     by title

0-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

or enter first few letters:   
Peer Reviewed
See detailMolecular cloning of varicella-zoster virus DNA and its detection in situ in infected nerve cells
Merville, Marie-Paule ULg; Sadzot-Delvaux, Catherine ULg; Delrée, P. et al

in Archives Internationales de Physiologie et de Biochimie (1987), 95(2), 31

Detailed reference viewed: 11 (2 ULg)
See detailMolecular cloning, sequencing and expression of BVDV RNA
Renard, A.; Brown-Shimmer, S.; Schmetz, D. et al

Conference (1987)

Detailed reference viewed: 8 (1 ULg)
Full Text
Peer Reviewed
See detailMolecular conformation and electronic properties of protoporphyrin-IX self-assembled monolayers adsorbed on a Pt(111) surface
Humbert, C.; Volcke, C.; Sartenaer, Y. et al

in Surface Science (2006), 600

Monolayers of protoporphyrin-IX molecules are prepared on a Pt(111) surface by a self-assembly process in order to manufacture organic devices with controlled electronic properties. Scanning tunnelling ... [more ▼]

Monolayers of protoporphyrin-IX molecules are prepared on a Pt(111) surface by a self-assembly process in order to manufacture organic devices with controlled electronic properties. Scanning tunnelling microscopy (STM) and two-colour sum-frequency generation (2C-SFG) are performed ex situ in ambient air, in order to characterize their molecular conformation and electronic properties at the monolayer level, respectively. STM measurements performed with functionalized gold tips reveal a high covering rate of the metal surface. 2C-SFG measurements highlight CH stretching modes of vinyl substituted groups (R-CH=CH2) in the 2800–3200 cm-1 infrared spectral range and particular electronic features in the visible spectral range, i.e. a Soret band red shift and band separation compared to the liquid phase. Moreover, similar measurements are performed on Zn(II)Protoporphyrin-IX and 5-[p-(6-mercaptohexoxy)-phenyl]-10,15,20-triphenylporphin films for comparison. These results suggest a film conformation with the molecules having different tilt angles with respect to the substrate normal, depending on the ion metal presence or the chain length bonded to the porphyrin moiety. [less ▲]

Detailed reference viewed: 75 (3 ULg)
Peer Reviewed
See detailMolecular conformation and electronic properties of protoporphyrin-IX self-assembled monolayers adsorbed on Pt(111) surface
Humbert, Christophe; Volcke, Cédric; Sartenaer, Yannick et al

Poster (2005, September)

Detailed reference viewed: 23 (0 ULg)
Full Text
See detailMolecular Construction: Pushing, Moving, Stretching, and Connecting Individual Molecules
Bano, Fouzia; Duwez, Anne-Sophie ULg

in Duwez, Anne-Sophie; Willet, Nicolas (Eds.) Molecular manipulation with atomic force microscopy (2012)

Detailed reference viewed: 6 (0 ULg)
Full Text
Peer Reviewed
See detailMolecular cranes swing into action
Duwez, Anne-Sophie ULg

in Nature Nanotechnology (2008), 3

Atomic force microscopes have exploited the properties of DNA to ‘cut-and-paste’ molecules on surfaces with an accuracy of 10 nm

Detailed reference viewed: 44 (13 ULg)
Full Text
Peer Reviewed
See detailMolecular cytogenetic study of 126 unselected T-ALL cases reveals high incidence of TCR beta locus rearrangements and putative new T-cell oncogenes
Cauwelier, B.; Dastugue, N.; Cools, J. et al

in Leukemia (2006), 20(7), 1238-1244

Chromosomal aberrations of T-cell receptor (TCR) gene loci often involve the TCR alpha delta (14q11) locus and affect various known T-cell oncogenes. A systematic fluorescent in situ hybridization (FISH ... [more ▼]

