References of "Scientific congresses and symposiums"
     in
Bookmark and Share    
See detailDiasporic Experience and Music in Caryl Phillips’s Crossing the River
Mascoli, Giulia ULg

Conference (2015, September 07)

This paper deals with Caryl Phillips who has incessantly represented diasporic experience in his work where he evokes complex identities at the crossroads between Africa, the Caribbean and Europe. My ... [more ▼]

This paper deals with Caryl Phillips who has incessantly represented diasporic experience in his work where he evokes complex identities at the crossroads between Africa, the Caribbean and Europe. My proposal is to concentrate on Phillips’s novel Crossing the River (1993) which extensively explores the theme of the African diaspora and which, interestingly, has also been described as his most jazzy text. This narrative not only addresses diasporic themes, such as uprootings and lost origins, but very much like jazz -- which is for Brathwaite “a cry from the heart of the hurt man” (277) – it gives a voice to the victims of history, to shattered individuals in pain whose tragic fate is viewed at once as personal and collective. Benítez-Rojo draws attention to the importance of rhythm in this text, but he only provides a limited analysis with no specific examples of how this significant feature of the work is achieved or the purposes it serves. In this paper I will try to demonstrate that Phillips’s thematic and formal use of music, including the references to classic themes of the African American musical tradition or the recurrent and creative use of repetitions, has a performative role and reenacts the duty of remembering inherent in the diasporic experience. [less ▲]

Detailed reference viewed: 12 (1 ULg)
See detailBEDROCK AND BIOTIC INFLUENCE ON COMMUNITY COMPOSITION IN SOILS FROM THE SØR RONDANE MOUNTAINS, EAST ANTARCTICA
Tytgat, Bjorn; Verleyen, Elie; D'hondt, Sofie et al

Poster (2015, September 07)

Antarctica is a continent of extremes; the low availability of liquid water and nutrients, extreme low temperatures and seasonally variable levels of solar radiation exert high selective pressures on ... [more ▼]

Antarctica is a continent of extremes; the low availability of liquid water and nutrients, extreme low temperatures and seasonally variable levels of solar radiation exert high selective pressures on organisms. Consequently, most life forms in the scarce ice-free regions which represent less than 1% of the surface area of the continent are microbial. Despite this, terrestrial microbial communities are poorly studied and the existing data are geographically focused on McMurdo dry valleys and volcanically active regions. Nunataks, mountain tops protruding through the ice sheets, occur along much of the East Antarctic coast and in the Transantarctic Mountains. Among them, several remained ice-free during Neogene and Pleistocene ice ages and thus may have acted as important refugia for terrestrial life. Here we present the results of a broad-scale survey of microbial biodiversity of ice-free regions in the western Sør Rondane Mountains (Dronning Maud Land (DML), East Antarctica). A total of 66 samples from eight different ice-free regions were selected to represent gradients in bedrock type (gneiss or granite), the macrobiotic content (presence or absence of moss, lichen and/or arthropods) and geographic location. All samples were subjected to both genetic fingerprinting (ARISA) and second generation sequencing (Illumina MiSeq 300PE) targeting the V1 -V3 variable regions of the 16S rRNA gene. Mock communities were included to benchmark the bioinformatics pipeline. Reads were processed using Usearch (Edgar 2010), clustered based on a 97 % similarity cutoff using Uparse (Edgar 2013)and identified using the GreenGenes training set. The specific conductivity, pH, water content, and total (TC),total organic (TOC) and inorganic (IC) carbon content were determined and used as explanatory variables in direct ordination analyses of both the ARISA and the Illumina data. The Illumina sequencing resulted in ~600.000 high quality sequences divided over ~3980 OTUs in 28 phyla and 219 genera. No significant differences in richness equaling the number of OTUs after standardization for the number of sequences per samples were observed between high, medium and low TOC content classes for the sequencing data. Redundancy Analysis revealed that bedrock type (granite or gneiss), water content, specific conductance, pH and TOC significantly shaped the bacterial community composition. The ARISA dataset, despite having a lower taxonomic resolution, showed very similar patterns and relationships with environmental data, among which bedrock type remained the most important parameter in explaining differences in community structure between the samples. As the gneiss is supposedly of granite origin, differences in community structure may be related to physical differences between both bedrock types and their weathering products. Preliminary cosmogenic analysis of Pb isotopes of gravel samples indeed suggest a predominantly local origin of the material, yet mixtures with exotic material cannot be excluded in samples from gneiss outcrops. We conclude that microbial community composition is primarily driven by mineralogical characteristics of weathering products in these poorly developed soils, while biotic influences are of secondary importance. [less ▲]

Detailed reference viewed: 7 (0 ULg)
See detailImmunoglobulin E enhances host resistance to venoms.
Marichal, Thomas ULg

Conference (2015, September 07)

Detailed reference viewed: 8 (0 ULg)
See detailLa perte comme identité : le cas des familles post-séparation et post-divorce.
D'Amore, Salvatore ULg

Conference (2015, September 07)

Detailed reference viewed: 18 (1 ULg)
See detailThe 4m International Liquid Mirror Telescope
Surdej, Jean ULg

Conference (2015, September 07)

The International Liquid Mirror Telescope (ILMT) consists of a 4-m diameter zenith telescope with a liquid mirror characterized by a f/2 focal ratio. It is a collaborative project between Belgium, Canada ... [more ▼]

The International Liquid Mirror Telescope (ILMT) consists of a 4-m diameter zenith telescope with a liquid mirror characterized by a f/2 focal ratio. It is a collaborative project between Belgium, Canada, India and Poland. The participating institutions are: Institute of Astrophysics and Geophysics of the Liege University (IAGL), the Royal Observatory of Belgium (ROB), six Canadian universities (British Columbia, Laval, Montreal, Toronto, Victoria and York), the Aryabatta Research Institute of Observational Sciences (ARIES, Nainital, India) and the Observatory of Poznan (UAM, Poland). This telescope is being installed at the Devasthal observatory, India (Longitude 79° 41' 04'' E, +29° 21' 40'' N, altitude 2450m), in the central Himalayas. First light should happen in early 2016. It will image every night a strip of sky having an approximate width of 27' in declination using a 4096 x 4096 pixel CCD detector that will work in the time delay integration (TDI) mode. The ILMT will thus perform a deep survey of a long and narrow strip of sky by looking at stars, galaxies, AGN, quasars, asteroids, space debris, ... crossing its field of view. It will observe in the i', r', g' SDSS spectral bands. This survey will thus be mainly dedicated to photometric and astrometric variability studies of faint objects. Among the main scientific goals, let us mention the detection and follow up of a few tens of multiply imaged quasars produced by gravitational lensing, hundreds of supernovae every year, detection of nearby brown dwarfs, white dwarfs and other faint stars based upon their trigonometric parallax and/or proper motion measurements, photometric variability studies of thousands of quasars and millions of stars as well as space debris detection at dusk and/or at dawn. Right now, numerous data sets have already been obtained of the ILMT strip of sky with smaller telescopes in the TDI mode. These will be used to carry out preliminary scientific projects and calibration of the ILMT data. A pipeline and database are presently in construction at the Poznan Observatory. Some videos and recent photographs will illustrate the present status of the ILMT project. [less ▲]

Detailed reference viewed: 10 (3 ULg)
Full Text
Peer Reviewed
See detailCitizens abroad and Regional Elections: A diffusionist Perspective
Lafleur, Jean-Michel ULg; Arrighi, Jean-Thomas

Conference (2015, September 06)

In this paper we shift the focus away from the state to the regional demos with the aim to introduce the notion of scale in the study of external voting. It is divided into three parts. Following a ... [more ▼]

In this paper we shift the focus away from the state to the regional demos with the aim to introduce the notion of scale in the study of external voting. It is divided into three parts. Following a preliminary discussion on the external franchise from a sub-state perspective, we proceed with a comparative overview of the rules of acquisition and loss of the franchise in regional elections and show that the extension of the franchise to ‘regional expatriates’ is a relatively exceptional practice. We then identify factors that in our view are key to understand the absence of a vertical diffusion of the external franchise to lower levels of government, in sharp contrast with its rapid horizontal diffusion at the state level. The second part examines the debates surrounding the inclusion and exclusion of the franchise in three cases of protracted nationalist mobilization that translated into far reaching territorial autonomy: Catalonia, Scotland and Flanders. The third and final section contrasts the similarities and differences that can be found between our three cases and reflects upon the lessons that can be drawn from them. [less ▲]

Detailed reference viewed: 28 (0 ULg)
Full Text
Peer Reviewed
See detailBinge Drinking at young age
Gavray, Claire ULg

Conference (2015, September 05)

discussion théorique et méthodologique sur le concept et la mesure du binge drinking. Présentation des facteurs liés à cette pratique chez les adolescents filles et garçons. Analyse des résultats à la ... [more ▼]

discussion théorique et méthodologique sur le concept et la mesure du binge drinking. Présentation des facteurs liés à cette pratique chez les adolescents filles et garçons. Analyse des résultats à la lumière des opportunités historiques sexuées en évolution.données ISRD3-Belgique [less ▲]

Detailed reference viewed: 31 (5 ULg)
See detailAge-related modulations in cognitive functions and its cerebral underpinnings
Collette, Fabienne ULg

Conference (2015, September 04)

Detailed reference viewed: 14 (1 ULg)
Full Text
See detailFrom Aleph to Alma: Fulfillment, feel it fully
Van Ruymbeke, Muriel ULg; Lhoest, Rémy ULg; Thirion, Paul ULg

Conference (2015, September 04)

If it is well prepared, migrating from Aleph to Alma brings users a lot of advantages. To reach the go live day with as less worries as possible, ULg Library's preparation consisted in two things: a deep ... [more ▼]

If it is well prepared, migrating from Aleph to Alma brings users a lot of advantages. To reach the go live day with as less worries as possible, ULg Library's preparation consisted in two things: a deep understanding of Alma new concepts and a simplification of our physical fulfillment policy. This presentation, based on our experience, will aim at describing the main differences between Aleph and Alma regarding fulfillment concepts and their significant consequences on implementation and migration jobs. On a fulfillment point of view, what distinguishes Aleph from Alma is that, in Aleph, the circulation policy is based on item status. On the contrary in Alma it is based on the location, and its traffic rules built by a set of terms of uses (TOU). Numerous other idioms complete the Alma toolkit and allow physical item’s fulfillment customizing. But to really enjoy the new possibilities given by Alma, it is important to fully feel the necessary changes… at the very beginning ! [less ▲]

Detailed reference viewed: 57 (4 ULg)
Full Text
See detailMagnetic shielding properties of tubular bulk superconductors subjected to stray magnetic fields
Hogan, Kevin ULg; Fagnard, Jean-François ULg; Wera, Laurent ULg et al

Conference (2015, September 04)

Superconducting materials act as efficient magnetic shields thanks to their intrinsic magnetic properties. The vast majority of studies on superconducting shields has been conducted in homogeneous ... [more ▼]

Superconducting materials act as efficient magnetic shields thanks to their intrinsic magnetic properties. The vast majority of studies on superconducting shields has been conducted in homogeneous magnetic field configurations. Only few works have been done concerning inhomogeneous magnetic field configurations while those are representative of practical situations. Moreover, those configurations are non-trivial given the magnetic hysteretic behaviour of type-II superconductors. In the present work, we aim at investigating and understanding the magnetic response of a superconducting hollow cylinder made of Bi-2223 subjected to the magnetic stray field of various magnetic sources. Thanks to a bespoke 3D mapping system and a three-axis Hall probe, we measure the magnetic flux density distribution in the vicinity of the cylinder when the latter is subjected to those stray fields. All experiments are carried out in liquid nitrogen. Our experimental data allow us to apprehend the magnetic field penetration inside the superconductor in inhomogeneous field configurations and to compare those to results obtained with homogeneous fields. Then we compare our results to a finite element model of an infinite tube subjected to an inhomogeneous magnetic field in order to gather information on the magnetic field penetration and the current density distribution inside the superconductor. [less ▲]

Detailed reference viewed: 36 (9 ULg)
Full Text
See detailEVALUATION OF SV2Alox/Cre TRANSGENIC MOUSE USING [18F]UCB-H IN IN VITRO AUTORADIOGRAPHY
Serrano Navacerrada, Maria Elisa ULg; Becker, Guillaume ULg; MENTEN, Catherine ULg et al

Poster (2015, September 04)

Background: SV2A is the most studied isoform of the Synaptic Vesicle 2 proteins, which are involved in the synaptic vesicle trafficking. Interestingly, the SV2A has been identify as the binding site for ... [more ▼]

Background: SV2A is the most studied isoform of the Synaptic Vesicle 2 proteins, which are involved in the synaptic vesicle trafficking. Interestingly, the SV2A has been identify as the binding site for the antiepileptic drug levetiracetam, showing a close relation between the epilepsy, the dysregulation of the SV2A levels and the response to antiepileptic medications. SV2A floxed-mice were developed using a cre-lox technique, leading to a strong decrease of SV2A expression in the CA3 field of the hippocampus. We aim here to validate this model using [18F]UCB-H, a novel PET imaging radiotracer with a nanomolar affinity for human SV2A. Methods: In vitro autoradiography were performed on SV2Alox/Cre+ transgenic mouse brain slices. SV2Alox/Cre- mouse was used as control. To obtain a structural reference, brain slices underwent eosin-haematoxylin staining. Images of both procedures were coregistered using π-PMOD software. Regions of interest (Dentate Gyrus, CA1, CA2 and CA3) were drawn according to a stereotaxic atlas of the mouse brain. Results: Analyses showed significant differences in radiotracer binding (p<0.001) between SV2Alox/Cre+ mouse and SV2Alox/Cre- mouse highlighting an important reduction for the labelling density in Ammon's horn, particularly in CA1, compared to Dentate Gyrus where the diminution was less marked. Conclusions: Here, we used the radiotracer [18F]UCB-H to probe the decreased expression of SV2A protein in the hippocampus of SV2Alox/Cre+ mouse versus SV2Alox/Cre- control mouse. Our results contribute to the validation of the model, and encourage us to proceed with further longitudinal and behavioural studies. [less ▲]

Detailed reference viewed: 77 (34 ULg)
Peer Reviewed
See detailThe executive functioning in normal aging: Impact of the cognitive reserve
Simon, Jessica ULg; Gilsoul, Jessica ULg; Collette, Fabienne ULg

Poster (2015, September 04)

There exists a large inter-individual variability regarding the effects of aging on cognition. According to Stern (2009), people who developed a high level of reserve are more resilient to the effects of ... [more ▼]

