     by title

0-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

or enter first few letters:   
Full Text
Peer Reviewed
See detailThe Fish Migrate and so Must We': the Relationship between International and Internal Environmental Mobility in a Senegalese Fishing Community
Zickgraf, Caroline ULg

Conference (2015, April)

In 2008, the UN designated Saint-Louis “the city most threatened by rising sea levels in the whole of Africa”. The people of Guet Ndar, a densely populated fishing quarter, are coping with environmental ... [more ▼]

In 2008, the UN designated Saint-Louis “the city most threatened by rising sea levels in the whole of Africa”. The people of Guet Ndar, a densely populated fishing quarter, are coping with environmental challenges on two fronts: 1) coastal erosion and intensifying storms have destroyed sea-front homes, and, 2) overfishing and climate change’s maritime impacts are making local fishing less feasible as a livelihood strategy. Based on a local case study, this paper examines Guet Ndarian migration as an adaptive response to environmental risks and more specifically climate change: 1) through the intensification of fishing migration to Mauritania, and 2) through home construction on the mainland away from the encroaching sea. Although these population movements respond to different environmental challenges, this paper identifies their enmeshment as the former facilitates the latter. Furthermore, it embeds these migratory dynamics in their socio-economic context and applies mobility and transnational paradigms to environmentally vulnerable areas. [less ▲]

Detailed reference viewed: 58 (6 ULg)
Full Text
Peer Reviewed
See detailFish responses to artificial flow and water temperature variability in a large river (Rhône, France)
Capra, Hervé; Ovidio, Michaël ULg; Pella, Hervé et al

in Proceedings of the 9th International Conference on Ecohydraulics (2012, September)

Understanding fine scale behavioural responses of fish to changes in abiotic characteristics of habitat, such as flow variability, is an interesting innovative issue to improve river management in highly ... [more ▼]

Understanding fine scale behavioural responses of fish to changes in abiotic characteristics of habitat, such as flow variability, is an interesting innovative issue to improve river management in highly disturbed aquatic environments. For example, in the Rhône River (France), important hydrology and thermal contrasts are mainly explicated by the succession of dams and nuclear power plants. The main aim of our study was to describe fish behaviour in term of movements and habitat use as responses to habitat variability due to the production of peaking electricity and temperature heterogeneity (natural or due to a nuclear power plant release). Fixed telemetry system (accuracy of few square meters; Hydroacoustic Technology Inc.) enabled to define individual fish behavior during different short habitat variability configuration (flow increase, flow decrease, temperature increase....). We then recorded at a local scale continuous movements of n=61 fish during short term (lower than day) habitat variability. The study was conducted in a 2 km long river stretch, from July to September 2009. Abiotic conditions (temperature, depth, velocity or substrate) were simulated (with an accuracy comparable with fish positioning accuracy) every where at any time (i.e. for any discharge) using a hydraulic 2D model calibrated and validated for the whole discharge range observed during the experiment. Three main species were represented : two native cyprinids, chub (Squalius cephalus) and barbel (Barbus barbus), and an invasive species, wels catfish (Silurus glanis). Fish mobility and habitat use were studied to describe changes in behavior associated with changes of abiotic conditions. The separate effects of each environmental factors (discharge, temperature, photoperiod) and their interactions on fish behavioral responses were studied. Finally, variability of fish habitat preferences were estimated to refine understanding of observed behaviors. The different results highlighted the advantages and limitations of the telemetry acoustic system in a large river to address fish displacement in response to discharge and temperature variability. They also emphasized the necessity of a 2D hydrodynamic model to understand fish behaviour. [less ▲]

Detailed reference viewed: 198 (4 ULg)
Full Text
Peer Reviewed
See detailThe Fisher Information Matrix as a Relevant Tool for Sensor Selection in Engine Health Monitoring
Borguet, Sébastien ULg; Léonard, Olivier ULg

in International Journal of Rotating Machinery (2008), 2008

Engine health monitoring has been an area of intensive research for many years. Numerous methods have been developed with the goal of determining a faithful picture of the engine condition. On the other ... [more ▼]

Engine health monitoring has been an area of intensive research for many years. Numerous methods have been developed with the goal of determining a faithful picture of the engine condition. On the other hand, the issue of sensor selection allowing an efficient diagnosis has received less attention from the community. The present contribution revisits the problem of sensor selection for engine performance monitoring within the scope of information theory. To this end, a metric that integrates the essential elements of the sensor selection problem is defined from the Fisher information matrix. An example application consisting in a commercial turbofan engine illustrates the enhancement that can be expected from a wise selection of the sensor set. [less ▲]

Detailed reference viewed: 60 (4 ULg)
Full Text
See detailFisheries reforms and right-based fisheries: insights from community fisheries across Cambodia
Chap, Sreyphea; Touch, Panha; Diepart, Jean-Christophe ULg

E-print/Working paper (2016)

The working paper uses a right-based approach to examine recent wave of reforms in the Cambodian fisheries sector and what these reforms mean for community fisheries management.