Chromosomal aberrations of T-cell receptor (TCR) gene loci often involve the TCR alpha delta (14q11) locus and affect various known T-cell oncogenes. A systematic fluorescent in situ hybridization (FISH) screening for the detection of chromosomal aberrations involving the TCR loci, TCRad (14q11), TCR beta (7q34) and TCR gamma (7p14), has not been conducted so far. Therefore, we initiated a screening of 126 T-cell acute lymphoblastic leukemia (T-ALL) and T-cell lymphoblastic lymphoma cases and 19 T-ALL cell lines using FISH break-apart assays for the different TCR loci. Genomic rearrangements of the TCR beta locus were detected in 24/ 126 cases (19%), most of which (58.3%) were not detected upon banding analysis. Breakpoints in the TCR alpha delta locus were detected in 22/ 126 cases (17.4%), whereas standard cytogenetics only detected 14 of these 22 cases. Cryptic TCR alpha delta/ TCR beta chromosome aberrations were thus observed in 22 of 126 cases (17.4%). Some of these chromosome aberrations target new putative T-cell oncogenes at chromosome 11q24, 20p12 and 6q22. Five patients and one cell line carried chromosomal rearrangements affecting both TCR beta and TCR alpha delta loci. In conclusion, this study presents the first inventory of chromosomal rearrangements of TCR loci in T-ALL, revealing an unexpected high number of cryptic chromosomal rearrangements of the TCR beta locus and further broadening the spectrum of genes putatively implicated in T-cell oncogenesis. [less ▲]

Detailed reference viewed: 32 (0 ULg)
Full Text
Peer Reviewed
See detailMolecular data challenge traditional subgeneric divisions in the leafy liverwort Radula
Devos, Nicolas; Renner, MAM; Gradstein, SR et al

in Taxon (2011), 60

Detailed reference viewed: 25 (0 ULg)
Full Text
Peer Reviewed
See detailMolecular decision trees realized by ultrafast electronic spectroscopy
Fresch, Barbara ULg; Hiluf, Dawit; Collini, Elisabetta et al

in Proceedings of the National Academy of Sciences (2013), 110(43), 17183-17188

The outcome of a light–matter interaction depends on both the state of matter and the state of light. It is thus a natural setting for implementing bilinear classical logic. A description of the state of ... [more ▼]

The outcome of a light–matter interaction depends on both the state of matter and the state of light. It is thus a natural setting for implementing bilinear classical logic. A description of the state of a time-varying system requires measuring an (ideally complete) set of time-dependent observables. Typically, this is prohibitive, but in weak-field spectroscopy we can move toward this goal because only a finite number of levels are accessible. Recent progress in nonlinear spectroscopies means that nontrivial measurements can be implemented and thereby give rise to interesting logic schemes where the outputs are functions of the observables. Lie algebra offers a natural tool for generating the outcome of the bilinear light–matter interaction. We show how to synthesize these ideas by explicitly discussing three-photon spectroscopy of a bichromophoric molecule for which there are four accessible states. Switching logic would use the on–off occupancies of these four states as outcomes. Here, we explore the use of all 16 observables that define the time-evolving state of the bichromophoric system. The bilinear laser–system interaction with the three pulses of the setup of a 2D photon echo spectroscopy experiment can be used to generate a rich parallel logic that corresponds to the implementation of a molecular decision tree. Our simulations allow relaxation by weak coupling to the environment, which adds to the complexity of the logic operations. [less ▲]

Detailed reference viewed: 21 (0 ULg)
Full Text
Peer Reviewed
See detailMolecular Definition of an Allelic Series of Mutations Disrupting the Myostatin Function and Causing Double-Muscling in Cattle
Grobet, Luc ULg; Poncelet, D.; Royo, L. J. et al

in Mammalian Genome : Official Journal of the International Mammalian Genome Society (1998), 9(3), 210-3

We have determined the entire myostatin coding sequence for 32 double-muscled cattle sampled from ten European cattle breeds. Seven DNA sequence polymorphisms were identified, of which five would be ... [more ▼]

We have determined the entire myostatin coding sequence for 32 double-muscled cattle sampled from ten European cattle breeds. Seven DNA sequence polymorphisms were identified, of which five would be predicted to disrupt the function of the protein, one is a conservative amino acid substitution, and one a silent DNA sequence variant. Four additional DNA sequence polymorphisms were identified in myostatin intronic sequences. In all but two breeds, all double-muscled animals were either homozygous or compound heterozygotes for one of the five loss-of-function mutations. The absence of obvious loss-of-function mutations in the coding sequence of the two remaining breeds points either towards additional mutations in unexplored segments of the gene, or towards locus heterogeneity of double-muscling. [less ▲]

