Browsing
     by title


0-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

or enter first few letters:   
OK
Peer Reviewed
See detailMolecular detection of kobuviruses and recombinant noroviruses in cattle in continental europe
Mauroy, Axel ULg; Scipioni, Alexandra; Mathijs, Elisabeth et al

Poster (2009, August)

Introduction and Objectives Noroviruses (NoV) and Kobuviruses (KoV), belong to the family Caliciviridae genus Norovirus and to the family Picornaviridae genus Kobuvirus respectively. Both have a single ... [more ▼]

Introduction and Objectives Noroviruses (NoV) and Kobuviruses (KoV), belong to the family Caliciviridae genus Norovirus and to the family Picornaviridae genus Kobuvirus respectively. Both have a single stranded positive-sense RNA genome. They both infect the gastrointestinal tract of different animal species including human beings. Two NoV and one KoV prototype strains have been already identified in the bovine (Bo) species: Jena virus (JV) and Newbury 2 (NB2) for BoNoV; U1 for BoKoV. Genogroup (G) III gathers all BoNoV strains and is further subdivided into two genotypes where viruses genetically related to JV and NB2 are assigned to the genotype 1 and 2 respectively. Recombination is a common event in NoV and is usually reported near the overlapping region between open reading frame (ORF) 1 (end of the polymerase gene) and ORF2 (beginning of the single capsid protein gene). Two GIII.1/GIII.2 BoNoV recombinant strains have been described including the recombinant strain Bo/NoV/Thirsk10/00/UK (Thirsk10), identified in the year 2000 in Great Britain. To our knowledge, no other genetically related strains have been reported since [1]. Bovine KoV were detected by RT-PCR in stool samples of healthy calves from Japan, in samples from diarrhoeic calves from Thailand [2] and were also identified very recently in Hungary. Bovine NoV prevalence studies performed in different areas have shown the predominance of the GIII.2 genotype but this could reflect a GIII.1 specificity failure in the RT-PCR methods. The aim of this study was to screen cattle stool samples with two primer sets targeting the polymerase and the capsid region. The primer pair targeting the capsid region was designed based on a GIII.1 sequence in order to improve their detection. Materials and methods A stool bank (n=300) was created with calf and young stock diarrhoeic samples from five provinces in Belgium (Hainaut, Liège, Namur, Luxembourg, Walloon Brabant) and received from a Belgian diagnostic laboratory through the year 2008. Viral RNA extraction was performed and one step RT-PCR was carried out on 2 µl of each viral RNA extraction using the CBECu-F/R primers (nucleotidic position on JV: 4543-4565 and 5051-5074) and a primer pair, named AMG1-F/R, designed from the JV genomic sequence (F: tgtgggaaggtagtcgcgaca, nucleotidic position on JV: 5012-5032; R: cacatgggggaactgagtggc, 5462-5482). Combined approaches with the CBECu-F and AMG1-R primers, additional internal primers (F2: atgatgccagaggtttcca, position on JV: 4727-4745; R2: gcaaaaatccatgggtcaat, 5193-5211) or CBECu-F and a polyTVN-linker were also carried out on some positive samples. RT-PCR products were directly sequenced twice or cloned before sequencing. Sequencing was carried out at the GIGA facilities of the University of Liège with BigDye terminator kit. Nucleotidic sequences were analysed with the BioEdit software. Nucleotidic similarity with the NCBI genetic database was assessed using the BLAST tool. Phylogenetic inference was performed with the MEGA software. Phylogenetic tree was constructed by neighbour-joining analysis where evolutionary distances were computed using the Maximum Composite Likelihood method. The confidence values of the internal nodes were calculated by performing 1,000 replicate bootstrap values. Genetic recombination was analysed with the Simplot software and the Recombinant Detection Program. Results Twenty-eight positive samples were identified in the 300 samples: 24 and 23 BoNoV sequences with the CBECu and AMG1 primer pairs respectively, giving a combined apparent molecular prevalence of 9.33% (CI 95%: [9.27; 9.38%]). Using BLAST, three