERBULL runs for female fertility. In order to define general way of female fertility expression, a principal component analysis was carried out on six published foreign female fertility indexes. Results of were used to compute a direct female fertility index with the INTERBULL international female fertility proofs available on the Walloon scale. An indirect female fertility index was also developed in order to increase reliability of young bulls. Approximate procedure based on selection index was used to combine both indexes in an overall index called combined female fertility index. This index was highly correlated with the direct female fertility index (.96) and the first principal component (.85), therefore it was considered as good expression of female fertility. Moreover, this allowed recovering 4,019 INTERBULL bulls with a publishable female fertility index. [less ▲]

Detailed reference viewed: 13 (3 ULg)
Full Text
See detailBLUESEL - an INTERREG France-Wallonie-Vlaanderen project aiming at the conservation and the use of the genetic heritage of the dual-purpose Blue Breeds in Belgium and Northern France
Colinet, Frédéric ULg

Poster (2009, August)

Dual-purpose Belgian Blue and North Blue cattle are mainly located on both sides of the border between France and Belgium. Even if these Belgian and French Blue breeds are related because of their common ... [more ▼]

Dual-purpose Belgian Blue and North Blue cattle are mainly located on both sides of the border between France and Belgium. Even if these Belgian and French Blue breeds are related because of their common ancestors in the former Mid and High Belgium cattle, these breeds diverged slightly under differentiated selection objectives in both countries. Within the BLUESEL project, a first aim consists to create a working group cross-border which will develop common guidelines for selection of bull dams and elite-matings for this dual-purpose Blue Breeds. This working group will create and help to conserve a common pool of bulls available for breeding in both countries. The project will also develop tools to harmonize the collection of phenotypic data (milk production and morphology). A joint genetic evaluation for production traits will be developed, adapted to the specifities of these breeds and integrating data provided by both countries. Others objectives of BLUESEL are the implementation of a technical and economical guidance of these farms and the improvement of profitability of farms through advice on management and on improvement of livestock. The valorisation of these breeds through the development of new and specific products (e.g. cheese products) is another objective. In summary, the whole project should contribute maintaining biodiversity in this cross-border region through conservation and use of animals naturally adapted. The BLUESEL project was launched in July 2008. It is conceived for four years and is supported by the European Union, the Walloon Region, the Nord-Pas-de Calais Region and the General Council of Department of Nord. [less ▲]

Detailed reference viewed: 20 (5 ULg)
Full Text
Peer Reviewed
See detailRefining the taxonomy of the Rattini tribe: a phylogeny-based delimitation of species boundaries
Pagès, Marie ULg; Chaval, Yannick; Waengsothorn, Surachit et al

Poster (2009, August)

Among mammals, rodents are recognized as the major hosts and vectors of zoonoses and represent a serious threat for human health. Because of global change, interactions between hosts and pathogens are ... [more ▼]

Among mammals, rodents are recognized as the major hosts and vectors of zoonoses and represent a serious threat for human health. Because of global change, interactions between hosts and pathogens are dramatically modified leading to new unexpected disease risks. To predict some of these, accurate identification of each rodent at specific level is needed. Among Muridae, the Rattini tribe encompasses 167 species inhabiting South East Asia, a hotspot of biodiversity facing with a growing economical development, affecting habitats, biodiversity and health but also a hot place of emerging and re-emerging diseases. Rat species were demonstrated as main hosts of pathogens but are difficult to recognize at a specific level using morphological criteria. DNA-barcoding methods appear as promising tools for accurate rat species identifications but their achievement is hampered by the need of reliable identifications as a departure. To provide a rigorous systematic framework for epidemiological surveys, we carried out a taxonomic revision of the Rattini tribe. As morphological characters are misleading, we decided to use the DNA sequence information itself as the primary information source to establish group membership and define species boundaries. We sequenced two mitochondrial and one nuclear genes from 122 rat samples to perform phylogenetic reconstructions and applied the method developed by Pons and colleagues (2006) that determines with no a priori the locations of ancestral nodes defining putative species. To name each cluster recognized as a valid species, we obtained sequence from museum holotype specimen, illustrating how huge opportunities ancient DNA analysis may offer to taxonomists. [less ▲]