Detailed reference viewed: 42 (7 ULg)
Full Text
Peer Reviewed
See detailMolecular dermatopathology in malignant melanoma.
REGINSTER, Marie-Annick ULg; PIERARD-FRANCHIMONT, Claudine ULg; PIERARD, Gérald ULg et al

in Dermatology Research and Practice (2012), 2012(684032), 1-6

At present, immunohistochemistry is taken for granted in the establishment of malignant melanoma (MM) diagnosis. In recent years, molecular diagnosis in dermatopathology has benefited from a vast array of ... [more ▼]

At present, immunohistochemistry is taken for granted in the establishment of malignant melanoma (MM) diagnosis. In recent years, molecular diagnosis in dermatopathology has benefited from a vast array of advances in the fields of genomics and proteomics. Sensitive techniques are available for detecting specific DNA and RNA sequences by molecular hybridization. This paper intends to update methods of molecular cytogenetics available as diagnostic adjuncts in the field of MM. Cytogenetics has highlighted the pathogenesis of atypical melanocytic neoplasms with emphasis on the activation of the mitogen-activated protein kinase (MAPK) signalling pathway during the initiation step of the neoplasms. 20 to 40% of MM families have mutations in the tumour suppressor gene p16 or CDKN2A. In addition, somatic mutations in p16, p53, BRAF, and cKIT are present in MM. Genome-wide scan analyses on MM indicate positive associations for genes involved in melanocytic naevi, but MM is likely caused by a variety of common low-penetrance genes. Molecular dermatopathology is expanding, and its use in the assessment of melanocytic neoplasms appears to be promising in the fields of research and diagnosis. Molecular dermatopathology will probably make its way to an increased number of diagnostic laboratories. The expected benefit should improve the patient management. This evolution points to a need for evolution in the training requirements and role of dermatopathologists. [less ▲]

Detailed reference viewed: 19 (6 ULg)
Full Text
Peer Reviewed
See detailMolecular description of the interactions of aminoglycoside antibiotics with negatively-charged phospholipids. Theoretical molecular modelling and experimental results.
Mingeot-Leclercq, M. P.; Schanck, A.; Van Bambeke, F. et al

in Pharmacology (1995), 14

Detailed reference viewed: 14 (0 ULg)
Full Text
Peer Reviewed
See detailMolecular design of multicomponent polymer systems XIX : stability of cocontinuous phase morphologies in low-density polyethylene-polystyrene blends emulsified by block copolymers
Harrats, Charef; Blacher, Silvia ULg; Fayt, Roger et al

in Journal of Polymer Science. Part B, Polymer Physics (1995), 33(5), 801-811

Polyethylene-polystyrene blends containing small amounts of polyethylene (20 wt %) display a cocontinuous phase morphology that is very unstable in the absence of an emulsifier. The kinetics of ... [more ▼]

Polyethylene-polystyrene blends containing small amounts of polyethylene (20 wt %) display a cocontinuous phase morphology that is very unstable in the absence of an emulsifier. The kinetics of coalescence at high temperature is therefore very sensitive to differences in the interfacial activity of added polymeric emulsifiers. The morphology of blends added with a pure or a tapered hydrogenated polybutadiene-b-polystyrene block copolymer is investigated as a function of annealing time at 180°C. Various image treatments (standard granulometry, opening size granulometry distribution, and multiscaling analysis) were used to quantify the morphological evolution of these blends. The results clearly demonstrate that the tapered block copolymer is definitely more efficient than the corresponding pure diblock for stabilizing the cocontinuous structure of these blends. The differential behavior is assumed to results from differences in the tendency of the two copolymers to segregate and form their own domains. © 1995 John Wiley [less ▲]

Detailed reference viewed: 39 (4 ULg)
Full Text
Peer Reviewed
See detailMolecular Detection and Genotyping of Noroviruses
Stals, A.; Mathijs, E.; Baert, L. et al

in Food and Environmental Virology (2012), 4(4), 153-167

Noroviruses (NoVs) are a major cause of gastroenteritis worldwide in humans and animals and are known as very infectious viral agents. They are spread through feces and vomit via several transmission ... [more ▼]