sequences amplified with CBECu-F/R (BV164, BV362, and BV416) were genetically more related to the GIII.1 JV and Aba Z5/02/HUN sequences and one (BV168) to the recombinant strain Thirsk10. The others were genetically related to GIII.2 BoNoV. All the sequences amplified with AMG1-F/R but one genetically matched with GIII.2 BoNoV. The AMG1-amplicon of the BV416 sample matched with the recombinant strain Thirsk10. A 2410 nucleotide (nt)-large genomic sequence was obtained from BV416 with CBECu-F/TVN linker, which was a recombinant sequence genetically related to the Thirsk10 strain. This result was confirmed by phylogenetic and by Simplot analysis. The potential recombination breakpoint of BV416 was located near or within the ORF1/ORF2 overlapping region depending on the bioinformatic program used. Comparison between its different genomic regions and the JV, Newbury2 and Thirsk10 genomic sequences showed that the polymerase region of BV416 was genetically more related to the GIII.1 than to the recombinant strain. F2/R2 amplicons from BV164 and BV362 were genetically related to GIII.2 and GIII.1 BoNoV respectively. Surprisingly, three amplicons obtained with the combined primer pair CBECu-F/AMG1-R on BoNoV positive samples at the expected molecular weight did not match genetically with BoNoV but did so with different genomic regions of the BoKoV U1 strain (86%, 92% and 93% of nucleotidic identity by BLAST for BV228, 250 and 253 respectively on sequences of about 500-700 nt). Discussion and conclusions In this study, very few genotype 1 BoNoV were identified (BV362 was the sole GIII.1 sequence obtained in the ORF1/2 overlapping region), confirming results reported in a previous study on BoNoV infection in the same area [3]. A recombinant status was clarified for BV416. Co-infection with GIII.1 and GIII.2 BoNoV was evidenced in the BV164 sample but could not be excluded in the BV168 sample because an overlapping sequence could not be obtained, although genetic analyses related its CBECu-F/R sequence to the Thirsk10 sequence. These results raise issues about the genetic characterization by primers targeting either the polymerase region or the capsid region. By exclusion of the potential recombination breakpoint, these primers can lead to the misclassification of strains and to the underestimation of circulation of recombinant strains. Multiple alignment and bioinformatic analysis performed with JV, Aba Z5, NB2, Thirk10 and BV416 sequences has suggested a recombination breakpoint for BV416 located near the ORF1/ORF2 overlapping region and one quite similar to those determined for the Thirsk10 strain. Nevertheless the greater similarity of BV416 with the Jena and Aba Z5 viruses in the polymerase region and the exact localization of the recombination breakpoint suggest another origin or genetic evolution than the Thirsk10 strain. The identification, in geographically and temporally different samples, of sequences that could be genetically related to the recombinant Thirsk10 strain suggests at least that Thirsk10-related strains circulate in the north European cattle population. Furthermore, the low detection rate of GIII.1 BoNoV could reflect an evolution of the viral population pattern to the benefit of the Thirsk10-related and genotype 2 strains in the studied region. To date, BoKoV-related sequences have been very rarely identified, and in only three countries (namely Japan, Thailand and Hungary). Their detection in another European country suggests their wider distribution, making them at least emerging bovine viruses in the studied region. In conclusion, prevalence studies on BoNoV using RT-PCR assays, even targeting relatively well conserved genomic regions, need to take into account in their protocols both their high genetic variability and their relative genetic proximity with other viruses, in order to maximize sensitivity and specificity. This study also showed that recombination events could lead to emerging strains in the BoNoV population, as already found for HuNoV. The molecular detection of bovine kobuvirus-related sequences in the studied area extends the distribution of these viruses in Europe. [less ▲]