Detailed reference viewed: 19 (3 ULg)
Full Text
See detailBLUESEL - an INTERREG France-Wallonie-Vlaanderen project aiming at the conservation and the use of the genetic heritage of the dual-purpose Blue Breeds in Belgium and Northern France
Colinet, Frédéric ULg

in Book of Abstracts of the 60th Annual Meeting of the European Association for Animal Production (2009, August)

Dual-purpose Belgian Blue and North Blue cattle are mainly located on both sides of the border between France and Belgium. Even if these Belgian and French Blue breeds are related because of their common ... [more ▼]

Dual-purpose Belgian Blue and North Blue cattle are mainly located on both sides of the border between France and Belgium. Even if these Belgian and French Blue breeds are related because of their common ancestors in the former Mid and High Belgium cattle, these breeds diverged slightly under differentiated selection objectives in both countries. Within the BLUESEL project, a first aim consists to create a working group cross-border which will develop common guidelines for selection of bull dams and elite-matings for this dual-purpose Blue Breeds. This working group will create and help to conserve a common pool of bulls available for breeding in both countries. The project will also develop tools to harmonize the collection of phenotypic data (milk production and morphology). A joint genetic evaluation for production traits will be developed, adapted to the specifities of these breeds and integrating data provided by both countries. Others objectives of BLUESEL are the implementation of a technical and economical guidance of these farms and the improvement of profitability of farms through advice on management and on improvement of livestock. The valorisation of these breeds through the development of new and specific products (e.g. cheese products) is another objective. In summary, the whole project should contribute maintaining biodiversity in this cross-border region through conservation and use of animals naturally adapted. The BLUESEL project was launched in July 2008. It is conceived for four years and is supported by the European Union, the Walloon Region, the Nord-Pas-de Calais Region and the General Council of Department of Nord. [less ▲]

Detailed reference viewed: 144 (17 ULg)
Full Text
See detailGeometric Study of Mixed-integer Sets from Two Rows of Two Adjacent Simplex Bases
Louveaux, Quentin ULg

Conference (2009, August)

We generalize the study of sets arising from two rows of a simplex tableau by considering bounds on the nonbasic variables. We show that new classes of facets arise that cannot be obtained from triangles ... [more ▼]

We generalize the study of sets arising from two rows of a simplex tableau by considering bounds on the nonbasic variables. We show that new classes of facets arise that cannot be obtained from triangles and quadrilaterals. Specifically, when exactly one upper bound on a non-basic variable is introduced, inequalities that can be derived from pentagons involving up to six variables also appear. [less ▲]

Detailed reference viewed: 23 (0 ULg)
See detailAurora at Earth, Jupiter and Saturn: a comparative view
Gérard, Jean-Claude ULg

Conference (2009, August)

The interaction of the solar wind with the magnetospheres of the giant planets is different from that with the terrestrial magnetosphere in several respects bearing consequences on the morphology and ... [more ▼]

The interaction of the solar wind with the magnetospheres of the giant planets is different from that with the terrestrial magnetosphere in several respects bearing consequences on the morphology and dynamics of the aurora: - the magnetospheres of the outer planets are dominated by the planetary rotation that can provide much of the energy for the processes acting within these magnetospheres. - the circulation of plasma may be driven by mass loading of the giant magnetospheres by moons and rings rather than by reconnection with the IMF. - the magnitude and orientation of the interplanetary magnetic field plays a key role in controlling the Earth’s auroral dynamics whereas the solar wind dynamic pressure appears as a key factor in triggering auroral intensification on Saturn. - The combination of imaging and spectral techniques indicates the characteristic energy of the auroral electrons is comparable on Earth and Saturn, but higher energies are associated with the Jovian aurora. As a consequence, Jupiter’s aurora appears relatively shielded from solar wind influences, except inside the auroral oval where transient bright emission has been observed following sudden compressions of the magnetosphere. The size and brightness of the main oval shows only a week dependence on solar wind conditions. By contrast, Saturn’s aurora is quite responsive to solar wind perturbations, as was observed during campaigns of concurrent observations between HST and Cassini. Auroral intensification events that are reminiscent of shock-induced Earth aurora appear to be triggered by sudden increases of the solar dynamic pressure more than by changes in the IMF orientation. However, simultaneous HST-Cassini observations indicate that localised auroral brightenings and ENA acceleration events may be observed under quiet solar wind conditions. The occurrence of substorms is a key characteristics of the Earth’s auroral dynamics. Localized auroral enhancements have also been observed on Jupiter and Saturn. They have been associated to reconnection events causing events similar to substorms. [less ▲]