Noroviruses (NoVs) are a major cause of gastroenteritis worldwide in humans and animals and are known as very infectious viral agents. They are spread through feces and vomit via several transmission routes involving person-to-person contact, food, and water. Investigation of these transmission routes requires sensitive methods for detection of NoVs. As NoVs cannot be cultivated to date, detection of these viruses relies on the use of molecular methods such as (real-time) reverse transcriptase polymerase chain reaction (RT-PCR). Regardless of the matrix, detection of NoVs generally requires three subsequent steps: a virus extraction step, RNA purification, and molecular detection of the purified RNA, occasionally followed by molecular genotyping. The current review mainly focused on the molecular detection and genotyping of NoVs. The most conserved region in the genome of human infective NoVs is the ORF1/ORF2 junction and has been used as a preferred target region for molecular detection of NoVs by methods such as (real-time) RT-PCR, NASBA, and LAMP. In case of animal NoVs, broad range molecular assays have most frequently been applied for molecular detection. Regarding genotyping of NoVs, five regions situated in the polymerase and capsid genes have been used for conventional RT-PCR amplification and sequencing. As the expected levels of NoVs on food and in water are very low and inhibition of molecular methods can occur in these matrices, quality control including adequate positive and negative controls is an essential part of NoV detection. Although the development of molecular methods for NoV detection has certainly aided in the understanding of NoV transmission, it has also led to new problems such as the question whether low levels of human NoV detected on fresh produce and shellfish could pose a threat to public health. © 2012 Springer Science+Business Media New York. [less ▲]

Detailed reference viewed: 60 (5 ULg)
Full Text
Peer Reviewed
See detailMolecular detection of bovine noroviruses in Argentinean dairy calves: Circulation of a tentative new genotype
Ferragut, Fatima; Vega, Celina; Mauroy, Axel ULg et al

in Infection, Genetics and Evolution : Journal of Molecular Epidemiology and Evolutionary Genetics of Infectious Diseases (2016), 40

Detailed reference viewed: 24 (8 ULg)
See detailMolecular detection of HAV by a new one step real time RT-PCR
Zonta, William ULg; Denayer, Sarah; Thiry, Etienne ULg et al

Poster (2012, September)

Introduction and objectives Hepatitis A virus (HAV) is a RNA virus with a single-stranded positive sense genome and the only species of the genus Hepatovirus of the Picornaviridae family. Belgium and ... [more ▼]

Introduction and objectives Hepatitis A virus (HAV) is a RNA virus with a single-stranded positive sense genome and the only species of the genus Hepatovirus of the Picornaviridae family. Belgium and European countries in general, are countries with a low prevalence and the majority of adults can be infected. HAV is mainly transmitted by the fecal-oral route and even if foodborne outbreaks account for less than 5 % of the reported cases per year, the source of infection cannot be identified in 50 % of the reported cases. Therefore the contribution of foodborne infection is probably underestimated. Viral loads in food samples are lower than in clinical samples and their detection requires refined molecular detection methods. Methods A one step real-time RT-PCR to detect HAV, with new primers (HAV F2 and HAV R2) and probe (HAV P2) was performed directly on HAV diluted suspensions and on food samples (dates) and was compared with a ready-to-use commercial kit. Before the one step real time RT-PCR, a preliminary step combining concentration of viral particles with polyethyleneglycol and centrifugation was used on food samples. Results Real time RT-PCR one step with HAV F2/R2/P2 is more efficient but less sensitive than the commercial kit. It could be used to confirm a positive sample or to detect HAV in an unknown sample. With cell cultured HAV, the limit of detection (LOD) is 1.25 infectious particles in volume tested by RT-PCR or 102 TCID50/ml. In food samples, LOD is between 25 infectious particles and 250 infectious particles in volume tested by RT-PCR or between 104 and 105 TCID50/ml. Several hypotheses could explain these results: the loss of viral particles during the extraction process, the low efficiency of RNA extraction and interference of food on molecular detection. Conclusion Molecular detection of virus in food samples remains a challenge and the protocol of extraction should be improved and adapted at each food category to increase the sensitivity of detection in food matrices characterized by a low viral contamination. [less ▲]