There exists a large inter-individual variability regarding the effects of aging on cognition. According to Stern (2009), people who developed a high level of reserve are more resilient to the effects of aging that individuals with lower cognitive reserve. In this study, we describe the impact of cognitive reserve on executive functions in normal aging. Ninety healthy participants aged from 60 to 80 years were recruited. We assessed the three major executive functions: Inhibition (Stroop test, Hayling test, TAP Incompatibility subtest), Shifting (TAP Flexibility subtest, Plus-Minus task), and Updating (Letter-Number Sequencing subtest from MEM III, Letter memory task, 2-back task). Cognitive reserve was measured by questionnaires assessing educational level, occupation, leisure activities and physical activity across the life. Multiple linear regressions (p<0.05) adjusted for age, quality of sleep, processing speed showed that elderly with a high level of reserve have better performance on updating. We also assessed the effect of each factor of cognitive reserve separately after adjustment for the other. We observed that people with high level of education have better performance on flexibility (TAP Flexibility subtest and composite score) and on updating (Letter-Number Sequencing subtest, Letter memory and composite score). However, we didn’t observe any significant effect of the other factors of cognitive reserve. These results suggest that the cognitive reserve is related to abilities in some executive tests. [less ▲]

Detailed reference viewed: 83 (3 ULg)
See detailSeasonality in human cognitive brain responses.
Meyer, Christelle ULg; Muto, Vincenzo ULg; Jaspar, Mathieu ULg et al

Poster (2015, September 04)

Detailed reference viewed: 68 (6 ULg)
Peer Reviewed
See detailThe impact of ageing on episodic memory encoding: an fMRI study
François, Sarah ULg; Angel, Lucie; SALMON, Eric ULg et al

Poster (2015, September 04)

Detailed reference viewed: 13 (0 ULg)
Full Text
Peer Reviewed
See detailSelf-Reported Delinquency Survey: Comparison of Two Methods Among Female and Male Detained Adolescents
Grégoire, Julie ULg; Mathys, Cécile ULg

Poster (2015, September 04)

Self-report delinquency (SRD) surveys have begun to be used more than 70 years ago to measure delinquency (Porterfield, 1943). Since then, lots of methods have been developed (e.g. P&P questionnaire ... [more ▼]

Self-report delinquency (SRD) surveys have begun to be used more than 70 years ago to measure delinquency (Porterfield, 1943). Since then, lots of methods have been developed (e.g. P&P questionnaire, telephone interviewing, face-to-face interviewing, CASI, ACASI) for data collection (Kleck & Roberts, 2012). Although a lot of researches have assessed the participation rates of these methods, most of SRD surveys are submitted to non-detained adolescents . We have therefore noticed that those methods only allow us to know but little about the participation rate of young detainees and about their motivation to take part in a SRD survey. This research, which constitutes the pre-test of a further larger research, aims to: 1) Identify which method of SRD (comparing Paper & Pencil (P&P) questionnaire and Web questionnaire) has the highest participation rate and is the most attractive for young detained people, and if there are differences between boys and girls. 2) Determine the impact of an incentive on the motivation to participate in a survey, and if there are differences between boys and girls. As a result, we can observe that the SRD survey method doesn’t seem to have an influence on the participation rate of youth from detention centers. Nevertheless, the most attractive SRD survey method seems to be the Web one. As it is also less discouraging, it seems preferable to use this method with these adolescents whenever it is possible. Regarding the different kinds of incentives regularly used in research, their impact on the decision to take part in a survey turns out to be very weak, even nonexistent or negative. It appears that an incentive for juveniles placed in detention centers is inappropriate to increase their motivation to participate. [less ▲]

Detailed reference viewed: 17 (2 ULg)
Full Text
Peer Reviewed
See detailLa Banque de Données des Epiclèses Grecques (BDEG) dans le cadre des Humanités numériques : questions théoriques et méthodologiques.
Lebreton, Sylvain ULg

Poster (2015, September 03)

Quiconque est un peu familier avec les textes grecs antiques peut aisément prendre la mesure de la richesse, en nombre et en diversité, des épiclèses (épithètes cultuelles) que les anciens Grecs ont ... [more ▼]

Quiconque est un peu familier avec les textes grecs antiques peut aisément prendre la mesure de la richesse, en nombre et en diversité, des épiclèses (épithètes cultuelles) que les anciens Grecs ont attribuées à leurs divinités. Cette importance, tant quantitative que qualitative, fait de ces dénominations un vecteur extrêmement pertinent pour l'étude du polythéisme hellénique, en même temps qu'elle constitue un défi analytique de premier ordre. Compte tenu de cette abondance, de la masse documentaire mise à contribution (surtout si l'on envisage le monde grec antique dans son ensemble), mais aussi de la complexité des relations entre les différentes composantes de la « société des dieux » des anciens Grecs, une telle étude peut tirer grand profit du recours à des outils de traitement quantitatif des données. Ce constat est à l'origine de la création, il y a une dizaine d'années, de la Banque de Données des Epiclèses Grecques (BDEG), dans le cadre du LAHM (ex-Crescam, UMR 6566 CReAAH) de l'Université Rennes 2 (https://epiclesesgrecques.univ-rennes1.fr/accueil.php). Le projet est toujours en cours de développement et constitue de ce fait une étude de cas potentiellement intéressante dans le cadre d'une réflexion sur les Humanités numériques dans le champ de l'Antiquité. En effet, la confrontation avec la réalité des données documentaires (en l'occurrence principalement littéraires et épigraphiques), les progrès dans la réflexion sur le traitement quantitatif et les évolutions des outils numériques ont rendu nécessaire l'évolution de la BDEG depuis sa création. On s'attachera donc à présenter certains pans de cette évolution – passés, en cours et à venir – en insistant sur les problèmes méthodologiques qu'ils posent du point de vue des Humanités numériques. [less ▲]

Detailed reference viewed: 19 (1 ULg)
Full Text
See detailWhy are flux avalanches deflected by a metallic layer?
Brisbois, Jérémy ULg

Poster (2015, September 03)

Sudden avalanches of magnetic flux bursting into a superconducting sample are deflected from their trajectories when they encounter a conductive layer deposited on top of the superconductor. Remarkably ... [more ▼]

Sudden avalanches of magnetic flux bursting into a superconducting sample are deflected from their trajectories when they encounter a conductive layer deposited on top of the superconductor. Remarkably, in some cases the flux is totally excluded from the area covered by the conductive layer. Even if this phenomenon has been known for a few years, there is currently no theoretical model describing it. Moreover, the question whether the deflection would also be observed for a single vortex entering the region covered by a metallic layer is still unanswered. In this work we use the magneto-optical imaging (MOI) technique, based on the Faraday effect, to show that a conductive layer (Cu) can repel flux avalanches triggered in an underlying superconducting film (Nb) (see figure). We present a simple classical model that accounts for the deflection of a single vortex and considers a magnetic monopole approaching a semi-infinite conductive plane. This model suggests the important role played in the avalanche deflection by electromagnetic braking, arising from the eddy currents induced by the moving vortex in the metal. Moreover, we have found a decrease of the vortex damping coefficient due to the metallic sheet at large vortex velocities, correcting early theoretical descriptions where a linear behaviour was proposed. [less ▲]

Detailed reference viewed: 7 (0 ULg)
Full Text
Peer Reviewed
See detailFragility Analysis of a Steel Building in Fire
Gernay, Thomas ULg; Elhami Khorasani, Negar; Garlock, Maria

in Usmani, Asif; Lu, Yong; Das, Purnendu (Eds.) Proceedings of the First International Conference on Structural Safety under Fire & Blast - CONFAB 2015 (2015, September 03)

Community resilience to extreme events is an issue of increasing concern in our interconnected and urbanized societies. This work provides a framework to evaluate the response of a community of buildings ... [more ▼]

Community resilience to extreme events is an issue of increasing concern in our interconnected and urbanized societies. This work provides a framework to evaluate the response of a community of buildings to fire following earthquake, a potentially highly destructive cascading multi-hazard event. In a previous part of the work, a model has been developed to predict the probability of ignition in a building due to an earthquake. Given an ignition in a building, the probability of the structure exceeding certain limit states must be evaluated in order to quantify the expected damage loss. Adopting an approach similar to that used in seismic engineering, fragility functions can be developed for structures subjected to fire. The methodology is described here for a prototype nine-story steel frame building. In developing the fragility functions, uncertainties in the fire model, the heat transfer model and the thermo-mechanical response are considered. In addition several fire scenarios at different locations in the building are studied. The demand on and capacity of the system are assessed probabilistically in terms of critical temperature. The developed fire fragility functions yield the probability of exceedance of predefined damage states as a function of the fire load in the building. Future works will aim to implement fire fragility functions into a GIS based risk assessment software platform for assessment of the expected risk and cost associated with fire following earthquake for a community of buildings. [less ▲]

Detailed reference viewed: 71 (15 ULg)
Full Text
See detailUne féminité en métamorphose: Représentation de la féminité noire dans le cinéma black-British
Herbert, Emilie ULg

Conference (2015, September 03)

Le long-métrage "Burning an illusion", réalisé par Menelik Shabazz, met en scène l'éveil politique d'une jeune femme noire, Pat (Cassie McFarlane) lorsqu'elle fait l'expérience du racisme et de la ... [more ▼]

Le long-métrage "Burning an illusion", réalisé par Menelik Shabazz, met en scène l'éveil politique d'une jeune femme noire, Pat (Cassie McFarlane) lorsqu'elle fait l'expérience du racisme et de la violence dans les rues de Londres. "Burning an illusion" est l'un des premiers films black British à prendre pour personnage principal une femme et Shabazz décrit la conscientisation politique de Pat en termes ouvertement féminins : sa transformation intellectuelle passe en effet par une métamorphose physique. A travers une africanisation de son apparence (son maquillage disparaît, ses vêtements changent et ses cheveux, soigneusement lissés au début du film, reprennent leur apparence naturelle), Pat manifeste son rejet des codes de beauté occidentaux qui annihilent les femmes noires en imposant la blancheur comme point de référence. Ce long-métrage, réalisé en 1981, met en avant une notion développée par un féminisme noir qui s'éveille à la même époque en Grande-Bretagne : celle de la (re)conquête de la féminité noire à travers la création d'une identité black British fluide qui reconnaît la nature fragmentée des identitées hybrides, racialisées et genrées (Mirza, 1997). L'analyse d'un corpus de plusieurs films du mouvement du black British Cinema des années 1980 et 90 à travers une approche intersectionnelle, féministe et de genre nous permettra de comprendre ce processus de redéfinition de la féminité noire, jusqu'alors rendue invisible au sein du cinéma britannique blanc (Bourne, 2001). Les films étudiés encouragent en effet la revalorisation de la beauté naturelle du corps féminin noir, permettant ainsi son mouvement d'objet à sujet (Weekes, 1997), en passant par un processus de métamorphose physique. Le corps y est fragmenté (Coly, 2010) afin d'en déconstruire l'image socialement et culturellement produite (Jordan-Zachery, 2013) et de créer ainsi une nouvelle syntaxe qui permet d'articuler et de comprendre le corps féminin noir différemment (Doane, 1981). [less ▲]

Detailed reference viewed: 40 (5 ULg)
See detailWildflowers sown at field margins have positive and negative effects on pests and parasitoids
Hatt, Séverin ULg; Uyttenbroeck, Roel ULg; Chevalier Mendes Lopes, Thomas ULg et al

Conference (2015, September 03)

Wildflower strips are sown at field margins throughout Europe to support insect conservation in agricultural areas. Among other insects, parasitoids may favor a biological regulation of pests. On an ... [more ▼]

Wildflower strips are sown at field margins throughout Europe to support insect conservation in agricultural areas. Among other insects, parasitoids may favor a biological regulation of pests. On an experimental field of the research platform AgricultureIsLife in Gembloux (University of Liège, Belgium), three replications of five wildflower seed mixtures were sown in strips adjacent to crops in spring 2013. Insect pests and their parasitoids were pan-trapped in spring 2014 in both wildflower strips and oilseed rape crops and identified at the species level. Flower species and cover were monitored in the strips using 1 m² quadrats, before mowing. Meligethes spp. were found abundantly in crops when oilseed rape was blooming. Meligethes’ parasitoids occurred later and their abundance was positively correlated with that of Meligethes in the flower strips. At the crop ripening stage, weevils Ceutorhynchus spp. occurred and were followed by an increase in abundance of their parasitoids in both crops and flowers. Positive as well as negative correlations were found between the abundance of these pests, their parasitoids and different flower species blooming at this time. The link between these results with flower species’ functional traits will be discussed. [less ▲]

Detailed reference viewed: 36 (12 ULg)
Full Text
Peer Reviewed
See detailIn vivo quantification of dopaminergic terminals loss in Parkinson’s Disease rat model: comparison between [18F]FMT and [18F]FDOPA.
Becker, Guillaume ULg; Bahri, Mohamed Ali ULg; Michel, Anne et al

Poster (2015, September 02)

Objectives: Rat models of Parkinson’s disease (PD), such as unilaterally lesioned rats with 6-hydroxydopamine (6-OHDA), are useful to evaluate novel antiparkinsonian therapies. MicroPET imaging, using L-3 ... [more ▼]

Objectives: Rat models of Parkinson’s disease (PD), such as unilaterally lesioned rats with 6-hydroxydopamine (6-OHDA), are useful to evaluate novel antiparkinsonian therapies. MicroPET imaging, using L-3,4-dihydroxy-6-[18F]-fluoro-phenylalanine ([18F]FDOPA) allows longitudinal evaluations of DA terminals loss. However, chemical structure of [18F]FDOPA leads to suboptimal PET imaging. 18F-fluoro-m-tyrosine ([18F]FMT) is an effective PET tracer to evaluate DA terminals integrity and L-aromatic amino acid decarboxylase (AAAD) metabolic pathway. So far, there are no available quantitative PET studies comparing the two methods in hemiparkinsonian rats. In this study, we compare imaging data provided by [18F]FMT PET and [18F]FDOPA PET in 6-OHDA-lesioned rats. Methods: 10 µg of 6-OHDA were injected into the right medial forebrain bundle (MFB) of male Sprague-Dawley rats (n=8). As control, sham-treated rats (n=8) were injected with vehicle only but otherwise treated identically. Striatal DA presynaptic activity was assessed by dynamic PET with both [18F]FMT and [18F]FDOPA. Structural T2-weighted brain images were acquired on a 9.4T MRI and were used for co-registration. After normalization on a MRI template, kinetic analysis was performed by “Patlak Reference” model, using PMOD software. Six days after the last PET scan, rats were sacrificed, and striatum were rapidly removed for striatal DA and metabolites quantification. Results: Striatal accumulation was observed for both tracers. However, while the administration of [18F]FDOPA required two peripheral inhibitors (benserazide and entacapone), only benserazide is needed with [18F]FMT. As consequence of the 6-OHDA-lesion, significant decrease of both [18F]FMT and [18F]DOPA accumulation was recorded in the striatum ipsilateral to the lesion. Lesioned rats had dramatically reduced uptake constant Ki in the ipsilateral striatum compared to the contralateral striatum (p<0.001 for [18F]FMT and p<0.05 for [18F]DOPA) and to the ipsilateral striatum of sham-treated rats (p<0.001 for both tracers). The DA content in the ipsilateral striatum was significantly lower (p<0.001) than in the contralateral striatum in the 6-OHDA-injected group, whereas such difference was not measured with the sham group. This indicate that [18F]FMT PET is as effective as [18F]DOPA PET to quantify loss of DA presynaptic function in unilaterally 6-OHDA lesioned rats. Conclusions: Our results are in agreement with data reporting correlation between these two tracers in a Non-human primate model of PD. The sensitivity of the data quantification obtained in this study, confirms the interest to pursue longitudinal investigations with [18F]FMT to monitor dopaminergic dysfunction in a more progressive preclinical model of PD. [less ▲]