Detailed reference viewed: 29 (1 ULg)
Peer Reviewed
See detailBioclimatic Architecture Design Strategies in Egypt,
Attia, Shady ULg; De Herde, André

in Proceedings of 8th International Conference on Sustainable Energy Technologies (2009, August)

In this paper, bioclimatic design strategies in vernacular Egyptian architecture have been analysed for three different climatic regions of Egypt. The climatic regions of Egypt are: hot dry, hot mild and ... [more ▼]

In this paper, bioclimatic design strategies in vernacular Egyptian architecture have been analysed for three different climatic regions of Egypt. The climatic regions of Egypt are: hot dry, hot mild and hot humid regions. The design strategies were extracted from existing vernacular architecture in each region. All of the vernacular buildings in these regions include strategies that are technically, environmentally, socially, and economically valid. However, for the last 50 years, modern buildings were depending on highly subsidized energy prices, which eventually produced obviously an architecture that is energetically and environmentally degrading. Therefore, the aim of this study is to enable architects to re-understand the lessons of tradition, because the way towards bioclimatic architecture should start by understanding vernacular architecture. The paper presents a set of bioclimatic principles addressing (1) urban morphologies, (2) building architecture and (3) vernacular architectural components. They are not intended as a set recipe that must be followed, but have been selected to show the range of bioclimatic and vernacular design strategies that exist to overcome individual problem in buildings. Finally, the study developed a comparative matrix that can support architects with the principles and strategies for bioclimatic design [less ▲]

Detailed reference viewed: 389 (1 ULg)
See detailDoes Saturn's UV aurora vary with SKR phase?
Nichols, J. D.; Cowley, S. W. H.; Clarke, J. T. et al

Conference (2009, July 27)

Detailed reference viewed: 12 (1 ULg)
Full Text
See detailBaseline data on cyanobacterial diversity near the new Princess Elizabeth Antarctic research station.
Fernandez Carazo, Rafael ULg; Namsaraev, Zorigto; Ertz, Damien et al

Poster (2009, July 27)

Detailed reference viewed: 17 (7 ULg)
See detailHST observations of Europa's atmospheric UV emission
Saur, J.; Feldman, P. D.; Strobel, D. F. et al

Conference (2009, July 27)

Detailed reference viewed: 9 (2 ULg)
See detailSaturn's equinoctial auroras
Nichols, J. D.; Gérard, Jean-Claude ULg; Grodent, Denis ULg et al

Conference (2009, July 27)

Detailed reference viewed: 7 (2 ULg)
See detailThe variability of auroral emissions on Jupiter and Saturn
Clarke; Nichols; Gérard et al

Conference (2009, July 27)

Detailed reference viewed: 2 (0 ULg)
See detailThe morphology of equatorial electron beams at Io
Jacobsen, S.; Saur, J.; Neubauer, F. M. et al

Conference (2009, July 27)

Detailed reference viewed: 9 (1 ULg)
Full Text
See detailExploring the Holocene through fossil cyanobacterial sequences from Antarctic lake sediments.
Fernandez Carazo, Rafael ULg; Waleron, Krzysztof; Hodgson, Dominic et al

Poster (2009, July 27)

Detailed reference viewed: 10 (1 ULg)
See detailObservations of jovian polar auroral filaments
Nichols; Clarke; Gérard et al

Poster (2009, July 27)

Detailed reference viewed: 4 (0 ULg)
See detailNews from outer worlds
Grodent, Denis ULg

Conference (2009, July 27)

Detailed reference viewed: 4 (0 ULg)
See detailAsset Management Forum
Bodson, Laurent ULg

Conference (2009, July 23)

Detailed reference viewed: 31 (4 ULg)
Peer Reviewed
See detailLa recherche d’une forme théâtrale pour les sans-voix
Delhalle, Nancy ULg

Conference (2009, July 17)

Detailed reference viewed: 32 (11 ULg)
Peer Reviewed
See detailIMPROVING SOIL ORGANIC CARBON (SOC) PREDICTION BY FIELD SPECTROMETRY IN BARE CROPLAND BY REDUCING THE DISTURBING EFFECT OF SOIL ROUGHNESS
Denis, Antoine ULg; Tychon, Bernard ULg; Stevens, Antoine et al

in Geoscience and Remote Sensing Symposium, 2009 IEEE International, IGARSS 2009 (2009, July 17)