Detailed reference viewed: 17 (0 ULg)
Full Text
Peer Reviewed
See detailMolecular detection of six high importance endosymbiotic bacteria in Belgian wild-caught mosquitoes
Raharimalala, Fara Nantenaina ULg; Boukraa, Slimane ULg; Bawin, Thomas ULg et al

Poster (2014, July)

Introduction Several disease vectors presented a resistance to various pesticides currently used. One of an alternative solution was to use endosymbiotic bacteria because their probably interactive ... [more ▼]

Introduction Several disease vectors presented a resistance to various pesticides currently used. One of an alternative solution was to use endosymbiotic bacteria because their probably interactive effects with their host. According to the introduction risks of mosquito born disease and their dispersion, we propose to investigate the prevalence of six endosymbiontic bacteria in wild-caught Culicidae in Belgium. Methods Eleven species of Belgian fields mosquitoes (Culex pipiens s.l., Cx. torrentium, Cx. hortensis, Anopheles claviger, An. maculipennis s.l., An. plumbeus, Culiseta annulata, Ochlerotatus geniculatus, Oc. dorsalis, Aedes albopictus and Coquillettidia richiardii) were used for the screening of six genera endosymbiotic bacteria (Wolbachia sp., Commamonas sp., Delftia sp., Pseudomonas sp., Acinetobacter sp. and Asaia sp.) according to their possible impact in mosquito biology. PCR was done for the screening and positives bands were sequenced and deposited in GenBank. Results Total of 144 larvae and 32 adults were used. Wolbachia, Pseudomonas, Acinetobacter and Asaia were found in mosquitoes with different proportions, according to stages (adults, larvae) with a predominance of Pseudomonas in all species, as far as Acinetobacter and Asaia also have a high prevalence. Commamonas and Delftia were absent from all species tested, either in larvae and in adults. Discussion Choice of endosymbiotic bacteria studied here was allowing of their importance in literature. For Pseudomonas, it showed that this bacteria could produced ovipositon attractants for mosquito. Acinetobacter was suggested efficient in transmission and maintenance within host populations. Asaia was capable of efficiently crossing body barriers and colonizing different organs. Wolbachia was currently the most studied bacteria which plays an important role in the genetic manipulation of the host. Present advances in understanding the mosquito–microbiota relationships may have a great impact in a better understanding of some traits of mosquito biology and in the development of innovative mosquito-borne disease-control strategies. [less ▲]

Detailed reference viewed: 34 (6 ULg)
Full Text
Peer Reviewed
See detailMolecular detection of Theileria equi and Babesia caballi in the bone marrow of asymptomatic horses
Pitel, Pierre-Hugues; Pronost, Stéphane; Scrive, Thibaut et al

in Veterinary Parasitology (2010)

Equine piroplasmosis is a tick-borne disease, the aetiological agents of which are either Theileria equi or Babesia caballi parasites. Piroplasmosis is commonly encountered in acute or sub-acute clinical ... [more ▼]

Equine piroplasmosis is a tick-borne disease, the aetiological agents of which are either Theileria equi or Babesia caballi parasites. Piroplasmosis is commonly encountered in acute or sub-acute clinical forms although clinically recovered horses may remain asymptomatic but infected for several years. The clinical detection of such apparently healthy carrier horses (that serve as a host for subsequent infecting ticks), remains a worldwide challenge for controlling the spread of the disease. The aim of the present paper is to report on the detection of both T. equi and B. caballi by PCR in the bone marrow of naturally infected asymptomatic horses. Among 35 bone marrow samples evaluated for orthopaedic clinical research purposes, three samples from clinically healthy horses were found to be positive for T. equi, one of which was also positive for B. caballi. Even if the precise localisation of these parasites as well as the underlying mechanisms for persistence still remains unknown, one should not exclude bone marrow as a potential reservoir site for T. equi and B. caballi in infected asymptomatic horses. We suggest that, this possible localisation site (the bone marrow) should be considered as a therapeutic target when treating parasitic infection in apparently healthy horses. [less ▲]

Detailed reference viewed: 61 (5 ULg)
Full Text
Peer Reviewed
See detailMolecular Determinants Of The Interaction Between The C-Terminal Domain Of Alzheimer'S Beta-Amyloid Peptide And Apolipoprotein E Alpha-Helices
Lins, Laurence ULg; Thomas, Annick ULg; Pillot, T. et al

in Journal of Neurochemistry (1999), 73(2), 758-69

In a previous work, we predicted and demonstrated that the 29-42-residue fragment of beta-amyloid peptide (Abeta peptide) has in vitro capacities close to those of the tilted fragment of viral fusion ... [more ▼]