Detailed reference viewed: 47 (2 ULg)
Full Text
See detailMilk biomarkers to detect ketosis and negative energy balance using MIR spectrometry
Grelet, Clément ULg; Bastin, Catherine ULg; Gelé, Marine et al

Conference (2015, September 02)

Detailed reference viewed: 30 (9 ULg)
Full Text
Peer Reviewed
See detailImpact of a one-day preventive voice program for teachers : A longitudinal study
Remacle, Angélique ULg; Gerber, Silvain; David, Claire et al

Conference (2015, September 02)

I. INTRODUCTION Teachers are professional voice users, i.e. people who rely on a consistent, special, or appealing voice quality to achieve their job. If afflicted with dysphonia or aphonia, they would ... [more ▼]

I. INTRODUCTION Teachers are professional voice users, i.e. people who rely on a consistent, special, or appealing voice quality to achieve their job. If afflicted with dysphonia or aphonia, they would generally loose motivation at work and seek alternative employment [1]. Teachers represent the largest group of professionals complaining of dysphonia: they represent 20% to 25% of the treatment-seeking workers [2, 3]. Voice disorders impact both physical and psychological health. They represent a public health problem, since they have considerable economic consequences in terms of treatment and replacement of professionals who suffer from these problems [4]. Moreover, they have been shown to interfere with quality of life, emotional state, job satisfaction, performance and attendance [4, 5]. Finally, a teacher’s dysphonia adversely impacts students’ comprehension and learning [6]. These negative effects of teachers’ voice disorders motivate to develop prevention programs and test their efficacy. This study aims to evaluate the impact over a five-month period of a one-day prevention program for female teachers. This program includes both direct and indirect methods. II. METHODS A. Participants Twenty-two female kindergarten and elementary schoolteachers with less than 5 years of experience participated in this study. Half of them (test group) took part in a one-day prevention program in October, while the other half (control group) received no counseling on the use of the voice. B. Assessments For each participant, five sustained /a/ vowels and the reading of a text were recorded (1) at two times of the workday (morning and evening), and (2) at three times of the year: October (T0), December (T1) and February (T2). For the sustained vowels, we measured maximum phonation time (MPT), mean fundamental frequency (F0), values of jitter, shimmer and harmonics-to-noise ratio (HNR). For the texts, we measured mean F0, standard deviation in F0 and intensity, and parameters related to speech rate (number of syllables per second, number of pauses and mean duration of pauses). For each parameter, a repeated-measures ANOVA (2 groups * 2 times of day * 3 times of year) was carried out. Participants also completed a questionnaire on voice use and comfort at the three test sessions. III. RESULTS A. Time of day effect The main effect of time of day showed an increase in the mean F0 of the vowels and the text following a workday (p<.01). MPT and HNR also increased (p<.01), while jitter and shimmer decreased at the end of the day (p<.05). The speech rate measures showed that the teachers tended to pause less often while reading the text at the end of the day, and their pauses were shorter (p<.05). B. Time of year effect The main effect of time of year showed an increase in the mean F0 of the vowels and the text during the year (p<.01), with the highest values observed in December (T1). The speech rate measures also showed an increase in the number of syllables per second (p<.01) and a tendency for speakers to pause less often later in the year. C. Group effect Several acoustic parameters showed that voice changed during the day and during the year in significantly different ways in the two groups. Thus, the MPT increased more during the year for the control group than for the test group. The elevation of mean F0 during the day increased to a similar degree for both groups between T0 and T1, but continued to increase until T2 for the control group, while it decreased for the test group. Jitter and shimmer decreased significantly following a workday for both groups at T0, and this decrease was more marked for the test group at T1 and T2. Finally, analysis of the questionnaires showed a very strong deterioration in teachers’ self-evaluations of vocal comfort and control at T1; nevertheless there were significantly fewer complaints from the group that received the prevention program. IV. DISCUSSION AND CONCLUSION For both groups, the changes in the observed parameters suggested an increase in vocal fatigue and hyperfunctional phonation during the day and during the year. The results showed greater vocal deterioration in December than at the other points in the school year (October and February). For several acoustic parameters, the comparison of the two groups showed a less severe vocal deterioration for subjects who received the preventive program. Moreover, the questionnaires showed that the prevention program had a significantly positive impact on the changes in the teachers’ perception during the year. These results encourage to offer such preventive interventions to teachers before or during their career, since they have a positive impact on teachers’ perception and vocal comfort. V. REFERENCES [1] Titze IR, Lemke J, Montequin D. (1997). Populations in the U.S. workforce who rely on voice as a primary tool of trade: A preliminary report. Journal of Voice, 11(3), 254-259. [2] Van Houtte, E., Van Lierde, K., D'Haeseleer, E., & Claeys, S. (2010). The prevalence of laryngeal pathology in a treatment-seeking population with dysphonia. Laryngoscope, 120(2), 306-312. [3] Remacle, A., Petitfils, C., Lejeune, L., Finck, C., & Morsomme, D. (2014). Quel est le profil professionnel des patients consultant en phoniatrie ? 70e Congrès de la Société Française de Phoniatrie, Paris, France. (October 13, 2014). [4] Roy, N., Merrill, R. M., Thibeault, S., Parsa, R. A., Gray, S. D., & Smith, E. M. (2004). Prevalence of voice disorders in teachers and the general population. Journal of Speech, Language, and Hearing Research, 47(2), 281-293. [5] Chen, S. H., Chiang, S.-C., Chung, Y.-M., Hsiao, L.-C., & Hsiao, T.-Y. (2010). Risk factors and effects of voice problems for teachers. Journal of Voice, 24(2), 183-190. [6] Morsomme, D., Minel, L., & Verduyckt, I. (2011). Impact of teachers’ voice quality on children’s language processing skills. Vocologie: Stem en Stemstoornissen, 4, 9-15. [less ▲]

Detailed reference viewed: 60 (4 ULg)
See detailCross-linked polymer micelles made of polyphosphate containing amphiphilic copolymers for drug delivery
Riva, Raphaël ULg; Vanslambrouck, Stéphanie ULg; Ergül, Zeynep ULg et al

Conference (2015, September 01)

In the pharmaceutical field, amphiphilic block copolymers are of great interest for the nanovectorization of active principles in Drug Delivery. Indeed, new drugs are synthesized each day but in too many ... [more ▼]

In the pharmaceutical field, amphiphilic block copolymers are of great interest for the nanovectorization of active principles in Drug Delivery. Indeed, new drugs are synthesized each day but in too many cases, their high hydrophobicity makes them useless because of the absence of an appropriated administration method. Typically, amphiphilic block copolymers present the remarkable property to self-assemble in water with formation, in most cases, of spherical micelles characterized by a hydrophobic core and a hydrophylic corona. Rapidly, their ability to encapsulate a hydrophobic drug in their hydrophiobic core was investigated to increase the solubility of the drug in aqueous media, prevent its degradation and decrease its toxicity. However, polymer micelles suffer of the main drawback to be unstable in diluted medium, leading to a premature release of the drug, when the concentration falls down the critical micellar concentration (CMC), which it is rapidly observed after intravenous injection. This work aims at reporting on the development of a drug delivery device based on a new amphiphilic block copolymers made of degradable polyphosphate and bioeliminable poly(ethylene oxide). Thanks to their biocompatibility, biodegradability and their structure similar to natural biomacromolecules, polyphosphates are appealing polymers for biomedical applications. In contrast to aliphatic polyesters, polyphosphate properties and functionality are easily tuned via the chemical nature of the lateral chains R. In order to get rid of the CMC, the crosslinking of the micelle’s core was realized by UV radiation, in order to fulfill the increasingly stringent requirements of biomedical applications. For this purpose, photo-cross-linkable groups were introduced on the polyphosphate backbone. The effect of the crosslinking rate on the drug loading and the drug release was evaluated using doxorubicin as model drug. [less ▲]

Detailed reference viewed: 295 (7 ULg)
Full Text
See detailStar Formation and Evolution as seen with Athena
Rauw, Gregor ULg; Sciortino, Salvatore; Hornschemeier, Ann et al

in Exploring the Hot and Energetic Universe: The first scientific conference dedicated to the Athena X-ray observatory. Proceedings of a conference held 8-10 September, 2015 in Madrid, Spain. Online at <A href="http://www.sciops.esa.int/index.php?project=CONF2015&page=ATHENA2015">http://www.sciops.esa.int/index.php?project=CONF2015&page=ATHENA2015</A>, p.36 (2015, September 01)

Stars over a wide range of masses and evolutionary stages are nowadays known to emit X-rays. This X-ray emission probes the most energetic phenomena occurring in the circumstellar environment of these ... [more ▼]

Stars over a wide range of masses and evolutionary stages are nowadays known to emit X-rays. This X-ray emission probes the most energetic phenomena occurring in the circumstellar environment of these stars, and provides precious insight on magnetic phenomena or hydrodynamic shocks. Owing to its unprecedented capabilities, Athena will open up an entirely new window on these phenomena. Athena will not only allow us to study many more objects with an unprecedented spectral resolution, but will also pioneer the study of the dynamics of these objects via time-resolved high-resolution spectroscopy. These studies will lead to a deeper understanding of yet poorly understood processes which have profound impact in star formation and evolution, including at earlier times in the Universe. They also are important to understanding feedback processes on Galactic scale. [less ▲]

Detailed reference viewed: 22 (0 ULg)
Full Text
See detailMagnetic fields in O-, B- and A-type stars on the main sequence
Briquet, Maryline ULg

in European Physical Journal Web of Conferences (2015, September 01)

In this review, the latest observational results on magnetic fields in main-sequence stars with radiative envelopes are summarised together with the theoretical works aimed at explaining them.

Detailed reference viewed: 43 (10 ULg)
Full Text
See detailParameter Identification Methods in a Model of the Cardiovascular System
Pironet, Antoine ULg; Desaive, Thomas ULg; Dauby, Pierre ULg et al

Poster (2015, September 01)

To be clinically relevant, mathematical models have to be patient-specific, meaning that their parameters have to be identified from patient data. To achieve real time monitoring, it is important to ... [more ▼]

To be clinically relevant, mathematical models have to be patient-specific, meaning that their parameters have to be identified from patient data. To achieve real time monitoring, it is important to select the best parameter identification method, in terms of speed, efficiency and reliability. This work presents a comparison of seven parameter identification methods applied to a lumped-parameter cardiovascular system model. The seven methods are tested using in silico and experimental reference data. To do so, precise formulae for initial parameter values first had to be developed. The test results indicate that the trust-region reflective method seems to be the best method for the present model. This method (and the proportional method) are able to perform parameter identification in two to three minutes, and will thus benefit cardiac and vascular monitoring applications. [less ▲]

Detailed reference viewed: 50 (4 ULg)
See detailRelationship between Stroke Volume and Pulse Wave Velocity
Kamoi, Shun; Pretty, Christopher; Chiew, Yeong Shiong et al

Conference (2015, September 01)

Stroke Volume (SV) measurements are essential for evaluating patient hemodynamic status and response to therapy. However, current methods for monitoring SV require either invasive or non- invasive ... [more ▼]

Stroke Volume (SV) measurements are essential for evaluating patient hemodynamic status and response to therapy. However, current methods for monitoring SV require either invasive or non- invasive additional measurements. This study investigates the relationship between SV and Pulse Wave Velocity (PWV) to examine whether the value of PWV can capture the changes in SV. The analysis was performed using data from six porcine experiments (N=6 Pietrain Pigs, 20-29 kg) in which left ventricular volume, aortic arc pressure, and descending aortic pressure waveforms were measured simultaneously. From the measured data, correlation coefficients were determined between absolute value of aortic PWV, SV and trend value ‘PWV – mean PWV’, ‘SV – mean SV’ during periods when changes in SV were induced from preload changes, as well as infusion of dobutamine. The results showed good correlation (r = 0.59) for trend value, however, the correlation coefficient were poor with r = 0.028 for absolute value across all pigs. The analysis showed that value of PWV is reliable for capturing trend value of SV in preload changes. However, it is unreliable for capturing absolute value of SV or changes in SV made from dobutamine. [less ▲]

Detailed reference viewed: 48 (0 ULg)
See detailDevelopment of photo- or thermo-reversible cross-linked recyclable shape-memory materials
Defize, Thomas ULg; Riva, Raphaël ULg; Thomassin, Jean-Michel ULg et al

Conference (2015, September 01)

Shape-memory polymers (SMPs) are remarkable materials able to switch from a stressed deformed state (temporary shape) to their initial relaxed state (permanent shape) by the application of a stimulus ... [more ▼]

Shape-memory polymers (SMPs) are remarkable materials able to switch from a stressed deformed state (temporary shape) to their initial relaxed state (permanent shape) by the application of a stimulus, such as heat or light. Typically, the shape-memory property is generally observed for chemically or physically cross-linked polymers that exhibit an elastomeric behavior above a phase transition, e.g. glass or melting transition. As an example, cross-linked semi-crystalline poly(ε-caprolactone) (PCL) is widely studied for the development of SMPs. As most of SMPs are irreversibly cross-linked material, their reprocessing is impossible preventing any recycling. Thereby, reversible reactions, allowing the formation/cleavage of the network, raise tremendous interest for the development of new SMPs. Recently, we reported the preparation reversibly cross-linked PCL-based SMP using the Diels-Alder (DA) reaction between furan and maleimide end-groups of 4-arm star-shaped PCL, well-known to create reversible bonds. After implementation, this shape-memory material was demonstrated to be recyclable, and was characterized by excellent fixity and recovery before and after recycling experiments. However, the relatively low retro DA temperature of the furan-maleimide adducts led to an inelastic deformation during shape-memory tensile cycles. In order to get rid of this drawback, an alternative approach was investigated. The substitution of the DA reaction by a photo-reversible reaction, typically the photo-induced (2+2) cycloaddition of coumarins, was proposed to prepare cross-linked PCL matrix presenting one-way and two-way memory properties, since photolabile adducts are supposed to be stable during shape-memory tensile cycles. [less ▲]