Detailed reference viewed: 41 (2 ULg)
Full Text
Peer Reviewed
See detailMolecular detection of kobuviruses and recombinant noroviruses in cattle in continental Europe
Mauroy, Axel ULg; Scipioni, A.; Mathijs, Elisabeth ULg et al

in Archives of Virology (2009), 154

Detailed reference viewed: 62 (4 ULg)
Peer Reviewed
See detailMolecular detection of kobuviruses and recombinant noroviruses in cattle in continental europe
Mauroy, Axel ULg; Scipioni, Alexandra; Mathijs, Elisabeth et al

Poster (2009, August)

Introduction and Objectives Noroviruses (NoV) and Kobuviruses (KoV), belong to the family Caliciviridae genus Norovirus and to the family Picornaviridae genus Kobuvirus respectively. Both have a single ... [more ▼]

Introduction and Objectives Noroviruses (NoV) and Kobuviruses (KoV), belong to the family Caliciviridae genus Norovirus and to the family Picornaviridae genus Kobuvirus respectively. Both have a single stranded positive-sense RNA genome. They both infect the gastrointestinal tract of different animal species including human beings. Two NoV and one KoV prototype strains have been already identified in the bovine (Bo) species: Jena virus (JV) and Newbury 2 (NB2) for BoNoV; U1 for BoKoV. Genogroup (G) III gathers all BoNoV strains and is further subdivided into two genotypes where viruses genetically related to JV and NB2 are assigned to the genotype 1 and 2 respectively. Recombination is a common event in NoV and is usually reported near the overlapping region between open reading frame (ORF) 1 (end of the polymerase gene) and ORF2 (beginning of the single capsid protein gene). Two GIII.1/GIII.2 BoNoV recombinant strains have been described including the recombinant strain Bo/NoV/Thirsk10/00/UK (Thirsk10), identified in the year 2000 in Great Britain. To our knowledge, no other genetically related strains have been reported since [1]. Bovine KoV were detected by RT-PCR in stool samples of healthy calves from Japan, in samples from diarrhoeic calves from Thailand [2] and were also identified very recently in Hungary. Bovine NoV prevalence studies performed in different areas have shown the predominance of the GIII.2 genotype but this could reflect a GIII.1 specificity failure in the RT-PCR methods. The aim of this study was to screen cattle stool samples with two primer sets targeting the polymerase and the capsid region. The primer pair targeting the capsid region was designed based on a GIII.1 sequence in order to improve their detection. Materials and methods A stool bank (n=300) was created with calf and young stock diarrhoeic samples from five provinces in Belgium (Hainaut, Liège, Namur, Luxembourg, Walloon Brabant) and received from a Belgian diagnostic laboratory through the year 2008. Viral RNA extraction was performed and one step RT-PCR was carried out on 2 µl of each viral RNA extraction using the CBECu-F/R primers (nucleotidic position on JV: 4543-4565 and 5051-5074) and a primer pair, named AMG1-F/R, designed from the JV genomic sequence (F: tgtgggaaggtagtcgcgaca, nucleotidic position on JV: 5012-5032; R: cacatgggggaactgagtggc, 5462-5482). Combined approaches with the CBECu-F and AMG1-R primers, additional internal primers (F2: atgatgccagaggtttcca, position on JV: 4727-4745; R2: gcaaaaatccatgggtcaat, 5193-5211) or CBECu-F and a polyTVN-linker were also carried out on some positive samples. RT-PCR products were directly sequenced twice or cloned before sequencing. Sequencing was carried out at the GIGA facilities of the University of Liège with BigDye terminator kit. Nucleotidic sequences were analysed with the BioEdit software. Nucleotidic similarity with the NCBI genetic database was assessed using the BLAST tool. Phylogenetic inference was performed with the MEGA software. Phylogenetic tree was constructed by neighbour-joining analysis where evolutionary distances were computed using the Maximum Composite Likelihood method. The confidence values of the internal nodes were calculated by performing 1,000 replicate bootstrap values. Genetic recombination was analysed with the Simplot software and the Recombinant Detection Program. Results Twenty-eight positive samples were identified in the 300 samples: 24 and 23 BoNoV sequences with the CBECu and AMG1 primer pairs respectively, giving a combined apparent