Detailed reference viewed: 67 (2 ULg)
Full Text
Peer Reviewed
See detailFission in Spallation Reactions Seminar on Fission, cientific, 2008, 241-258
Cugnon, Joseph ULg; Aoust, Thierry; Boudard, Alain

in Wagemans, C.; Wagemans, J.; D’hondt, P. (Eds.) Seminar on Fission (2008)

Detailed reference viewed: 10 (0 ULg)
Full Text
See detailFissuration de dépôts durs à base de Ni et de Co en Laser Cladding
Montrieux, Henri-Michel ULg; Lecomte-Beckers, Jacqueline ULg

Report (2010)

Le rapport concerne l'étude de la fissuration de dépôts durs en Ni-Cr-Fe-B-Si réalisés par Laser Cladding. Il est montré que la fissuration est provoquée par la présence de contraintes mécaniques ... [more ▼]

Le rapport concerne l'étude de la fissuration de dépôts durs en Ni-Cr-Fe-B-Si réalisés par Laser Cladding. Il est montré que la fissuration est provoquée par la présence de contraintes mécaniques résiduelles d'origine thermique et on se trouve face à un phénomène de fissuration à froid. Le travail comporte également la comparaison de 4 nuances de poudre différentes utilisées en Laser Cladding au niveau du coefficient de dilatation thermique et des microstructures. La présence de composés céramiques (borure ou carbure) de nature pro-eutectique a pour effet de diminuer le coefficient de dilatation mais d'augmenter la fragilité. Le rôle du coefficient de dilatation thermique dans la fissuration semble être moins important que la nature de la microstructure en elle-même. Le choix de nuances présentant une structure hypo-eutectique et une haute dureté semble être pertinent en ce qui concerne l'établissement d'un compromis entre la dureté et la résilience de ces matériaux particuliers. [less ▲]

Detailed reference viewed: 120 (14 ULg)
Full Text
See detailFissures et accrocs du modèle idéologique de l'Egypte ancienne
Winand, Jean ULg

Conference given outside the academic context (2015)

Detailed reference viewed: 52 (3 ULg)
Full Text
See detailFistula plug in fistulising ano-perineal Crohn's disease: a randomised controlled trial
Senéjoux, A.; Siproudhis, L.; Abramowitz, L. et al

in Journal of Crohn's and Colitis [=JCC] (2015)

Detailed reference viewed: 18 (0 ULg)
Peer Reviewed
See detailLes fistules cholécysto-cholédociennes. Présentation d'un cas et revue de la littérature.
Defraigne, Jean-Olivier ULg; Bonnet, Pierre ULg; Meurisse, Michel ULg et al

in Acta Gastro-Enterologica Belgica (1986), IL(Septembre-Octobre),

Detailed reference viewed: 16 (0 ULg)
Full Text
Peer Reviewed
See detailFit of single tooth zirconia copings: comparison between various manufacturing processes.
Grenade, Charlotte ULg; MAINJOT, Amélie ULg; Vanheusden, Alain ULg

in Journal of Prosthetic Dentistry (2011), 105(4), 249-55

STATEMENT OF PROBLEM: Various CAD/CAM processes are commercially available to manufacture zirconia copings. Comparative data on their performance in terms of fit are needed. PURPOSE: The purpose of this ... [more ▼]