In a previous work, we predicted and demonstrated that the 29-42-residue fragment of beta-amyloid peptide (Abeta peptide) has in vitro capacities close to those of the tilted fragment of viral fusion proteins. We further demonstrated that apolipoprotein E2 and E3 but not apolipoprotein E4 can decrease the fusogenic activity of Abeta(29-42) via a direct interaction. Therefore, we suggested that this fragment is implicated in the neurotoxicity of Abeta and in the protective effects of apolipoprotein E in Alzheimer's disease. Because structurally related apolipoproteins do not interact with the Abeta C-terminal domain but inhibit viral fusion, we suggested that interactions existing between fusogenic peptides and apolipoproteins are selective and responsible for the inhibition of fusion. In this study, we simulated interactions of all amphipathic helices of apolipoproteins E and A-I with Abeta and simian immunodeficiency virus (SIV) fusogenic fragments by molecular modeling. We further calculated cross-interactions that do not inhibit fusion in vitro. The results suggest that interactions of hydrophobic residues are the major event to inhibit the fusogenic capacities of Abeta(29-42) and SIV peptides. Selectivity of those interactions is due to the steric complementarity between bulky hydrophobic residues in the fusogenic fragments and hydrophobic residues in the apolipoprotein C-terminal amphipathic helices. [less ▲]

Detailed reference viewed: 7 (0 ULg)
Full Text
Peer Reviewed
See detailMolecular dissection of a quantitative trait locus: a phenylalanine-to-tyrosine substitution in the transmembrane domain of the bovine growth hormone receptor is associated with a major effect on milk yield and composition.
Blott, Sarah; Kim, Jong-Joo; Moisio, Sirja et al

in Genetics (2003), 163(1), 253-66

We herein report on our efforts to improve the mapping resolution of a QTL with major effect on milk yield and composition that was previously mapped to bovine chromosome 20. By using a denser chromosome ... [more ▼]

We herein report on our efforts to improve the mapping resolution of a QTL with major effect on milk yield and composition that was previously mapped to bovine chromosome 20. By using a denser chromosome 20 marker map and by exploiting linkage disequilibrium using two distinct approaches, we provide strong evidence that a chromosome segment including the gene coding for the growth hormone receptor accounts for at least part of the chromosome 20 QTL effect. By sequencing individuals with known QTL genotype, we identify an F to Y substitution in the transmembrane domain of the growth hormone receptor gene that is associated with a strong effect on milk yield and composition in the general population. [less ▲]

Detailed reference viewed: 30 (8 ULg)
See detailMolecular dissection of the bovine leukemia virus envelope glycoprotein (BLV gp51) by a monoclonal antibody study.
Bruck, Claudine; Portetelle, Daniel ULg; Zavada, J. et al

in Neth, R. (Ed.) Modern Trends in Human Leukemia V (1983)

Detailed reference viewed: 4 (0 ULg)
Peer Reviewed
See detailMolecular dissection of the Bovine Leukemia Virus external envelope glycoprotein using synthetic peptides.
Callebaut, Isabelle; Burny, Arsène; Krchnak, Viktor et al

in AIDS Research and Human Retroviruses (1992), 8

Detailed reference viewed: 2 (0 ULg)
Full Text
Peer Reviewed
See detailMolecular dissection of the color-sided phenotype in cattle reveals a novel mechanism of chromosome evolution involving circular shuttling intermediates.
Durkin, Keith ULg; Cambisano, Nadine ULg; Ahariz, Naïma ULg et al

in Chromosome Research : An International Journal on the Molecular, Supramolecular and Evolutionary Aspects of Chromosome Biology (2011, May), 19(S1), 18

The color-sided (Cs) phenotype is a dominant coat color pattern segregating in several breeds including Belgian Blue Cattle (BBC) and Brown Swiss (BS). A genome-wide association study performed in BBC ... [more ▼]