The spatial estimation of Soil Organic Carbon (SOC) at large scale in outdoor condition is an important issue. It has been largely demonstrated that diffuse reflectance spectroscopic techniques, are ... [more ▼]

The spatial estimation of Soil Organic Carbon (SOC) at large scale in outdoor condition is an important issue. It has been largely demonstrated that diffuse reflectance spectroscopic techniques, are efficient for SOC determination in field conditions. However these methods are influenced by disturbing factors such as soil water content, vegetation residues and surface roughness, the later being the object of this study. Our laboratory experiments showed that the accuracy of SOC prediction from shadowed soil samples with spectroscopy techniques decreases with increasing soil shadow. In this study a new methodology using a digital camera for identifying and correcting the effect of soil shadow on field reflectance spectra measured with an Analytical Spectral Devices (ASD) during field campaign in bare crop lands has been elaborated and tested. Results showed that the proposed shadow correction method enables improving significantly SOC prediction accuracy and performs better than traditionally used methods consisting in automatic signal processing. [less ▲]

Detailed reference viewed: 92 (30 ULg)
Full Text
See detailSérologies Mycoplasma pneumoniae et Chlamydia au CHU de Liège.
HUYNEN, Pascale ULg

Conference (2009, July 16)

Detailed reference viewed: 11 (2 ULg)
Peer Reviewed
See detailDiversity management status in morocco. an exploratory stydu
El Abboubi, Manal ULg; El Kandoussi, Fatima

Conference (2009, July 16)

The purpose of this article is to explore diversity management specificities in arab countries, especially in Morocco (North Africa). We analyse organisational initiatives, managers’ perception and the ... [more ▼]

The purpose of this article is to explore diversity management specificities in arab countries, especially in Morocco (North Africa). We analyse organisational initiatives, managers’ perception and the way they mainstream diversity tools in their management. The Moroccan industry is based on two major sectors: agriculture food and textile. Those two activities represent more than 50% of the PIB, 70% of the national employment and 75% of exportations. We focus our study on those two sectors which are a pillar of the morrocan economy. Our sample consist of 30 questionnaire sent to companies that have more than 50 employees. We received 16 answers. We questioned CEOs, managers, middle managers and employees. The main contribution of the research is that moroccan leaders are aware of their responsibilities to implement and carry out diversity projects. The main topics mentioned concerns equality and gender. However, they have no skills or power to ensure that responsibilities fully. Diversity management is not included in the strategy. It remains a minor task operated mainly by the human resource department. Morrocan managers need more specific trainings and a global governmental policy to guide their actions. Employees are not well informed about their rights. Moreover, Morocco will open a free exchange zone in 2010. This is an opportunity for many international companies to invest in the country. Most of them are from Europe and USA. They are well informed about diversity management, especially gender issues. This represents a threat for Moroccan companies who feel the urgency to develop a national framework for diversity management. Our research is still under study. We are collecting more data and we aim to integrate some extra stakeholders in the sample. Mainly the government and the local communities. The fact that we interviewed only managers gives us a limited view of the diversity management status in Morocco. [less ▲]

Detailed reference viewed: 101 (9 ULg)
Peer Reviewed
See detailA Capability Approach to the European Directive on Parental Leave
Orianne, Jean-François ULg

Conference (2009, July 16)

Detailed reference viewed: 36 (7 ULg)
Full Text
See detailUnusual quantitative (co)polymer chain coupling reaction based on isoprene and cobalt complexes
Debuigne, Antoine ULg; Jérôme, Christine ULg; Detrembleur, Christophe ULg

Conference (2009, July 15)

Nowadays, progresses in medicine, biotechnology, microelectronic and many other fields are more and more sustained by the development of novel polymer materials with constantly improved properties and ... [more ▼]