STATEMENT OF PROBLEM: Various CAD/CAM processes are commercially available to manufacture zirconia copings. Comparative data on their performance in terms of fit are needed. PURPOSE: The purpose of this in vitro study was to compare the internal and marginal fit of single tooth zirconia copings manufactured with a CAD/CAM process (Procera; Nobel Biocare) and a mechanized manufacturing process (Ceramill; Amann Girrbach). MATERIAL AND METHODS: Abutments (n=20) prepared in vivo for ceramic crowns served as a template for manufacturing both Procera and Ceramill zirconia copings. Copings were manufactured and cemented (Clearfil Esthetic Cement; Kuraray) on epoxy replicas of stone cast abutments. Specimens were sectioned. Nine measurements were performed for each coping. Over- and under-extended margins were evaluated. Comparisons between the 2 processes were performed with a generalized linear mixed model (alpha=.05). RESULTS: Internal gap values between Procera and Ceramill groups were not significantly different (P=.13). The mean marginal gap (SD) for Procera copings (51(50) mum) was significantly smaller than for Ceramill (81(66) mum) (P<.005). The percentages of over- and under-extended margins were 43% and 57% for Procera respectively, and 71% and 29% for Ceramill. CONCLUSIONS: Within the limitations of this in vitro study, the marginal fit of Procera copings was significantly better than that of Ceramill copings. Furthermore, Procera copings showed a smaller percentage of over-extended margins than did Ceramill copings. [less ▲]

Detailed reference viewed: 54 (9 ULg)
Full Text
Peer Reviewed
See detailFitness And Genetic Variation Of Viola Calaminaria, An Endemic Metallophyte: Implications Of Population Structure And History
Bizoux, Jean-Philippe ULg; Daïnou, Kasso ULg; Raspe, O. et al

in Plant Biology (2008), 10(6), 684-693

We investigated variations in genetic diversity and plant fitness in a rare endemic metallophyte of calamine soils, Viola calaminaria, in relation to population size, population connectivity and ... [more ▼]

We investigated variations in genetic diversity and plant fitness in a rare endemic metallophyte of calamine soils, Viola calaminaria, in relation to population size, population connectivity and population history in order to evaluate and discuss potential conservation strategies for the species. Mean population genetic diversity (Hs = 0.25) of V. calaminaria was similar to endemic non-metallophyte taxa. Twenty-one per cent of the genetic variation was partitioned among populations and a low (9%) but significant differentiation was found among geographical regions. Our results did not support the hypothesis that the acquisition of metal tolerance may result in reduced genetic diversity, and suggested that strict metallophytes do not exhibit higher inter-population differentiation resulting from scattered habitats. There were no relationships between population genetic diversity and population size. Significant correlations were found between plant fitness and (i) population size and (ii) connectivity index. Recently-founded populations exhibited the same level of genetic diversity as ancient populations and also possessed higher plant fitness. There was no indication of strong founder effects in recently-established populations. The results suggest that the creation of habitats through human activities could provide new opportunities for conservation of this species. [less ▲]

Detailed reference viewed: 108 (12 ULg)
Peer Reviewed
See detailFitness evaluation and molecular characterization of a recombinant murine norovirus (MuNoV) during serial passages in cell culture
Ferreira de Oliveira Filho, Edmilson; Di Felice, Elisabetta; Toffoli, Barbara et al

Conference (2015, September 01)

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a ... [more ▼]