Detailed reference viewed: 50 (3 ULg)
Peer Reviewed
See detailFitness evaluation and molecular characterization of a recombinant murine norovirus (MuNoV) during serial passages in cell culture
Ferreira de Oliveira Filho, Edmilson; Di Felice, Elisabetta; Toffoli, Barbara et al

Conference (2015, September 01)

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a ... [more ▼]

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a recombinant Wu20/CW1 strain was obtained after in vitro coinfection of RAW264.7 cells with parental MuNoV strains CW1 and Wu20 (Mathijs et al 2010). The recombinant strain showed reduced plaque size compared to the parental strains and it was suggested that this was due to modified virulence properties in vitro. The aim of this study was to observe and molecularly characterize the natural genetic evolution of the recombinant MuNoV strain across in vitro replications. Methods: MNV strains used in this study were CW1, WU20 (Thackray et al., 2007, kindly provided by prof. H. Virgin) and Rec MNV (Mathijs et al., 2010). RAW 264.7 cells (ATCC TIB-71) grown in Dulbecco’s modified Eagle’s medium (Invitrogen) complemented (DMEMc) with 10 % heat inactivated FCS (BioWhittaker), 2 % penicillin (5000 U /ml) and streptomycin (5000 mg/ml) (PS; Invitrogen) and 1 % HEPES buffer (1 M; Invitrogen). The recombinant strain was serially replicated in vitro in RAW264.7 cells (up to 14 passages). RAW 264.7 (Mouse leukaemic monocyte macrophage) cells were infected with MNV for 72 hours and afterwards lysed by freeze and thaw and viruses purified by ultracentrifugation of both cells and supernatant. Viral plaque sizes of early and late progenies (30 for each virus) were compared with the Image J software. The experiment was repeated two times. RNA was extracted from 140 ml purified suspension 1:5 diluted using the QIAamp Viral RNA Mini KitTM (Qiagen) according to the manufacturer’s instructions. cDNA was generated using a poly-A primer tagged GCCAACGACCGGGAGGCCAGC(T)20 previously described (Müller et al 2007) using superscript ii reverse transcriptase kit (Invitrogen®) treated with RNase H or with other antisense primers using iScript select kit (Bio-Rad®). For the genetic characterization two different studies were conducted. The first study aimed to develop a sequencing strategy in order to obtain the complete genome of the recombinant MNV. Then, in the second study, sequences obtained from different viral passages into RAW cells (e.g. P5 and P14) were compared in order to study the viral adaptation. Primers were designed using the Primer Express® software and netprimer® (Premier biosoft). PCR was performed using taq polymerase with thermopol buffer (new England biolabs) as per manufacturer’s instructions. Afterwards, fragments were excised from agarose gel and DNA purified using the QIAquick Gel Extraction KitTM (Qiagen) and cloning using the PGEM T easy cloning kit (Promega) plasmid DNA was transferred to sequencing by GATC Biotech (Koblenz, Germany). Results: The size of the lysis plaque surface of P2 and P14 showed a considerable divergence. The average plaque size increased from the earlier to the later progenies (from 0.1 mm2 to around 0.5 mm2). A significant difference was demonstrated between them with the Mann and Whitney non parametric statistical test. The genetic characterization of the recombinant strain obtained in vitro was previously based on partial genomic sequences, which provided limited information. Accordingly to our initial molecular analysis of 1.5 kb partial genomic sequence comprising the part of the RdRp and the part of the VP1 did not show any genetic modifications between passage 4 (accession number HM044221) and passage 14 recMNV. Therefore, a strategy for sequencing the complete genome of the different MNV strains was established. The genome of the recombinant MNV was divided into seven regions and the amplification was performed using either new designed or previous published primers. Molecular analysis using the nearly complete genome of the recombinant MNV passage 14 and the two parental strains (CW1 and WU20) showed nine modifications in the genome, comprising three aminoacid changes. Accordingly, two modification were in the RdRp region aa position 1384 Glycine (G) instead of Aspartic acid (D) and aa position 1393 Serine (S) instead of Asparagine (N) and one modification was in the capsid region one modification on aa position 296 Glutamic Acid (E) instead of Lysine. Conclusion: Even preliminary, our data provide evidence of virus adaptation to a new environment (here a cell culture system) after a recombination event. In order to specify whether these hints of genetic mutations could explain fitness modifications during in vitro evolution we need to compare the sequences of passage 14 and the previous viral cellular passages. In addition, two other parameters of in vitro virulence modification will be investigated: (i) virus production and (ii) growth kinetics. The data should provide interesting information about genetic evolution in the genus Norovirus, especially regarding recombination events and explain how a recombinant strain, first disadvantaged compared to its parental strains, could regain fitness by genetic evolution. [less ▲]

Detailed reference viewed: 17 (1 ULg)
Full Text
Peer Reviewed
See detailOrbivirus screening on dried blood spots from captive oryx in United Arab Emirates stresses the importance of pre-import measures
Martinelle, Ludovic ULg; Haegeman, Andy; Lignereux, Louis et al

Poster (2015, September 01)

Objective: Following reintroduction and conservation programs of the Arabian oryx (Oryx leucoryx) and the scimitar horned oryx (SHO, Oryx dammah) in the United Arab Emirates (UAE), import of animals from ... [more ▼]

Objective: Following reintroduction and conservation programs of the Arabian oryx (Oryx leucoryx) and the scimitar horned oryx (SHO, Oryx dammah) in the United Arab Emirates (UAE), import of animals from wild game ranches in the United States of America (USA) is not uncommon. Bluetongue virus (BTV) and epizootic hemorrhagic disease virus (EHDV) are orbiviruses that are the causative agents of bluetongue disease (BT) and epizootic hemorrhagic disease (EHD), respectively. BTV and EHDV are endemic in the UAE and the USA. Sheep and some wild ruminant species are usually severely affected by BT whereas EHD mostly affects wild animals and sometimes cattle. The objective of this study was to estimate the prevalence of these orbiviruses in Arabian and SHO from captive herds in the UAE using serology and molecular virology. Dry blood spot sampling for orbivirus screening is also discussed. Methods: A total of 175 SHO and 16 Arabian oryx were sampled. The latters were imported from Texas (USA) two weeks before sampling. All sampled animals belonged to captive herds spread over the Al Wathba area. For biosecurity reasons and to simplify blood storage, elutes from dried blood spot were used for serological and virological tests. Drops of about 80 µl of blood were dispensed on Whatman protein saver cards, and then allowed to dry in the dark at room temperature for 48 hours. Blood spots were punched out in paper discs with a 6 mm diameter punch and diluted in 250 µl PBS and Tween 20 0.05%. Eluted samples were incubated overnight at room temperature and then used immediately or stored at -80°C. To assess the most suitable ELISA kit to detect anti-BTV antibodies from the oryx discs, similar discs were prepared using blood issued from BTV seropositive and viremic as well as seronegative and non-viremic cattle. Elutes from discs with dried-blood from cattle were tested by BTV competitive ELISA (cELISA), sandwich ELISA (sELISA) and indirect ELISA (iELISA) and compared to cELISA performed directly on the serum of the same animals. iELISA on cattle paper discs gave the best correspondence with cELISA on cattle serum and was therefore used to test the oryx paper discs. Subsequently oryx paper discs were tested to detect antibodies against EHDV by cELISA. All the paper discs elutes from Arabian oryx and ELISA positive elutes from SHO were also tested by pan-BTV RTqPCR targeting a fragment of BTV segment 5 and detecting all BTV serotypes. Serotype specific end-point RT-PCR targeting a fragment of segment 2 of BTV2, BTV8, BTV10, BTV11, BTV13 and BTV17 were performed on pan-BTV positive samples. Results: Three out of 175 SHO and eight out of 16 Arabian oryx were found BTV seropositive by iELISA. None of the animals could be found seropositive against EHDV. BTV genome was detected in 1/3 seropositive SHO and in 5/16 of the Arabian oryx, amongst those 2/5 were seronegative. Overall Cq values were high (33-39). End point PCR failed to detect positive samples for any of the tested serotypes. Conclusion: BTV seroprevalence and RNA detection in SHO was very limited. By contrast BTV could be demonstrated in 5/16 imported Arabian oryx by molecular virology and in 8/16 by serology. The sampling was realized two weeks after the animals arrived in UAE and some oryx were viremic and seronegative, possibly suggesting a recent infection. Among the local SHO a low BTV seroprevalence was observed (3/175) and no animals were found positive to EHDV. This result was quite surprising because previous studies showed a higher BTV seroprevalence in domestic and wild ruminants of the Arabian Peninsula with wide local variations. In addition, dried blood spot testing has been demonstrated being a convenient and reliable method of sampling when storage conditions are hazardous. BTV serotypes could not be determined by end-point RT-PCR. At least 15 different BTV serotypes were reported in the USA and at least 10 in the Middle East, thus the oryx could be infected by a serotype not tested so far. Since RTqPCR positive values were high, the sensitivity of end-point RT-PCR might be insufficient to detect BTV out of eluted blood spots. Additional testing will be performed to identify the virus on the serotype level and therefore provide new insights to clarify the origin of the infection of the oryx. These results stress the need for pre-import risk assessment, precaution and implementation of biosecurity measures when considering translocation of wild ruminant species susceptible to BTV and EHDV. [less ▲]

Detailed reference viewed: 40 (3 ULg)
Full Text
See detailModel-Based Stressed Blood Volume is an Index of Fluid Responsiveness
Pironet, Antoine ULg; Dauby, Pierre ULg; Chase, J. Geoffrey et al

Conference (2015, September 01)

Fluid therapy is frequently used to manage acute circulatory failure. This therapy aims to restore cardiac output by fluid administration, which increases the quantity of fluid in the circulation. However ... [more ▼]

Fluid therapy is frequently used to manage acute circulatory failure. This therapy aims to restore cardiac output by fluid administration, which increases the quantity of fluid in the circulation. However, it has been shown to be effective only in certain cases, leading to the need for indices of fluid responsiveness. Total stressed blood volume has recently been shown to be such an index of fluid responsiveness. However, the current methods to determine this parameter require specific procedures. In this work, a more straightforward method is developed using data available in the intensive care unit. A simple three-chamber cardiovascular system model is used, of which total stressed blood volume is a parameter. All model parameters (including total stressed blood volume) are adjusted to pig experimental data during fluid administrations. The resulting value of total stressed blood volume is always negatively associated with the relative change in cardiac output after fluid administration. This finding confirms that total stressed blood volume is an index of fluid responsiveness. Another finding of this study is that the response curves are subject-specific. The method developed in this work can be applied to humans, since the data required is typically available in an intensive care unit. [less ▲]

Detailed reference viewed: 20 (1 ULg)
Full Text
See detailRare recombination events and occurrence of superinfection exclusion during synchronous and asynchronous infection with homologous murine norovirus strains
Elisabetta, Di Felice; Ludwig, Louisa ULg; Toffoli, Barbara et al

Poster (2015, September 01)

Objective: Human noroviruses (HuNoVs) are recognised as one of the major global causes of non-bacterial gastroenteritis with significant morbidity and mortality in developing countries and a high economic ... [more ▼]