The color-sided (Cs) phenotype is a dominant coat color pattern segregating in several breeds including Belgian Blue Cattle (BBC) and Brown Swiss (BS). A genome-wide association study performed in BBC unambiguously positioned the Cs locus on chromo- some 29 (BTA29); however, SNP arrays and CGH detected an equally perfectly associated <480 kb duplication encompassing the KIT gene on chromo- some 6 (BTA6). FISH analysis reconciled these results by revealing an intrachromosomal duplication, which transposed a fragment of BTA6 to BTA29. The organization of the duplicated segment, including breakpoint definition, was determined by high-throughput resequencing and revealed that the transpo- sition occurred via a circular intermediate. The trans- posed KIT copy was shown to be transcriptionally competent, suggesting that dominant color-sidedness results from dysregulated expression of KIT. Similar analyses of the color-sided phenotype conducted in BS revealed linkage on BTA6, a <120- kb-BTA6 duplication (which overlaps with the BBC duplication), and a <414-kb-BTA29 duplication adja- cent to the BTA29 breakpoint defined in BBC. FISH analysis showed the duplicated portion of BTA29 was located on BTA6 and adjacent to the KIT gene. SNP genotyping indicated that the BTA6 and BTA29 haplotypes associated with color-sidedness in BS and BBC were near identical, demonstrating the non-independence of the two chromosomal events. High-throughput resequencing of a color-sided BS animal defined the corresponding breakpoints and suggests that the BS Cs allele is derived from the BBC duplication [less ▲]

Detailed reference viewed: 60 (17 ULg)
Peer Reviewed
See detailMolecular dissection of the insulin-like growth factor axis in the human thymus
Geenen, Vincent ULg; Kecha, Ouafae; Achour, Imane et al

in Diabetologia (1997), 40

Detailed reference viewed: 11 (0 ULg)
See detailMolecular Diversity of Antarctic Cyanobacteria
De Carvalho Maalouf, Pedro ULg; Zakhia, Frédéric; Chflami, Souad et al

Scientific conference (2008, December 12)

Detailed reference viewed: 29 (2 ULg)
Peer Reviewed
See detailMolecular diversity of Microcystis strains (Cyanophyceae, Chroococcales) based on 16S rDNA sequences
LEPERE, Claire ULg; Wilmotte, Annick ULg; Meyer, Barbara

in Systematics and Geography of Plants (2000), 70

Partial 16S rDNA sequences were determined for six Microcystis strains from lakes in the region of Plön (Northern Germany) assigned to four different species on the basis of their morphology. These ... [more ▼]

Partial 16S rDNA sequences were determined for six Microcystis strains from lakes in the region of Plön (Northern Germany) assigned to four different species on the basis of their morphology. These sequences appear very similar to each other and to those of 71 Microcystis strains from four continents available in the databases. This great genotypic homogeneity, as measured by 16S rDNA sequence similarity (334 characters), is contrasting with the conspicuous morphological differences observed for the studied strains. [less ▲]

Detailed reference viewed: 68 (5 ULg)
Peer Reviewed
See detailMolecular dynamic simulation of the cyclic lipodepsipeptide Pseudodesmin A self-assembly
Crowet, Jean-Marc ULg; Sinnaeve, Davy; Fehér, Krisztina et al

Conference (2014, February 10)

Pseudodesmine A is a cyclic lipodepsipeptide of nine residues which presents a moderate antibacterial activity and whose structure has been resolved by X-ray and NMR1,2. In acetonitrile, Pseudodesmine A ... [more ▼]

Pseudodesmine A is a cyclic lipodepsipeptide of nine residues which presents a moderate antibacterial activity and whose structure has been resolved by X-ray and NMR1,2. In acetonitrile, Pseudodesmine A is monomeric while in chloroform it has the same structure but assemble in a supramolecular complex. This structure could associate with membranes and be responsible of the biological activity of this peptide. Comparison of the NMR data between the two solvents has given indications on the intermolecular contacts that arise in chloroform and a model for the self association was proposed2,3. To study in more details this assembly, molecular dynamics have been carried on. In acetonitrile, the peptide show transient interactions while in chlorofom interactions between monomers was always observed. As stated in Sinnaeve et al. in 2009, these interactions arise mainly between the backbone protons of the LEU1 and the GLN2, the GLN2 sidechain and the loop located on the opposite end of the monomer structure. From 10 simulations of dimerization, hydrogen bonds were followed and specific interaction patterns were identified regarding the hydrogen bonds formed. The peptide interactions are mainly described by 13 interaction patterns; 8 with the peptides in a linear configuration, 1 perpendicular and 4 with peptides side by side. The patterns are characterized by 2 to 4 hydrogen bonds. From the linear dimer, it is possible to reconstruct filaments and, by combining a linear and a lateral dimer, it is possible to build fibrils with multi filaments, as expected in the NMR derived model. Besides, the perpendicular dimer can gives peptide rings that can also explain the potential ability of this peptide to form ion pores in membranes. 1. Sinnaeve, D., Michaux, C., Van hemel, J., Vandenkerckhove, J., Peys, E., Borremans, F. a. M., Sas, B., Wouters, J. and Martins, J. C. Tetrahedron 2009, 65, 4173–4181. 2. Sinnaeve, D., Hendrickx, P. M. S., Van Hemel, J., Peys, E., Kieffer, B. and Martins, J. C. Chemistry (Weinheim an der Bergstrasse, Germany) 2009, 15, 12653–62. 3. Sinnaeve, D., Delsuc, M.-A., Martins, J. C. and Kieffer, B. Chemical Science 2012, 3, 1284. [less ▲]