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a recombinant Wu20/CW1 strain was obtained after in vitro coinfection of RAW264.7 cells with parental MuNoV strains CW1 and Wu20 (Mathijs et al 2010). The recombinant strain showed reduced plaque size compared to the parental strains and it was suggested that this was due to modified virulence properties in vitro. The aim of this study was to observe and molecularly characterize the natural genetic evolution of the recombinant MuNoV strain across in vitro replications. Methods: MNV strains used in this study were CW1, WU20 (Thackray et al., 2007, kindly provided by prof. H. Virgin) and Rec MNV (Mathijs et al., 2010). RAW 264.7 cells (ATCC TIB-71) grown in Dulbecco’s modified Eagle’s medium (Invitrogen) complemented (DMEMc) with 10 % heat inactivated FCS (BioWhittaker), 2 % penicillin (5000 U /ml) and streptomycin (5000 mg/ml) (PS; Invitrogen) and 1 % HEPES buffer (1 M; Invitrogen). The recombinant strain was serially replicated in vitro in RAW264.7 cells (up to 14 passages). RAW 264.7 (Mouse leukaemic monocyte macrophage) cells were infected with MNV for 72 hours and afterwards lysed by freeze and thaw and viruses purified by ultracentrifugation of both cells and supernatant. Viral plaque sizes of early and late progenies (30 for each virus) were compared with the Image J software. The experiment was repeated two times. RNA was extracted from 140 ml purified suspension 1:5 diluted using the QIAamp Viral RNA Mini KitTM (Qiagen) according to the manufacturer’s instructions. cDNA was generated using a poly-A primer tagged GCCAACGACCGGGAGGCCAGC(T)20 previously described (Müller et al 2007) using superscript ii reverse transcriptase kit (Invitrogen®) treated with RNase H or with other antisense primers using iScript select kit (Bio-Rad®). For the genetic characterization two different studies were conducted. The first study aimed to develop a sequencing strategy in order to obtain the complete genome of the recombinant MNV. Then, in the second study, sequences obtained from different viral passages into RAW cells (e.g. P5 and P14) were compared in order to study the viral adaptation. Primers were designed using the Primer Express® software and netprimer® (Premier biosoft). PCR was performed using taq polymerase with thermopol buffer (new England biolabs) as per manufacturer’s instructions. Afterwards, fragments were excised from agarose gel and DNA purified using the QIAquick Gel Extraction KitTM (Qiagen) and cloning using the PGEM T easy cloning kit (Promega) plasmid DNA was transferred to sequencing by GATC Biotech (Koblenz, Germany). Results: The size of the lysis plaque surface of P2 and P14 showed a considerable divergence. The average plaque size increased from the earlier to the later progenies (from 0.1 mm2 to around 0.5 mm2). A significant difference was demonstrated between them with the Mann and Whitney non parametric statistical test. The genetic characterization of the recombinant strain obtained in vitro was previously based on partial genomic sequences, which provided limited information. Accordingly to our initial molecular analysis of 1.5 kb partial genomic sequence comprising the part of the RdRp and the part of the VP1 did not show any genetic modifications between passage 4 (accession number HM044221) and passage 14 recMNV. Therefore, a strategy for sequencing the complete genome of the different MNV strains was established. The genome of the recombinant MNV was divided into seven regions and the amplification was performed using either new designed or previous published primers. Molecular analysis using the nearly complete genome of the recombinant MNV passage 14 and the two parental strains (CW1 and WU20) showed nine modifications in the genome, comprising three aminoacid changes. Accordingly, two modification were in the RdRp region aa position 1384 Glycine (G) instead of Aspartic acid (D) and aa position 1393 Serine (S) instead of Asparagine (N) and one modification was in the capsid region one modification on aa position 296 Glutamic Acid (E) instead of Lysine. Conclusion: Even preliminary, our data provide evidence of virus adaptation to a new environment (here a cell culture system) after a recombination event. In order to specify whether these hints of genetic mutations could explain fitness modifications during in vitro evolution we need to compare the sequences of passage 14 and the previous viral cellular passages. In addition, two other parameters of in vitro virulence modification will be investigated: (i) virus production and (ii) growth kinetics. The data should provide interesting information about genetic evolution in the genus Norovirus, especially regarding recombination events and explain how a recombinant strain, first disadvantaged compared to its parental strains, could regain fitness by genetic evolution. [less ▲]

Detailed reference viewed: 44 (4 ULg)
Peer Reviewed
Oliveira-Filho, Edmilson; Di Felice, Elisabetta; Toffoli, Barbara et al

Poster (2014, September 28)

Noroviruses are single stranded positive sense RNA viruses which can infect human and different animal species. Human norovirus (NoV) infections are among the most important causes of gastroenteritis in ... [more ▼]

Noroviruses are single stranded positive sense RNA viruses which can infect human and different animal species. Human norovirus (NoV) infections are among the most important causes of gastroenteritis in both children and adults. Infections often occur as outbreaks which may be foodborne. Due to the lack of an efficient cell culture system as well as a workable animal model, many aspects of the NoV infection in human are still poorly understood. The murine norovirus (MuNoV) grows easily in cell culture in contrast to the Human NoV, and constitutes an excellent animal model. Recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Recently, after in vitro coinfection of RAW264.7 cells with parental MuNoV strains CW1 and Wu20, we obtained a recombinant Wu20/CW1 strain. This recombinant strain showed reduced plaque size compared to the parental strains. The aim of the study was to observe and molecularly characterize the natural genetic evolution of the recombinant MuNoV strain across in vitro replications. Viral fitness is a complex concept. Here we defined this fitness as the ability of a viral population to adapt to the cell culture system. Thus, the recombinant strain was serially replicated in vitro in RAW264.7 cells (up to 14 passages). Viral plaque sizes of early and late progenies were compared with the Image J software. A significant difference was shown between them with the Mann and Whitney non parametric statistical test. Afterwards, viruses from different cell passages were cloned and sequenced. The average plaque size increased from the earlier to the later progenies (from 0.1 mm2 to around 0.5 mm2). Molecular investigations are currently performed in order to specify in which genetic region mutations occur and whether or not this could explain fitness modifications during in vitro evolution. In addition, two other parameters of in vitro virulence modification will be investigated: (i) virus production and (ii) one step growth kinetics. The data should provide interesting information about genetic evolution in the genus Norovirus, especially regarding recombination events and explain how a recombinant strain, first disadvantaged compared to its parental strains, could regain fitness by genetic evolution. [less ▲]