Objective: Human noroviruses (HuNoVs) are recognised as one of the major global causes of non-bacterial gastroenteritis with significant morbidity and mortality in developing countries and a high economic impact in developed countries. Spread primarily via the faecal-oral route, HuNoV infection is typically an acute self-limiting gastrointestinal illness. However, chronic HuNoV infection of immunocompromised persons has been identified as a persistent cause of disease and viral populations in such patients have been postulated as possible reservoirs for novel NoV variants. The Norovirus genus belongs to the Caliciviridae family of small, non-enveloped, positive sense, single-stranded RNA viruses. This genus is subdivided into at least six genogroups, which infect humans and various animal species. Until the recent report of low-level infection of cultured human B cells, no viable cell culture system existed for the study of HuNoVs. The robustness of this new cell culture system still poses a major hurdle, so that the murine norovirus (MuNoV), replicating efficiently in murine dendritic or macrophage cells, remains the model of choice for in vitro study of noroviruses. The molecular mechanisms driving viral evolution and specifically that of NoVs, are accumulation of point mutations and recombination, which enables the emergence of new combinations of genetic materials to generate potentially dramatic genomic changes in a recombinant NoV, which clusters within two distinct groups of NoV strains when two different genomic regions are phylogenetically analysed. The mechanism for NoV recombination is proposed to follow the copy-choice mechanism, involving a template shift during simultaneous replication of two strains infecting the same cell. Numerous NoV recombination events have been highlighted by in silico methods and the phenomenon has recently been shown in vitro with two homologous MuNoV strains. The object of this study was to qualitatively and quantitatively assess virus progenies generated by the use of different parameters of co- and superinfection of RAW264.7 cells with two homologous MuNoV strains (CW1 and Wu20) and thus help to specify important parameters for the occurrence of recombination events. As prerequisite for recombination events, co-and superinfection are of special interest in viral diseases, such as NoV, for which a persistent stage can be developed. Methods: Viruses and Cells Murine NoVs isolates CW1 and Wu20 were plaque purified and propagated in RAW 264.7 cells (ATCC TIB-71).Virus stocks were produced by infection of RAW 264.7 cells at an MOI of 0.05 and clarified by centrifugation. Passages 8 and 7 for CW1 and Wu20, respectively, were used for the experiments. Co-infection and superinfection experiments Monolayers of RAW 264.7 cells were infected with Wu20 at a MOI of 1 on ice. After 1 h, the Wu20 inoculums were removed and stored. The cells were washed twice with PBS and infected with CW1 at various MOI (0.1 ; 1 ; 10) and at various delays of co- or superinfection (0 min, 30 min, 1 h, 2 h, 4 h, 8 h, 12 h and 24 h). For co-infections, CW1 and Wu20 were simultaneously inoculated on the cells for 1 h on ice. Twenty-four hours after CW1 co- or superinfections, cells and supernatants were collected. Molecular analysis RNA was extracted both from supernatants from the experiment and from propagations of individual plaques, reverse transcribed into cDNA and analysed via two parallel real time PCR reactions allowing discrimination between CW1 and Wu20 at both genomic extremities (regions 1 and 5, located at the ORF1 and ORF3 terminal respectively), as previously described by Mathijs et al., 2010. For analysis of the supernatants, quantifications were also performed via real time PCR. Accordingly, amplicons corresponding to region 1 were amplified for both CW1 and Wu20, then cloned and in vitro transcribed to provide a standard curve for RNA copies. Following this, values for genomic copies were deduced and results were normalised with GAPDH gene transcripts. Isolation and screening of progeny viruses A plaque assay for virus isolation from the co- or superinfection experiments was set up by modifying the protocol described by Hyde et al. (2009). Thus, after 24 h of incubation, 36 plaques were randomly picked for each condition and propagated by inoculation onto RAW 264.7 cells. After this amplification step, monitoring of recombination events was performed by PCR and Real-Time PCR on extracted, reverse transcribed viral RNA, using two sets of primers to amplify regions 1 and 5. The use of two pairs of TaqMan probes allowed discrimination of the strains WU20 and CW1 in two different regions and identification of recombinant strains. Results: Molecular analysis The Real-Time PCR performed on supernatants collected at 24 h post infection showed a greater number of copies of MuNoV Wu20 cDNA in almost all conditions, except t 0 h, 0.5 h, 1 h, 2 h at the MOI 10, where an increase in the number of copies of the CW1 strain was noted. In particular, the latter showed a peak at 1 h at the MOI 10 (89%) followed by a rapid reduction in later times (t 8 h: 20%). Interestingly, for both viruses expected ratios were never attained during the study with the notable exception of the MOI ratio 0.1/1 and the condition t1 MOI 10/1. Isolation and screening of progeny viruses Molecular analysis conducted on plaques selected in the condition of coinfection at MOI 1 and 10 highlighted a predominance of the strain MuNoV CW1 (90%) from t 0h to t 2h, followed by a sharp reduction from t 4h leading to complete absence at t 24h. The Wu20 strain showed a progressive increase from 4h (10%) to 24h (100%). Overall, the occurrence of recombination events was very rare. Only three putative recombination events were detected at t1 h MOI 1/1 and t 4 h MOI 1/1. Conclusion: The profiles of viral ratios over time are highly interesting. Particularly the infection with CW1 at the MOI 10, with a relative percentage of genomic quantifications of about 50% at the two first time points is intriguing. While the percentage is changed completely at t1 MOI 1 to give the expected ratio of 90/10, it then gradually decreases over the next time points to less than 10% at 24 h post infection. The presence of numerous recombinant viruses as a possible explanation for the t1 MOI 1 peak seems unlikely, as very few putative recombinants were detected during the screening process. The single-step growth kinetics established by Mathijs et al in 2010, showing great similarities for both strains, indicate that the replicative cycle dynamics of the viruses are probably also not responsible. The decrease, especially marked after 8 h, is suggestive of a superinfection exclusion mechanism, where productive infection with Wu20 induces a resistance of the cells to infection with the homologous CW1. Alternatively, in view of the above-mentioned growth curve at high MOI, the decrease might also be due to the end of the first replication cycle having been reached, with no more viable cells left for infection. Considering the 50% viral ratio estimated by genomic copies for the early time-points, the identification of CW1 as the predominant strain (90%) after plaque purification for the same time appears to be somewhat of a discrepancy and merits further investigation Although circulating recombinant NoV strains seem to be common, in vitro recombination is a rare event, at least in the protocol described above, and does not seem to be easily influenced by parameter changes such as time of infection and MOI. Parameters where putative recombinations were identified include t1 MOI 1 and t4 MOI 1. The possible recombinants are yet to be confirmed by sequencing reactions. Further study is necessary to understand mechanisms favouring the predominance of replication of recombinant virus strain in vivo and the challenges of such a replication in vitro. The occurrence of recombination was theoretically limited to one cycle of replication by the protocol (MOI 1 of Wu20). More than one replication cycle might be necessary to enhance the process of recombination by increasing the number of replicating events that could favour recombination. Thus, initial infection at a lower MOI might be an interesting future consideration. Other mechanisms than a time-dependent coinfection might also be worth exploring. Acknowledgements: We thank Professor Herbert Virgin and Dr Larissa Thackray (Washington University, St Louis, MO, USA) for providing the MNV isolates and RAW 264.7 cells. [less ▲]

Detailed reference viewed: 44 (5 ULg)
See detailL'emploi du conjonctif en kirundi
Tuyubahe, Pascal ULg

Conference (2015, September 01)

The verb in the conjuctive mood accompagnies always an other verb (auxiliary verb or verb in subordinate clause (valencielle or not) not introduced by a linking word. It is marked by an initial high tone ... [more ▼]

The verb in the conjuctive mood accompagnies always an other verb (auxiliary verb or verb in subordinate clause (valencielle or not) not introduced by a linking word. It is marked by an initial high tone on the first vowel after the first consonnant. After an auxiliary, the high tone disappears in the presence of -ra- morpheme in the present tense. Auxiliaries trigger raising from subject to subect and distinguish two type of morpheme -ra- in the conjunctive verb: -ra- determined syntactically and -ra- determined lexically. [less ▲]

Detailed reference viewed: 14 (2 ULg)
Full Text
See detailHD 97658 and its super-Earth
Van Grootel, Valérie ULg; Gillon, Michaël ULg; Valencia, D. et al

in European Physical Journal Web of Conferences (2015, September 01)

Super-Earths transiting nearby bright stars are key objects that simultaneously allow for accurate measurements of both their mass and radius, providing essential constraints on their internal composition ... [more ▼]

Super-Earths transiting nearby bright stars are key objects that simultaneously allow for accurate measurements of both their mass and radius, providing essential constraints on their internal composition. We present the confirmation, based on Spitzer observations, that the super-Earth HD 97658 b transits its host star. HD 97658 is a low-mass (M*=0.77+-0.05 Msun) K1 dwarf, as determined from the Hipparcos parallax and stellar evolution modeling. To constrain the planet parameters, we carry out Bayesian global analyses of Keck-HIRES radial velocities, and MOST and Spitzer photometry. HD 97658 b is a massive (Mp=7.55 +0.83,-0.79 Mearth) and large (Rp = 2.247 +0.098,-0.095 Rearth at 4.5 microns) super-Earth. We investigate the possible internal compositions for HD 97658 b. Our results indicate a large rocky component, by at least 60% by mass, and very little H-He components, at most 2% by mass. We also discuss how future asteroseismic observations can improve the knowledge of the HD 97658 system, in particular by constraining its age. [less ▲]

Detailed reference viewed: 13 (2 ULg)
Peer Reviewed
See detailERT monitoring sheds light on the hydrogeological behavior in a landfill
Dumont, Gaël ULg; Nguyen, Frédéric ULg

in EarthDoc - Near Surface Geoscience 2013 – 21th European Meeting of Environmental and Engineering Geophysics (2015, September)

Detailed reference viewed: 13 (0 ULg)
Peer Reviewed
See detailImpact of the trophic strategy on the eco-functional diversification of a coral reef fish family
Gajdzik, Laura ULg; Aguilar-Medrano, Rosalia; Parmentier, Eric ULg et al

Conference (2015, September)

The analyses of the role of trophic strategies as promoter or constraint on processes of diversification remain understudied, especially in fish. The Pomacentridae (damselfishes), a species-rich (394 ... [more ▼]

The analyses of the role of trophic strategies as promoter or constraint on processes of diversification remain understudied, especially in fish. The Pomacentridae (damselfishes), a species-rich (394 species) and worldwide distributed reef fish family, include three main trophic guilds: (1) pelagic zooplankton feeders, (2) benthic feeders grazing on turf algae or biting polyps and (3) an intermediate group feeding on zooplankton, small benthic invertebrates and algae. Our study aims to analyze the role of the trophic strategies in the eco-functional diversity of Pomacentridae. Due to its feeding versatility, we hypothesize that the intermediate trophic group is the most successful group in terms of eco-functional diversity through evolutionary time. To target our aim, we compiled detailed dietary, environmental and behavioral data for 201 pomacentrid species, and compared the eco-functional diversity among trophic guilds. Various metrics, such as functional entity (i.e. unique combinations of functional traits) and functional richness revealed that the intermediate trophic group exhibited the lowest diversity. Then, we used time-calibrated phylogenies and comparative methods to evaluate the impact of trophic strategies on the tempo of ecological diversification. Results were consistent and the lowest rate of diversification was found for the intermediate trophic group. Our study shows that a generalist trophic strategy does not promote ecological diversification but being specialized may increase the ability to evolve greater diversity. [less ▲]

Detailed reference viewed: 23 (4 ULg)
Peer Reviewed
See detailRelationship between Stroke Volume and Pulse Wave Velocity
Kamoi, Shun; Pretty, Christopher; Chiew, Yeong Shiong et al

in Preprints of the 9th IFAC Symposium on Biological and Medical Systems (2015, September)

Stroke Volume (SV) measurements are essential for evaluating patient hemodynamic status and response to therapy. However, current methods for monitoring SV require either invasive or non- invasive ... [more ▼]

Stroke Volume (SV) measurements are essential for evaluating patient hemodynamic status and response to therapy. However, current methods for monitoring SV require either invasive or non- invasive additional measurements. This study investigates the relationship between SV and Pulse Wave Velocity (PWV) to examine whether the value of PWV can capture the changes in SV. The analysis was performed using data from six porcine experiments (N=6 Pietrain Pigs, 20-29 kg) in which left ventricular volume, aortic arc pressure, and descending aortic pressure waveforms were measured simultaneously. From the measured data, correlation coefficients were determined between absolute value of aortic PWV, SV and trend value ‘PWV – mean PWV’, ‘SV – mean SV’ during periods when changes in SV were induced from preload changes, as well as infusion of dobutamine. The results showed good correlation (r = 0.59) for trend value, however, the correlation coefficient were poor with r = 0.028 for absolute value across all pigs. The analysis showed that value of PWV is reliable for capturing trend value of SV in preload changes. However, it is unreliable for capturing absolute value of SV or changes in SV made from dobutamine. [less ▲]

Detailed reference viewed: 32 (1 ULg)
Full Text
Peer Reviewed
See detailEfficacité du traitement des tendinopathies chroniques par infiltration de plasma riche en plaquettes
Kaux, Jean-François ULg; Sancerne, Audrey; Libertiaux, Vincent ULg

in 8ème Congrès Commun SFMES - SFTS (2015, September)

Introduction: Les tendinopathies sont des pathologies d’hyperutilisation essentiellement présentent chez les sportifs ainsi que les travailleurs manuels. Elles représentent près de 20% des troubles ... [more ▼]

Introduction: Les tendinopathies sont des pathologies d’hyperutilisation essentiellement présentent chez les sportifs ainsi que les travailleurs manuels. Elles représentent près de 20% des troubles musculo-squelettiques et plus de 30% des consultations en médecine générale et en médecine sportive. Ces tendinopathies peuvent être rebelles aux traitements conservateurs, raison pour laquelle de nouveaux traitements sont développés parmi lesquels figurent les infiltrations de plasma riche en plaquettes (PRP). L’objectif de notre étude est d’évaluer l’effet d’une injection de PRP suivie d’un protocole de rééducation standardisé chez des patients présentant différentes tendinopathies : épicondylites, tendinopathies du moyen glutéus, patellaires, calcanéennes et fasciites plantaires. Enfin, nous souhaitons mettre en évidence des facteurs biologiques de bon pronostic suite à un traitement par PRP. Matériels et méthodes : 51 patients atteints de différentes tendinopathies, réfractaires aux traitements de kinésithérapie classique depuis au moins 3 mois, ont reçu une injection de PRP sous contrôle échographique sans anesthésie locale. Par la suite, ils ont bénéficié d’une rééducation excentrique standardisée. Aux trois temps de l’étude (pré-injection, 6 semaines et 12 semaines), ils ont reçu une évaluation algo-fonctionnelle (EVA, PRTEE, HOOS, VISA-P, VISA-A, FAAM) en fonction de la localisation de la tendinopathie et une évaluation de la douleur par un algomètre de pression. Résultats : Les résultats montrent d’une manière générale une amélioration significative de l’EVA (p=0,01) après 3 mois de suivi et une amélioration de l’algomètre de pression entre 6 et 12 semaines (p=0,05). Pour les épicondylites, les améliorations sont significatives pour l’EVA (p=0,017) et le PRTEE (p=0,0036) au terme de l’étude. Les tendinopathies du moyen glutéus, patellaires et les fasciites plantaires montrent également une amélioration clinique mais non significative (nombre de sujets trop faible). Concernant les tendinopathies d’Achille, l’EVA (p<0.001) et le VISA-A (p=0,018) évoluent de manière significative après les 6 premières semaines. Aucune relation n’a été mise en évidence entre l’évolution de l’EVA et de l’algomètre de pression et les paramètres biologiques. Conclusions : Une injection de PRP couplée à un programme de rééducation excentrique présente des effets positifs au niveau de la symptomatologie douloureuse et la fonctionnalité pour les épicondylites et les tendinopathies d’Achille. Malgré l’absence de résultats significatifs, la tendance est à l’amélioration clinique concerne également les tendinopathies du moyen glutéal, patellaires et les fasciites plantaires. [less ▲]

Detailed reference viewed: 62 (1 ULg)
Peer Reviewed
See detailCell-based description of ventricular contraction in a model of the human cardiovascular system
Kosta, Sarah ULg; Negroni, Jorge; Lascano, Elena et al

in Preprints of the 9th IFAC Symposium on Biological and Medical Systems (2015, September)

A multiscale model of the cardiovascular system (CVS) is presented. Hemodynamics is described by a lumped parameter model, while heart contraction is described at the cellular scale. An ... [more ▼]

A multiscale model of the cardiovascular system (CVS) is presented. Hemodynamics is described by a lumped parameter model, while heart contraction is described at the cellular scale. An electrophysiological model and a mechanical model were coupled and adjusted so that the pressure and volume of both ventricles are linked to the force and length of a half-sarcomere. Particular attention was paid to the extremal values of the sarcomere length, which must keep physiological values. This model is able to reproduce healthy behavior, preload variations experiments, and ventricular failure. [less ▲]

Detailed reference viewed: 21 (1 ULg)
Peer Reviewed
See detailThe materiality of Intangible Cultural Heritage: food and social encounters.
Mescoli, Elsa ULg

Conference (2015, September)

Following the patrimonialization process of the Mediterranean diet, some gastronomies found themselves involved within a common framework of food traditions. Some regional practices, indicated as ... [more ▼]