Detailed reference viewed: 28 (4 ULg)
See detailMolecular dynamic simulations of a beta amphiphilic peptide
Crowet, Jean-Marc ULg; Deschamps, Antoine; Soumillion, Patrice et al

Conference (2013, October 03)

Detailed reference viewed: 42 (8 ULg)
Full Text
Peer Reviewed
See detailMolecular dynamics simulations of laser-induced damage of nanostructures and solids.
Diakhate, Momar ULg

in Applied Physics A : Materials Science & Processing (2009), 96

Detailed reference viewed: 24 (5 ULg)
Full Text
Peer Reviewed
See detailMolecular effectors and modulators of hypericin-mediated cell death in bladder cancer cells
Buytaert, E.; Matroule, J. Y.; Durinck, S. et al

in Oncogene (2008)

Photodynamic therapy (PDT) is an anticancer approach utilizing a light-absorbing molecule and visible light irradiation to generate, in the presence of O(2), cytotoxic reactive oxygen species, which cause ... [more ▼]

Photodynamic therapy (PDT) is an anticancer approach utilizing a light-absorbing molecule and visible light irradiation to generate, in the presence of O(2), cytotoxic reactive oxygen species, which cause tumor ablation. Given that the photosensitizer hypericin is under consideration for PDT treatment of bladder cancer we used oligonucleotide microarrays in the T24 bladder cancer cell line to identify differentially expressed genes with therapeutic potential. This study reveals that the expression of several genes involved in various metabolic processes, stress-induced cell death, autophagy, proliferation, inflammation and carcinogenesis is strongly affected by PDT and pinpoints the coordinated induction of a cluster of genes involved in the unfolded protein response pathway after endoplasmic reticulum stress and in antioxidant response. Analysis of PDT-treated cells after p38(MAPK) inhibition or silencing unraveled that the induction of an important subset of differentially expressed genes regulating growth and invasion, as well as adaptive mechanisms against oxidative stress, is governed by this stress-activated kinase. Moreover, p38(MAPK) inhibition blocked autonomous regrowth and migration of cancer cells escaping PDT-induced cell death. This analysis identifies new molecular effectors of the cancer cell response to PDT opening attractive avenues to improve the therapeutic efficacy of hypericin-based PDT of bladder cancer. [less ▲]

Detailed reference viewed: 10 (2 ULg)
Full Text
Peer Reviewed
See detailMolecular epidemiology of canine parvovirus, Europe
Decaro, Nicolas; Desario, Costantino; Addie, Diane D. et al

in Emerging Infectious Diseases (2007), 13(8), 1222-1224

Canine parvovirus (CPV), which causes hemorrhagic enteritis in dogs, has 3 antigenic variants: types 2a, 2b, and 2c. Molecular method assessment of the distribution of the CPV variants in Europe showed ... [more ▼]

Canine parvovirus (CPV), which causes hemorrhagic enteritis in dogs, has 3 antigenic variants: types 2a, 2b, and 2c. Molecular method assessment of the distribution of the CPV variants in Europe showed that the new variant CPV-2c is widespread in Europe and that the viruses are distributed in different countries. [less ▲]

Detailed reference viewed: 40 (1 ULg)