Nowadays, progresses in medicine, biotechnology, microelectronic and many other fields are more and more sustained by the development of novel polymer materials with constantly improved properties and well-defined molecular parameters. In this context, we designed an innovative and very promising tool for macromolecular engineering. This technique, called Isoprene-Assisted Radical Coupling (I-ARC), allows to couple quantitatively polymer chains preformed by Cobalt-Mediated Radical Polymerization (CMRP), an efficient controlled radical polymerization system for vinyl acetate (VAc) and acrylonitrile (AN). Typically, addition of isoprene to well-defined polymers prepared by CMRP invariably leads to the quantitative coupling reaction of the chains, as assessed by the perfect doubling of the molar mass of the polymer. Importantly, the I-ARC reaction is not limited to macromolecules with low molar masses and homopolymers, contrary to the previously reported radical chains coupling methods. Indeed, when applied to diblock copolymers, I-ARC constitutes a straightforward approach for the synthesis of telechelic symmetrical ABA triblock copolymers, as illustrated by the preparation of poly(vinyl acetate)-b-poly(acrylonitrile)-bpoly(vinyl acetate) triblock copolymers and their derivatives. [less ▲]

Detailed reference viewed: 55 (9 ULg)
See detailSteel construction and sustainability
Reiter, Sigrid ULg

Conference (2009, July 10)

Detailed reference viewed: 38 (11 ULg)
Peer Reviewed
See detailProfessional acts and services rendered by psychologists : a Belgian study.
Hansez, Isabelle ULg; Mormont, Marie; Côte, Virginie

Conference (2009, July 10)

Detailed reference viewed: 10 (1 ULg)
Full Text
See detailLeuven English Old to New (LEON): Some ideas on a new corpus for longitudinal diachronic studies.
Petré, Peter ULg

Conference (2009, July 09)

Despite the explosion of diachronic corpora of English in the last few decades, still not a single corpus exists that covers the entire documented history of English. Although its compilation is generally ... [more ▼]

Despite the explosion of diachronic corpora of English in the last few decades, still not a single corpus exists that covers the entire documented history of English. Although its compilation is generally perceived as most attractive (Rissanen 2000: 13), corpus compilers do not seem to believe in its creation in the near future. This is regrettable, as many linguists dealing with longitudinal developments such as grammaticalization need to cover very long time spans, and are forced to combine several, not necessarily compatible, corpora (e.g. Hilpert 2008, van Linden 2009). Clearly, their results are less reliable than they might be if a single corpus existed (for example, Gries and Hilpert’s data (2008) show a major shift in the collocational profile of shall about 1710; however, this is precisely where one corpus they use ends and a second – rather different one – begins). So I tentatively started compiling a corpus myself, provisionally called LEON (Leuven English Old to New). The basic architecture of LEON comprises a 400,000 word corpus for each HC-period, and after 1710 for the periods 1710-1780, 1780-1850, 1850-1920, 1920-1990 and post-1990. Data available from 1250-1350, a less well represented period, serve as a template on which other subperiods are to be based to acquire best comparability of genre and region. To make up for the lack of some genres (letters, diaries) and social stratification, for each period after 1350 an additional, selfsufficient 600,000 words corpus is envisaged. While LEON is primarily conceived as a ‘meta-corpus’, mining existing corpora, some additions are envisaged too (e.g. the unedited Statutes Rwl. B.520, dated a1325). LEON does not aim at full comparability (which would be presumptuous), but wants to optimize the usefulness of concepts like ‘equal size of subperiods’ or ‘diachronic text prototype’ (HC). LEON might be, as compared to the present ‘big evil’, a ‘lesser evil’. References Gries, Stefan Th. and Martin Hilpert. The identification of stages in diachronic data: variability-based neighbour clustering. Corpora Vol. 3 (1): 59–81. Hilpert, Martin. 2008. Germanic future constructions A usage-based approach to language change. Amsterdam & Philadelphia: John Benjamins. Los, Bettelou. 2005. The rise of the to-infinitive. Oxford: Oxford University Press. Rissanen, Matti & Merja Kytö. 1993. General introduction. In Rissanen, Matti, Merja Kytö & Minna Palander-Collin, eds. 1993. Early English in the computer age: Explorations through the Helsinki Corpus. Berlin: Mouton de Gruyter. 1-17. Rissanen, Matti. 2000. The world of English historical corpora: From Cædmon to computer age. Journal of English Linguistics 28: 7-20. van Linden, An. 2009. Dynamic, deontic and evaluative adjectives and their clausal complement patterns: A synchronic-diachronic account. PhD dissertation, University of Leuven. [less ▲]

Detailed reference viewed: 69 (3 ULg)