Following the patrimonialization process of the Mediterranean diet, some gastronomies found themselves involved within a common framework of food traditions. Some regional practices, indicated as representative of national food cultures, were chosen to illustrate a shared heritage that historically took a shape around the Mediterranean sea. This heritage, still concretely performed, needed to be stated and preserved against the globalization of food practices. Institutional and political dynamics, occurring on a transnational level, triggered this process, which is nevertheless not detached from the communities involved. Common people played a fundamental role not only in promoting the patrimonialization process itself, but above all in concretely perpetuating some traditions and in spreading them in the contemporary world. In particular, some different cultural groups that found themselves living a common territory and social context thanks to migration, began dialoguing about their own food traditions, starting from some shared elements. As a consequence, some gastronomies interact through people’s practices and define in relation one to the other. This is the case, among others, of Moroccan and Italian cuisine. Throughout a doctoral research conducted within a group of Moroccan women living in the North of Italy, I collected an amount of ethnographic materials showing how social encounters developed through food. The influence of the patrimonialization process on these encounters made people try to find similarities among different traditional practices or to describe some ways of reinterpreting them in reason of the new context. My presentation will focus on these dynamics, thus proving that the Intangible Cultural Heritage is indeed grounded on materiality, that is, in this case, the concrete performance of food practices and their pragmatic effects on relations among humans. [less ▲]

Detailed reference viewed: 44 (1 ULg)
Full Text
See detailRèglement EU 650/2012 sur les successions et planification successorale
Wautelet, Patrick ULg

Conference (2015, September)

Detailed reference viewed: 31 (0 ULg)
See detailNature des villes, nature des champs : Synergies et controverses. Journée de terrain à La Louvière (Belgique)
Schmitz, Serge ULg; Cornut, Pierre; Dubois, Charline ULg et al

Conference (2015, September)

Comment une ville moyenne, née du charbon et de l'industrialisation, se restructure pour s'inscrire sur la carte de Belgique et maintenir activités économiques et habitants? Entre patrimoine Unesco, Plan ... [more ▼]

Comment une ville moyenne, née du charbon et de l'industrialisation, se restructure pour s'inscrire sur la carte de Belgique et maintenir activités économiques et habitants? Entre patrimoine Unesco, Plan Communal de Développement de la Nature et Rénovation urbaine, nous analyserons les divers projets d'amélioration du cadre de vie et d'intégration de la nature tant côté ville que côté campagne. [less ▲]

Detailed reference viewed: 19 (1 ULg)
Peer Reviewed
See detailChanging public viewpoints on wind energy development in Belgium
Vanderheyden, Vincent ULg; Schmitz, Serge ULg

in Abstracts. Energy Landscapes: Perception, Planning, Participation and Power. European Conference of the Landscape Research Group, Dresden, 16‐18 September 2015 (2015, September)

The amount of wind turbines has increased exponentially in Belgium in the last eight years (175 in 2007, 771 in 2015). During this period, especially in the last two years, critics of this energy have ... [more ▼]

The amount of wind turbines has increased exponentially in Belgium in the last eight years (175 in 2007, 771 in 2015). During this period, especially in the last two years, critics of this energy have become more organised, virulent, and active in delaying or stopping many projects. The landscape impact of wind energy is central to their arguments. We wonder if people’s attitudes towards wind turbines and landscape changed in the last years in Belgium and how they changed. This paper compares public perception of wind energy in two researches about landscape perception. The two studies used slightly different methodologies but with similarities in the designs, allowing some comparisons. The first research (2007‐2009) aimed to study the perceived landscape impact and the social acceptance of wind turbines in Belgium. 1542 Belgians were surveyed about their landscape preferences using a photo‐questionnaire, including some pictures with wind turbines. 75 stakeholders of wind energy projects were also interviewed. The second research (2012‐2014) aimed to examine deeper the landscape preferences among 54 residents in three areas in Wallonia where wind turbines are present, using the previous photographs. During the conduct of the first research, changing attitudes were already observed. People had become more familiar with wind turbines and were less reluctant. The symbolic positive aspect of wind energy was highlighted seven years ago. This view continues. However, people seem more categorical in their viewpoint. All respondents have now been confronted to wind energy, which was not the case seven years ago. Some persons are not against wind farms but their increase in number start to overwhelm them. Others point they get used to the turbines, as long as they are not too many and too close. The huge increase in wind farms in the last seven years has changed the acceptance of wind energy. Some doubts about the real efficiency of this energy also shaped the attitudes. [less ▲]

Detailed reference viewed: 60 (11 ULg)
Full Text
See detailBrain trains: scenario development to explore intermodal rail transport expansion in, from and towards Belgium
Troch, Frank; Vanelslander, Thierry; Belboom, Sandra ULg et al

Conference (2015, September)

Detailed reference viewed: 24 (5 ULg)
Full Text
Peer Reviewed
See detailSilurian acritarchs and associated freshwater and marine microfloras from Saudi Arabia: comprehensive review and new insights
Le Hérissé, A.; Steemans, Philippe ULg; Breuer, P. et al

Conference (2015, September)

Detailed reference viewed: 28 (5 ULg)
See detailInvolvement of adamalysin proteases in modulations of tumor microenvironment and premetastatic niches.
Donati, Kim ULg; Bekaert, Sandrine; Sepult, Christelle ULg et al

Poster (2015, September)

Detailed reference viewed: 14 (1 ULg)
Full Text
Peer Reviewed
See detailEfficacité à long terme d’une infiltration de plasma riche en plaquettes pour traiter une tendinopathie patellaire proximale
Kaux, Jean-François ULg; Honoré, Morgan; Evrard, Frédéric

in 8ème Congrès Commun SFMES - SFTS (2015, September)

Introduction: Les tendinopathies sont des pathologies d’hyper-utilisation très fréquentes, tant chez des sujets sportifs ou non-sportifs. Leur incidence est actuellement en augmentation. La tendinopathie ... [more ▼]

Introduction: Les tendinopathies sont des pathologies d’hyper-utilisation très fréquentes, tant chez des sujets sportifs ou non-sportifs. Leur incidence est actuellement en augmentation. La tendinopathie patellaire proximale est une des tendinopathies les plus réfractaires au traitement conservateur et peut affecter la qualité de vie en limitant les activités sportives qu'elles soient récréationnelles ou professionnelles. Objectifs : L’objectif de cette étude est d’évaluer les effets à long terme du PRP pour traiter les tendinopathies patellaires proximales et éventuellement d’en identifier des facteurs de bon pronostic. Matériel et méthodes: 25 tendinopathies patellaires proximales ont été traités par PRP et ont été suivie à plus d’un an (dont 9 sujets sont suivi jusque 48 mois post-infiltration). Les patients sont évalués selon les questionnaires VISA-P, IKDC et un questionnaire reprenant leurs habitudes. Les scores VISA-P et IKDC sont croisés avec le troisième questionnaire afin d’obtenir des moyennes en rapport avec les réponses de ce dernier. Résultats : Aucun patient n’a été traité par chirurgie après l’infiltration. L’évolution des patients a tendance à être toujours positive jusqu’à 48 mois. Les facteurs semblant être bénéfiques sur l’évolution des patients sont : l’activité sportive à une fréquence de six à huit heures de sport par semaine, la réalisation d’exercices excentriques à domicile, une hydratation de plus d’un litre et demi par jour, un échauffement de plus de dix minutes ainsi que l’âge des patients (<30 ans). Conclusion : Le traitement d’une tendinopathie patellaire proximale par infiltration de PRP est efficace à long terme (jusque 4 ans). La réalisation d’exercices excentriques réguliers semble nécessaire et permet d’observer la poursuite de l’amélioration clinique des patients. [less ▲]

Detailed reference viewed: 24 (0 ULg)
See detailObservations of Mars aurorae
Gérard, Jean-Claude ULg; Soret, Lauriane ULg; Libert, Ludivine ULg et al

Conference (2015, September)

We present recent results obtained by combining remote sensing observations and in situ measurements of the Martian aurora made from Mars Express.

Detailed reference viewed: 34 (8 ULg)
Full Text
See detailA new hybrid approach for modelling groundwater flow in karst aquifers
Willems, Thibault ULg; Hakoun, Vivien ULg; Renard, Philippe et al

Conference (2015, September)

Groundwater flow modelling in karst aquifers represents a real challenge that requires adapted methods. The applicability of an innovative hybrid approach for modelling groundwater flow in karst aquifers ... [more ▼]

Groundwater flow modelling in karst aquifers represents a real challenge that requires adapted methods. The applicability of an innovative hybrid approach for modelling groundwater flow in karst aquifers, namely the Hybrid Finite Element Mixing Cell (HFEMC) method, is evaluated. The hybrid approach consists in combining a classical finite element (FE) model, to model slow flow in the rock matrix, with spatially distributed lumped reservoirs, to model fast flow in the karst conduits network. Water exchanges between the rock matrix and the conduits network are accounted for by means of an internal Fourier boundary conditions (BC). This BC (1st order exchange relation) allows to control the magnitude of water transfers between fast and slow flow domains. We tested the applicability of the HFEMC method on a schematic synthetic domain and on a real karst system. In the synthetic case analysis, we discussed dynamic processes of groundwater storage occurring in the karst system during a recharge pulse. The study focuses on the influence of selected parameters on representative variables such as the discharge curve of the karst system or pressure and mass transfers between conduits and rock matrix sub-domains. In this way, an inversion of the hydraulic gradient between karst conduits and the surrounding rock matrix is shown to occur during the recharge pulse. This phenomenon results in a temporary storage of water from conduits to the rock matrix, which impacts the modelled discharge curve. The first test performed on a real study site, the Noiraigue spring karst system (Jura mountains, Switzerland), exemplify the use of two separated lumped reservoirs for describing the conduits network, which allows to consider two base levels in the karst system. It also points out the challenges to face when modelling a complex natural karst system with the HFEMC approach. The results obtained show that the HFEMC approach is a good candidate to model groundwater flow in karst aquifers. [less ▲]

Detailed reference viewed: 59 (17 ULg)
See detailGalland épigraphiste et philologue classique
Famerie, Etienne ULg

in Bauden, Frédéric; Waller, Richard (Eds.) Actes du Colloque "Antoine Galland (1646-1715) : orientaliste, antiquaire, numismate, humaniste" (2015, September)

Detailed reference viewed: 23 (4 ULg)
Full Text
Peer Reviewed
See detailA perfect estimation of a background image does not lead to a perfect background subtraction: analysis of the upper bound on the performance
Pierard, Sébastien ULg; Van Droogenbroeck, Marc ULg

in International Conference on Image Analysis and Processing (ICIAP) (2015, September)

The quest for the “best” background subtraction technique is ongoing. Despite that a considerable effort has been undertaken to develop flexible and efficient methods, some elementary questions are still ... [more ▼]

The quest for the “best” background subtraction technique is ongoing. Despite that a considerable effort has been undertaken to develop flexible and efficient methods, some elementary questions are still unanswered. One of them is the existence of an intrinsic upper bound to the performance. In fact, data are affected by noise, and therefore it is illusory to believe that it is possible to achieve a perfect segmentation. This paper aims at exploring some intrinsic limitations of the principle of background subtraction. The purpose consists in studying the impact of several limiting factors separately. One of our conclusions is that even if an algorithm would be able to calculate a perfect background image, it is not sufficient to achieve a perfect segmentation with background subtraction, due to other intrinsic limitations. [less ▲]

Detailed reference viewed: 74 (16 ULg)
Full Text
See detailDetermination of air‐sea ice transfer coefficient for CO2: Significant contribution of gas bubble transport during sea ice growth
Kotovitch, Marie ULg; Moreau, S.; Zhou, Jiayun et al

Poster (2015, September)

Air‐ice CO2 fluxes were measured continuously from the freezing of a young sea‐ice cover until its decay. Cooling seawater was as a sink for atmospheric CO2 but asthe ice crystalsformed,sea ice shifted to ... [more ▼]

Air‐ice CO2 fluxes were measured continuously from the freezing of a young sea‐ice cover until its decay. Cooling seawater was as a sink for atmospheric CO2 but asthe ice crystalsformed,sea ice shifted to a source releasing CO2 to the atmosphere throughout the whole ice growth. Atmospheric warming initiated the decay, re‐shifting sea‐ice to a CO2 sink. Combining these CO2 fluxes with the partial pressure of CO2 within sea ice, we determined gas transfer coefficients for CO2 at air‐ice interface for growth and decay. We hypothesize that this difference originates from the transport of gas bubbles during ice growth, while only diffusion occurs during ice melt. In parallel, we used a 1D biogeochemical model to mimic the observed CO2 fluxes. The formation of gas bubbles was crucial to reproduce fluxes during ice growth where gas bubbles may account for up to 92 % of the upward CO2 fluxes. [less ▲]

Detailed reference viewed: 20 (0 ULg)
Full Text
Peer Reviewed
See detailNonlinear Background Filter to Improve Pedestrian Detection
Wang, Yi; Pierard, Sébastien ULg; Su, Song-Zhi et al

in New Trends in Image Analysis and Processing - ICIAP 2015 Workshops (2015, September)

In this paper, we propose a simple nonlinear filter which improves the detection of pedestrians walking in a video. We do so by first cumulating temporal gradient of moving objects into a motion history ... [more ▼]

In this paper, we propose a simple nonlinear filter which improves the detection of pedestrians walking in a video. We do so by first cumulating temporal gradient of moving objects into a motion history image (MHI). Then we apply to each frame of the video a motion-guided nonlinear filter whose goal is to smudge out background details while leaving untouched foreground moving objects. The resulting blurry-background image is then fed to a pedestrian detector. Experiments reveal that for a given miss rate, our motion-guided nonlinear filter can decrease the number of false positives per image (FPPI) by a factor of up to 26. Our method is simple, computationally light, and can be applied on a variety of videos to improve the performances of almost any kind of pedestrian detectors. [less ▲]

Detailed reference viewed: 54 (11 ULg)
Full Text
Peer Reviewed
See detailSurface aeration in baffled stirred tanks: hydrodynamics, mixing and mass transfer characteristics
de Lamotte, Anne ULg; Delafosse, Angélique ULg; Calvo, Sébastien ULg et al

Poster (2015, September)

Biotechnological and chemical processes often need a supply of gas for acceptable product formation. In some applications - where either gas requirements/reactor volumes are relatively low, or bubbles are ... [more ▼]