molecular prevalence of 9.33% (CI 95%: [9.27; 9.38%]). Using BLAST, three sequences amplified with CBECu-F/R (BV164, BV362, and BV416) were genetically more related to the GIII.1 JV and Aba Z5/02/HUN sequences and one (BV168) to the recombinant strain Thirsk10. The others were genetically related to GIII.2 BoNoV. All the sequences amplified with AMG1-F/R but one genetically matched with GIII.2 BoNoV. The AMG1-amplicon of the BV416 sample matched with the recombinant strain Thirsk10. A 2410 nucleotide (nt)-large genomic sequence was obtained from BV416 with CBECu-F/TVN linker, which was a recombinant sequence genetically related to the Thirsk10 strain. This result was confirmed by phylogenetic and by Simplot analysis. The potential recombination breakpoint of BV416 was located near or within the ORF1/ORF2 overlapping region depending on the bioinformatic program used. Comparison between its different genomic regions and the JV, Newbury2 and Thirsk10 genomic sequences showed that the polymerase region of BV416 was genetically more related to the GIII.1 than to the recombinant strain. F2/R2 amplicons from BV164 and BV362 were genetically related to GIII.2 and GIII.1 BoNoV respectively. Surprisingly, three amplicons obtained with the combined primer pair CBECu-F/AMG1-R on BoNoV positive samples at the expected molecular weight did not match genetically with BoNoV but did so with different genomic regions of the BoKoV U1 strain (86%, 92% and 93% of nucleotidic identity by BLAST for BV228, 250 and 253 respectively on sequences of about 500-700 nt). Discussion and conclusions In this study, very few genotype 1 BoNoV were identified (BV362 was the sole GIII.1 sequence obtained in the ORF1/2 overlapping region), confirming results reported in a previous study on BoNoV infection in the same area [3]. A recombinant status was clarified for BV416. Co-infection with GIII.1 and GIII.2 BoNoV was evidenced in the BV164 sample but could not be excluded in the BV168 sample because an overlapping sequence could not be obtained, although genetic analyses related its CBECu-F/R sequence to the Thirsk10 sequence. These results raise issues about the genetic characterization by primers targeting either the polymerase region or the capsid region. By exclusion of the potential recombination breakpoint, these primers can lead to the misclassification of strains and to the underestimation of circulation of recombinant strains. Multiple alignment and bioinformatic analysis performed with JV, Aba Z5, NB2, Thirk10 and BV416 sequences has suggested a recombination breakpoint for BV416 located near the ORF1/ORF2 overlapping region and one quite similar to those determined for the Thirsk10 strain. Nevertheless the greater similarity of BV416 with the Jena and Aba Z5 viruses in the polymerase region and the exact localization of the recombination breakpoint suggest another origin or genetic evolution than the Thirsk10 strain. The identification, in geographically and temporally different samples, of sequences that could be genetically related to the recombinant Thirsk10 strain suggests at least that Thirsk10-related strains circulate in the north European cattle population. Furthermore, the low detection rate of GIII.1 BoNoV could reflect an evolution of the viral population pattern to the benefit of the Thirsk10-related and genotype 2 strains in the studied region. To date, BoKoV-related sequences have been very rarely identified, and in only three countries (namely Japan, Thailand and Hungary). Their detection in another European country suggests their wider distribution, making them at least emerging bovine viruses in the studied region. In conclusion, prevalence studies on BoNoV using RT-PCR assays, even targeting relatively well conserved genomic regions, need to take into account in their protocols both their high genetic variability and their relative genetic proximity with other viruses, in order to maximize sensitivity and specificity. This study also showed that recombination events could lead to emerging strains in the BoNoV population, as already found for HuNoV. The molecular detection of bovine kobuvirus-related sequences in the studied area extends the distribution of these viruses in Europe. [less ▲]

Detailed reference viewed: 43 (0 ULg)