Biotechnological and chemical processes often need a supply of gas for acceptable product formation. In some applications - where either gas requirements/reactor volumes are relatively low, or bubbles are undesirable - aeration through the liquid free-surface is enough to meet the demand. In case of sparged stirred tanks, aeration through the liquid free-surface is a factor to be determined when scaling-up /down processes. Gas-liquid transfer is strongly influenced by the hydrodynamic conditions. Two phenomena, occurring at different scales, can be coupled in order to explain mass transfer : (i) circulation (macroscale) and (ii) mixing/homogenization (microscale). Mixing/homogenization takes into consideration the small eddies responsible for the rippled liquid free-surface and for the concentration gradients surrounding it. Circulation determines the fluid path across the reactor as well as its contribution of the surface aeration and leads to periodic and local deformation of the liquid free-surface. Circulation also accounts for the design of the reactor, where the scaling problems are focused. The objective of this work is to develop an experimental approach able to fully (global and local quantities) characterize a chosen agitation configuration in terms of hydrodynamics, mixing and transfer, in order to assess the capability of computational methods to predict gas-liquid mass transfer due to aeration through the liquid free-surface. [less ▲]

Detailed reference viewed: 36 (11 ULg)
See detailIconologies contemporaines : une compréhension symbolique de l’image est-elle toujours d’actualité ?
Hagelstein, Maud ULg

Conference (2015, September)

Le problème que je voudrais envisager ici tient à la pertinence de la compréhension symbolique de l’image. Il me semble qu’à première vue, la théorie de l’image contemporaine met en défaut ... [more ▼]

Le problème que je voudrais envisager ici tient à la pertinence de la compréhension symbolique de l’image. Il me semble qu’à première vue, la théorie de l’image contemporaine met en défaut l’interprétation symbolique de l’image. Ce débat peut être rapporté au problème de l’héritage, par les nouvelles générations de spécialistes de l’image, de la discipline de l’ICONOLOGIE et à la réception des travaux des grands historiens/théoriciens de l’art qui l’ont fondée. Depuis la fin des années 1980, de nombreuses tentatives visent à donner au concept d’iconologie un sens actuel. Au point que l’on peut – sans dénaturer cet élan théorique nouveau – parler d’« iconologies contemporaines ». La méthode iconologique vise l’interprétation du contenu symbolique des images. Elle repose donc entièrement sur une compréhension symbolique du visuel, et s’est d’ailleurs nourrie du dialogue avec la philosophie des formes symboliques d’E. Cassirer. Dans le système décrit par Cassirer, l’art se définit en tant que fonction symbolique (ce qui revient à dire = l’art est un domaine de production de significations, dont la vocation principale serait de charger de sens des éléments sensibles/matériels). Cette fonction symbolique particulière serait en outre inscrite dans un devenir historique (puisque le « contenu » des œuvres, les éléments de sens associés aux éléments sensibles, dépend fortement du contexte socio-historique d’inscription et reflète/révèle une vision du monde historiquement déterminée). Depuis la fin des années 1980, cette méthode a commencé à générer chez les théoriciens de l’art et du visuel (en général), toutes sortes de réactions d’insatisfaction – voire même d’hostilité. Les différentes réactions (je vais en détailler trois aujourd’hui : T. Mitchell, G. Didi-Huberman et G. Boehm) s’accordent (ou en tout cas pourraient s’accorder) sur le fait que l’iconologie doit être complétée : l’approche symbolique des œuvres doit par ex. pouvoir s’appuyer sur une attention soutenue à leur matérialité (c’est à cet endroit que les outils « phénoménologiques », notamment, viennent au secours de l’analyse). [less ▲]

Detailed reference viewed: 21 (1 ULg)
Full Text
Peer Reviewed
See detailReview of existing solutions and presentation of a simplified method for the crashworthiness of lock gates
Buldgen, Loïc ULg; Ehlers, Sören; Le Sourne, Hervé et al

in Proceedings of the Smart Rivers 2015 Conference (2015, September)

Detailed reference viewed: 22 (3 ULg)
Full Text
See detailImpact of forest transition on non-timber forest products in Centrak Africa
Gillet, Pauline ULg; Vermeulen, Cédric ULg; Feintrenie, Laurène

Conference (2015, September)

The objective of the study is to evaluate the impact of deforestation on non-timber forest products (NTFPs) harvest in Central Africa. The most common vegetal NTFPs are fruits, barks and leaves used as ... [more ▼]

The objective of the study is to evaluate the impact of deforestation on non-timber forest products (NTFPs) harvest in Central Africa. The most common vegetal NTFPs are fruits, barks and leaves used as complements to the staple food (cassava or plantain). Animal NTFPs such as caterpillars, worms and bush meat represent a major source of animal protein in the villagers’ diet. We analyzed the evolution of several parameters including NTFPs diversity, distance to the road, changes in land tenure rules, proportion in the alimentary bolus and in the villagers’ incomes. The research is based on field surveys, participatory mapping and geolocation of activities held in 8 villages. Three study sites are located at different stages on Mather’s forest transition curve (Mather, 1992). This curve shows the relationship between forest cover and population density. The sites represent the situations: (i) important cover of intact forest, (ii) forest partially degraded and under pressure of conversion to other land uses and (iii) small surfaces of degraded forest with a trend of plantation of useful trees on deforested land. Results show a reduction in NTFPs diversity along with the increase of deforestation. The maximum distance of collection sites to the road increases between the first and the second study site, as a consequence of the decrease in the quantity of NTFPs available. This distance decreases significantly in the third study site due to the contraction of villages’ terroir. The diversity of bush meat decreases while the hunting bag evolves from big to small species along with the forest transition. Land tenure rules to access and extract NTFPs become stricter. As a consequence, the proportion of these products reduces in the alimentary bolus and in the family cash income. This analysis establishes a strong link between Mather’s forest transition curve and the decline of the importance of NTFPs in the village production and livelihoods systems [less ▲]

Detailed reference viewed: 32 (0 ULg)
Full Text
Peer Reviewed
See detailQuality of life and physical components linked to sarcopenia: baseline data of the SarcoPhAge study
Beaudart, Charlotte ULg; Reginster, Jean-Yves ULg; Petermans, Jean ULg et al

in European Geriatric Medicine (2015, September), 6S1

Detailed reference viewed: 33 (5 ULg)
Peer Reviewed
See detailAnalysis of the time-dependent electrical current in reverse-biased p-GeSn/n-Ge mesa diodes
Baert, Bruno ULg; Gupta, Somya; Gencarelli, Federica et al

Poster (2015, September)

Detailed reference viewed: 23 (0 ULg)
See detailSea ice in the global biogeochemical cycles: How much do we care?
Vancoppenolle, M.; Moreau, S.; Bopp, L. et al

Conference (2015, September)

Large changes in the state and seasonality of sea ice are expected for this century in both hemispheres. The impact of these changes on marine biogeochemical cycles and ecosystems is difficult to predict ... [more ▼]

Large changes in the state and seasonality of sea ice are expected for this century in both hemispheres. The impact of these changes on marine biogeochemical cycles and ecosystems is difficult to predict. Will the polar oceans be more or less biologically productive? Will they take up more or less carbon? At this stage, the answers to these key questions are not obvious. Marine biogeochemical cycles in the sea ice zone are characterized by specific processes that have been unravelled over the last 20 years or so. They involve active biological and chemical processes within the sea ice, the modulation of heat and gas exchanges by the ice cover; and the impact of growing and melting sea ice on the water column stratification and vertical exchanges in the water. To understand how sea ice influences marine biogeochemical cycles, the sea ice biogeochemical community focuses on: (i) the synthesis of existing data and the interpretation of robust large-scale patterns; (ii) the introduction of new representations of sea ice processes into large-scale models of the Earth System and the study of their impact; (iii) the evaluation of existing observation methods and the development of new ones. In this talk, I will review and synthesize recent research activities in these lines of thought. [less ▲]

Detailed reference viewed: 34 (0 ULg)
Full Text
See detailRegional occurence of greenhouses gases in groundwater: Initial results in shallow Belgian aquifers.
Hakoun, Vivien ULg; Gesels, Julie ULg; Tseng, Jean Hsiao-Chun et al

Poster (2015, September)

Currently, the lack of robust, context-distributed subsurface greenhouses gases (GHG) concentrations data is a key bottleneck to reduce the uncertainty range of GHG groundwater input to continental ... [more ▼]

Currently, the lack of robust, context-distributed subsurface greenhouses gases (GHG) concentrations data is a key bottleneck to reduce the uncertainty range of GHG groundwater input to continental surface water bodies such as rivers or lakes estimates. Carbon dioxyde (CO2), methane (CH4) and nitrous oxyde (N2O) are likely to be indirectly transferred to the atmosphere through groundwater discharge into continental surface water bodies. We aim to extend regional-scale estimates of indirect GHG emissions by screening, in numerous hydrogeological (such as alluvial, sandstone, chalk and limestone aquifers) and land use contexts (such as industrial and agricultural), the occurence of these gases. Here, we report and discuss CO2, CH4 and N2O concentrations from an initial survey conducted over selected sites (n= 40) within shallow (0-100 m depth) aquifers in Wallonia (Belgium) for the first time. The preliminary results obtained in this study show that the range of GHG concentrations varies between 5160 and 47544 ppm, 0 and 1064 nmol.L-1, as well as 1 and 5637 nmol.L-1 for the partial pressure of CO2, CH4 and N2O respectively. This new and unique regional dataset provides a first step in developping a refined understanding of favorable contexts for GHG occurence in groundwater which may be used to reduce the uncertainties related to indirect emissions of GHG through groundwater-surface water transfers. [less ▲]

Detailed reference viewed: 71 (16 ULg)
Full Text
See detailMaximal fidelity between symmetric multiqubit states and entanglement classes
Neven, Antoine ULg; Mathonet, Pierre ULg; Gühne, Otfried et al

Poster (2015, September)

We present the results of our research concerning a conjecture about the maximal fidelity between a symmetric (permutation invariant) multiqubit state and the states belonging to a given entanglement ... [more ▼]

We present the results of our research concerning a conjecture about the maximal fidelity between a symmetric (permutation invariant) multiqubit state and the states belonging to a given entanglement class. [less ▲]

Detailed reference viewed: 30 (2 ULg)
Peer Reviewed
See detailRELY – short term scientific missions
Schmitz, Serge ULg

in Abstracts. Energy Landscapes: Perception, Planning, Participation and Power. European Conference of the Landscape Research Group, Dresden, 16‐18 September 2015 (2015, September)

The COST Action TU1401 ‘Renewable Energy and Landscape Quality’ ('RELY') encourages Short Term Scientific Missions (STSMs). This Action investigates “the inter‐relationships between renewable energy ... [more ▼]

The COST Action TU1401 ‘Renewable Energy and Landscape Quality’ ('RELY') encourages Short Term Scientific Missions (STSMs). This Action investigates “the inter‐relationships between renewable energy production and landscape quality, and the role of public participation for the acceptance of renewable energy systems”. STSMs are exchange visits from five working days until three months that are aiming to strengthen the existing networks by allowing individual scientists to go to an institution or laboratory in other COST country to foster collaboration and contribute to the scientific objectives of the COST Action. Each year of the COST Action TU1401, there are up to six STSMs to be awarded. The financial support is a contribution to the costs of a STSM. A grant (maximum 2500€ depending on the duration of the stay) covers travel and subsistence. We invite researchers, especially early stage researchers, to participate in a STSM. The selection of STSM applicants is based on the scientific scope of the STSM application that must be in line with the Cost Action TU1401 objectives. This short communication aims to inform of the next calls and presents the result of the 2015 call. [less ▲]

Detailed reference viewed: 26 (0 ULg)
Full Text
Peer Reviewed
See detailChanges in biting characteristics recorded using the inertial measurement unit of a smartphone reflect differences in sward attributes
Andriamandroso, Andriamasinoro ULg; Lebeau, Frédéric ULg; Bindelle, Jérôme ULg

in Guarino, Marcella; Berckmans, Daniel (Eds.) Precision Livestock Farming '15 (2015, September)

Accurate monitoring of grazing activity at individual cow level would provide useful information to farmers to improve the management of their animals and pastures in intensive dairy systems. Pasture ... [more ▼]

Accurate monitoring of grazing activity at individual cow level would provide useful information to farmers to improve the management of their animals and pastures in intensive dairy systems. Pasture attributes, starting with sward height, influence grazing behaviour and bites characteristics. In an attempt to link sward height to an individual automated detection of biting behaviour, a series of recording sessions of 4×3 days were realized on a ryegrass pasture with two contrasting heights (5 and 15 cm) over the grazing season (from July to October) with 4 dry red-pied cows equipped with the inertial measurement unit (IMU) of a smartphone on a halter, recording acceleration data at 100Hz. The behaviours were video-recorded. The number of grazing bouts performed during grazing trends to increase when the grass is highest. Fourier transforms of acceleration data showed that grazing bouts were characterized by a distinctive acceleration peak which frequency ranged between 1.02Hz and 1.46Hz whatever the sward height. It corresponded to the uprooting of grass frequency in the biting movement when compared with the observation in the video recordings and it could be used to improve automated grazing behaviour detection and to remotely characterize bites. These results show that some bite characteristics are influenced by sward height and automated individual monitoring of grazing behaviour is possible. An extension of this methodology should allow analysing more deeply the grazing behaviour of cattle in order to determine number of bites and possibly to link it to biomass intake. [less ▲]

Detailed reference viewed: 47 (21 ULg)
Full Text
Peer Reviewed
See detailCadaveric VOC profiling from human internal cavity
Stefanuto, Pierre-Hugues ULg; Varlet, Vincent; Grabherr, Silke et al

Conference (2015, September)

The processes tacking place during body decomposition is not yet totally understood. Soon after death, the different parts of a body start to decompose. This phenomenon conduct to the production of gases ... [more ▼]

The processes tacking place during body decomposition is not yet totally understood. Soon after death, the different parts of a body start to decompose. This phenomenon conduct to the production of gases inside or around the different organs. These gases reservoirs can be located using imaging tools as post-mortem computed tomography (PMCT) and subsequently sample (1). The analysis of very volatile compounds inside these internal cavities already provides useful information for legal medicine investigations (2). It gives valuable information about the potential cause of death avoiding the invasiveness of the autopsy procedure. This project wanted to perform an untargeted screening of this internal cavity in order to monitor the decomposition process taking place inside a cadaver. The analytical method was base on previously used techniques for complete decomposition analysis (3-4). This study wanted to investigate the volatile organic compounds (VOC) mixture present in these cavities. To achieve this task, we applied solid phase micro-extraction (SPME) combined with two-dimensional gas chromatography coupled to high-resolution time of flight mass spectrometer (GC×GC-HRTOFMS). The first point was to demonstrate the ability of GC×GC-HRTOFMS to detect these VOC. The combination of different statistical approaches conducted to establishment of potential biomarkers list. Base on these biomarkers identification, different decomposition stages were observed for different organs in the same body. The cardiac area seems to decompose faster than the other tissues studied in this project. References 1. Levy A.D. et al., Am. J. Forensic Med. Pathol. (2010) 31, 12-17. 2. Varlet V. et al., Anal. Chim. Acta (2013) 784, 42-46. 3. Stadler S. et al., Anal Chem (2013) 85, 998–1005. 4. Stefanuto et al. CPC (2014) 79, 786-789. [less ▲]

Detailed reference viewed: 52 (11 ULg)
See detailBaseline data on the cyanobacterial diversity of Svalbard assessed by pyrosequencing
Laughinghouse IV, Haywood Dail; Stelmach Pessi, Igor ULg; Velázquez, David et al

Poster (2015, September)

Detailed reference viewed: 16 (2 ULg)
Full Text
Peer Reviewed
See detailInvestigation of volatile mixture emit by human tissues degradation
Stefanuto, Pierre-Hugues ULg; Dubois, Lena; Lloyd, Rebecca et al

Conference (2015, September)

Human rescue dog unit are the more efficient tool to locate cadaver or people trap after a natural disaster. However, the dog training process is long and expensive. Dog trainers are always looking for a ... [more ▼]

Human rescue dog unit are the more efficient tool to locate cadaver or people trap after a natural disaster. However, the dog training process is long and expensive. Dog trainers are always looking for a better understanding of the dog olfaction matching to improve their training methods (1). During these training sessions, dogs are usually trained to locate body pieces due to the difficulty to obtain a full cadaver. Moreover, some training aid solution are available but their compositions and their efficiencies are not worldwide recognized (2). To answer these questions, this project is monitoring the headspace human organs during the decomposition process. Five different organs are used: heart, lung, liver, kidney and blood. Every organs are sampled in triplicates and let to decompose in glass jar. Regularly, the headspace of the jar is sample by dynamic pumping to sorbent tubes that will further be injected on comprehensive two-dimensional gas chromatography system (GC×GC). GC×GC is a powerful analytical tool that allows the complete resolution of “the smell of death”, i.e. the decomposition odor (3-4). The compounds identified in the organs headspace can be compared with the one coming from decomposition studies on full bodies to establish a biomarkers list that will further be used for dog training solution elaboration. References 1. Hoffman et al. FSI (2009) 186, 6-13. 2. Stadler et al. J. Chrom. A. 1255, 202-206. 3. Stefanuto et al. CPC (2014) 79, 786-789. 4. Perrault et al. J. Sep. Sci. (2015) 38, 73-80. [less ▲]

Detailed reference viewed: 67 (12 ULg)
Full Text
See detailMT4-MMP, a potential therapeutic target in triple negative breast cancer
Yip, Cassandre ULg; FOIDART, Pierre ULg; SOMJA, Joan ULg et al

Poster (2015, September)

MT4-MMP and EGFR axis may have a significant role in patient outcome and response to EGFR targeted therapy. This axis is clinically relevant in TNBC, the most aggressive breast cancer subtype. TNBC are ... [more ▼]

MT4-MMP and EGFR axis may have a significant role in patient outcome and response to EGFR targeted therapy. This axis is clinically relevant in TNBC, the most aggressive breast cancer subtype. TNBC are known to express high level of EGFR and treatment options are limited due to the non response of to the EGFR targeted therapy. Expression levels of MT4-MMP and EGFR in TNBC may be used as prognosis factor for the selection of patient who may respond or not to EGFR targeted therapy. Also, our data shed light and the potential therapeutic option of targeting both MT4-MMP and EGFR in TNBC. [less ▲]

Detailed reference viewed: 32 (13 ULg)
Full Text
Peer Reviewed
See detailChallenging land fragmentation thanks a mobile milking robot: Statement of 2 cases of implementation: Liège and Trevarez experimental farms
Brocard, Valérie; Dufrasne, Isabelle ULg; Lessire, Françoise ULg et al

in Conington, J; Klopcic, M; Lauridsen, C (Eds.) et al Book of abstracts of the 66th annual meeting of the European Federation of Animal Science (2015, September)

Cette présentation fait le point de l'expérience de l'utilisation de 2 robots mobiles, développés comme prototypes à la Ferme expérimentale de Trévarez et à l'Université de Liège

Detailed reference viewed: 9 (0 ULg)
Full Text
See detailMagnesium-doped Cuprous Oxide (Mg:Cu2O) thin films as a transparent p-type semiconductor oxide
Avelas Resende, João ULg; Nguyen, Ngoc Duy ULg; Deschanvres, Jean-Luc et al

Poster (2015, September)

Oxide electronics is an important emerging area, notably for the development of transparent thin film transistors (TFTs) and other complex electronic circuits. The successful application of n-type oxides ... [more ▼]

Oxide electronics is an important emerging area, notably for the development of transparent thin film transistors (TFTs) and other complex electronic circuits. The successful application of n-type oxides to TFTs has motivated the interest in p-type oxide based semiconductors, also to be applied to TFTs or to complementary metal-oxide semiconductor (CMOS) technology. However, until now there is a lack of p-type oxide semiconductors with performance similar to that of n-type oxide. Among the different metallic oxides, Cu (I)-based oxides exhibit one of the lowest ionic character. These compounds are therefore one of the most promising candidates as p-type transparent semiconductors.Nevertheless, the band gap of 2,17eV is modest for transparent electronics applications, since the transmittance of Cu2O films is low on the visible part of the light spectrum. The incorporation of cations with large radii than Cu has been proposed as a way to achieve a higher band gap, by diminishing of three-dimensional Cu-Cu interactions, only possible with larger cations than Cu+. Therefore, cation doped Cu2O thin films were grown by metal-organic chemical vapor deposition (MOCVD). The three doping elements studied (Sr2+, Sn2+ and La3+) were selected having in account theoretical predictions for the band structure and the deposition conditions of Cu2O. The study focus on thin films growth optimization combined with electronic transport analysis and optical transmittance measurements. [less ▲]

Detailed reference viewed: 97 (4 ULg)
Full Text
Peer Reviewed
See detailModel-Based Stressed Blood Volume is an Index of Fluid Responsiveness
Pironet, Antoine ULg; Dauby, Pierre ULg; Chase, J. Geoffrey et al

in IFAC PapersOnLine (2015, September)

Fluid therapy is frequently used to manage acute circulatory failure. This therapy aims to restore cardiac output by fluid administration, which increases the quantity of fluid in the circulation. However ... [more ▼]

Fluid therapy is frequently used to manage acute circulatory failure. This therapy aims to restore cardiac output by fluid administration, which increases the quantity of fluid in the circulation. However, it has been shown to be effective only in certain cases, leading to the need for indices of fluid responsiveness. Total stressed blood volume has recently been shown to be such an index of fluid responsiveness. However, the current methods to determine this parameter require specific procedures. In this work, a more straightforward method is developed using data available in the intensive care unit. A simple three-chamber cardiovascular system model is used, of which total stressed blood volume is a parameter. All model parameters (including total stressed blood volume) are adjusted to pig experimental data during fluid administrations. The resulting value of total stressed blood volume is always negatively associated with the relative change in cardiac output after fluid administration. This finding confirms that total stressed blood volume is an index of fluid responsiveness. Another finding of this study is that the response curves are subject-specific. The method developed in this work can be applied to humans, since the data required is typically available in an intensive care unit. [less ▲]

Detailed reference viewed: 25 (2 ULg)
Full Text
Peer Reviewed
See detailAlkali injuries may lead to errors of diagnosis and mistreatment (161)
JACQUEMIN, Denise ULg

Conference (2015, September)

Detailed reference viewed: 8 (0 ULg)
Peer Reviewed
See detailBehavioral effects of exposure to salinity on tadpoles of two syntopic species of spadefoot toads (genus Pelobates)
Székely, Diana ULg; Stanescu, Floriana; Székely, Paul et al

Poster (2015, September)

Detailed reference viewed: 10 (0 ULg)
Full Text
See detailThe Number of Structures Compatible with any Specified Correlation Function
Gommes, Cédric ULg

Conference (2015, September)

Detailed reference viewed: 12 (1 ULg)
Full Text
Peer Reviewed
See detailEnergy and nutrient contents of food served and consumed by nursing home residents
Buckinx, Fanny ULg; Paquot, Nicolas ULg; Allepaerts, Sophie ULg et al

in European Geriatric Medicine (2015, September), 6S1

Detailed reference viewed: 28 (6 ULg)
Peer Reviewed
See detailParameter Identification Methods in a Model of the Cardiovascular System
Pironet, Antoine ULg; Desaive, Thomas ULg; Dauby, Pierre ULg et al

in Preprints of the 9th IFAC Symposium on Biological and Medical Systems (2015, September)

To be clinically relevant, mathematical models have to be patient-specific, meaning that their parameters have to be identified from patient data. To achieve real time monitoring, it is important to ... [more ▼]

To be clinically relevant, mathematical models have to be patient-specific, meaning that their parameters have to be identified from patient data. To achieve real time monitoring, it is important to select the best parameter identification method, in terms of speed, efficiency and reliability. This work presents a comparison of seven parameter identification methods applied to a lumped-parameter cardiovascular system model. The seven methods are tested using in silico and experimental reference data. To do so, precise formulae for initial parameter values first had to be developed. The test results indicate that the trust-region reflective method seems to be the best method for the present model. This method (and the proportional method) are able to perform parameter identification in two to three minutes, and will thus benefit cardiac and vascular monitoring applications. [less ▲]

Detailed reference viewed: 48 (5 ULg)
See detailDeciphering the molecular mechanisms underlying NLRP3 inflammasome activation by saturated fatty acids
Gianfrancesco, Marco ULg; Bloch, Katarzyna; Dehairs, Jonas et al

Poster (2015, September)

Detailed reference viewed: 26 (12 ULg)
Peer Reviewed
See detailEcologia funcional de campos rupestres
Negreiros, Daniel; Le Stradic, Soizig ULg; Fernandes, Geraldo Wilson

Conference (2015, September)

Detailed reference viewed: 12 (0 ULg)
Full Text
Peer Reviewed
See detailValidation and test cases for a free surface SPH model
Goffin, Louis ULg; Erpicum, Sébastien ULg; Dewals, Benjamin ULg et al

in Advances in hydroinformatics - Simhydro 2014 (2015, September)

Detailed reference viewed: 50 (24 ULg)
Full Text
Peer Reviewed
See detailComparison between VeinoPlus Sport and TENS on the recovery on young soccer players
God, Maxime; LE GOFF, Caroline ULg; Evrard, Frédéric et al

in European Journal of Sports Medicine (2015, September), 3(Suppl 1), 106

Introduction Every physical activity is tiresome for the body; muscles produce metabolites and lactic acid which limit its working ability. It is then necessary to efficiently and quickly recover after ... [more ▼]

Introduction Every physical activity is tiresome for the body; muscles produce metabolites and lactic acid which limit its working ability. It is then necessary to efficiently and quickly recover after the effort. In fact, a bad recovery could bring prejudice to the following performance and the athlete's physical state. Active recovery and balneotherapy together with new techniques such as cryotherapy and electro stimulation are upcoming tools to recover better. The goal of this study was to compare the impact of 2 types of electro stimulator : « VeinoPlus Sport » (VPS) and « TENS » on amateur soccer players after Yo-Yo-type effort. Material and methods In an identical context, each athlete (20 soccer players; average age 17,1 ± 0,79) benefited from VPS and TENS during 2 different treatment sessions after 2 Yo-Yo-type efforts. Four blood samples were taken (lactate, blood gases, ions, cardiac markers,...) and an explosiveness Myotest evaluation was conducted respectively before effort, just after effort, after recovery, and after the second effort. A questionnaire on the fatigue state was filled out by each athlete. For the statistical analysis, we used the Anova algorithm of the StatPlus system and a Scheffé test. Results All athletes have ran a greater distance in their second effort especially in the VPS group but differences were insignificant. The test lead to a significant variation of lactate, HCO3- ions and myoglobin. The study of other blood parameters and of the explosiveness parameters didn't show any significant variations. Nevertheless according to the subjective athlete's opinion the VPS group has noted less legs pain, less overall fatigue, less diminishment of strength and fitter than the TENS group between 12 and 24 hours after effort. Finally all athletes have said to like the use of a electro-stimulation recovery device better than their normal daily recovery techniques without expressing any preferences between VPS and TENS. Discussion - Conclusion This comparative study only shows minor differences, non significant, between the two devices. The two groups have ran the greatest distance during the second effort which suggests that the test wasn't tiresome despite biological signs of "fatigue". However on subjective criteria of recovery and well-being a slight preference was shown for the VPS device. The results should be taken into consideration in a other comparative study of the recovery devices with more tiresome effort. [less ▲]

Detailed reference viewed: 42 (1 ULg)
See detailA logarithmic commensurability theorem for a class of GDIFSs
Leroy, Julien ULg

Poster (2015, September)

Detailed reference viewed: 3 (0 ULg)
Full Text
See detailStudy of the Crystallization Behavior and the Subsequent Martensitic Transformation in a High Chromium Cast Steel submitted to Different Austenitization Temperatures
Tchuindjang, Jérôme Tchoufack ULg; Habraken, Anne ULg; Lecomte-Beckers, Jacqueline ULg

Conference (2015, September)

The crystallization behavior a High Chromium Cast Steel (HCCS) has been determined under Equilibrium conditions with ThermoCalc® software, and under non-Equilibrium conditions through Differential Thermal ... [more ▼]

The crystallization behavior a High Chromium Cast Steel (HCCS) has been determined under Equilibrium conditions with ThermoCalc® software, and under non-Equilibrium conditions through Differential Thermal Analyses (DTA). The results are compared to each other and the differences between the predicted solidification path and the actual one obtained from DTA (Figure 1) are highlighted. The microstructure in the as-cast conditions is characterized while using both scanning electron microscopy (SEM) and hardness measurements. The SEM analysis involves a combination of methods such as backscattered electron observation, energy dispersive spectrometry and backscattered-electron diffraction with X rays, which ensure proper identification of complex solidification carbides and the matrix made of martensite and retained austenite (Figure 2a). Solid state transformations occurring during the heating stage up to the austenitization temperature are studied towards both DTA and dilatometry, especially the dissolution/precipitation reactions. Different austenitization temperatures are considered prior to cooling down to room temperature during dilatometry tests to determine the starting points (Ms) for martensite transformation. In addition a cryogenic quenching within liquid nitrogen is performed which allows the completion of the martensitic transformation (Figure 2b) and help determining the critical point for the end of the martensitic reaction (Mf points). An enhanced discussion based on the influence of the cooling rate and the undercooling is developed to explain the differences that are observed between equilibrium and non-equilibrium conditions, which are mainly related to the solidification sequence and the carbides formed. The influence of the austenitization temperature and the matrix composition/supersaturation on both Ms and Mf points is also discussed. [less ▲]

Detailed reference viewed: 18 (1 ULg)