Detailed reference viewed: 40 (5 ULg)
See detailFitness evolution of a recombinant murine norovirus during serial passages in cell culture
Oliveira-Filho, Edmilson; Di Felice, Elisabetta; Toffoli, Barbara et al

Poster (2014, October 17)

Human norovirus (NoV) infections are among the most important causes of gastroenteritis in both children and adults and often occur as outbreaks which may be foodborne. Recombination can dramatically ... [more ▼]

Human norovirus (NoV) infections are among the most important causes of gastroenteritis in both children and adults and often occur as outbreaks which may be foodborne. Recombination can dramatically change virulence properties of the viruses and has been often evidenced in silico for different NoV strains. Recently, after in vitro coinfection of RAW264.7 cells with parental murine norovirus (MuNoV) strains CW1 and Wu20, we obtained a recombinant Wu20/CW1 strain (Mathijs et al., 2010). This recombinant strain showed reduced plaque size compared to the parental strains. The aim of the study was to observe and molecularly characterize the natural genetic evolution of the recombinant MuNoV strain across in vitro replications. The recombinant strain was serially replicated in vitro (up to 14 passages). Viral plaque diameters of early and late progenies were compared with the Image software. A significant difference was shown between them with the Mann and Whitney non parametric statistical test. The average size of plaques increased from the earlier to the later progenies (from 0.1 mm2 to around 0.5 mm2). Molecular investigations are currently performed in order to specify in which genetic region mutations occur and whether or not this could explain fitness modifications during in vitro evolution. In addition two other parameters of in vitro virulence modification will be investigated (i) virus production and (ii) one step growth kinetics. The data should provide interesting information about genetic evolution in the genus Norovirus, especially regarding recombination events and explain how a recombinant strain, first disadvantaged compared to its parental strains, could regain fitness by genetic evolution. Mathijs, E., Muylkens, B., Mauroy, A., Ziant, D., Delwiche, T., Thiry, E., 2010. Experimental evidence of recombination in murine noroviruses. J Gen Virol 91, 2723-2733. [less ▲]

Detailed reference viewed: 12 (0 ULg)
Full Text
Peer Reviewed
See detail"Fitness" versus "fatness": impacts cardio-metaboliques respectifs aux differents ages de la vie.
ESSER, Nathalie ULg; Paquot, Nicolas ULg; Scheen, André ULg

in Revue Médicale de Liège (2010), 65(4), 199-205

Almost 35% of overweight or obese individuals are free of any metabolic disorder. This may be explained by a favourable fat distribution. However, those individuals also have a higher level of physical ... [more ▼]

Almost 35% of overweight or obese individuals are free of any metabolic disorder. This may be explained by a favourable fat distribution. However, those individuals also have a higher level of physical fitness. Therefore, deleterious cardiometabolic effects of excessive fat mass ("fatness") might be counterbalanced by regular physical activity leading to high cardiorespiratory fitness ("fitness"). The present article first analyzes the various pathophysiological mechanisms explaining why muscular exercise has beneficial effects and second, describes the relationship between "fitness" and "fatness" and their respective cardiometabolic consequences at various ages: adolescents, adults and elderly people. [less ▲]

Detailed reference viewed: 144 (4 ULg)
Full Text
Peer Reviewed
See detailFitness-related parameters improve presence-only distribution modelling for conservation practice: The case of the red-backed shrike
Titeux, N.; Dufrêne, Marc ULg; Radoux, J. et al

in Biological Conservation (2007), 138(1-2), 207-223

The red-backed shrike (Lanius collurio L.) is a bird living in human-altered agricultural areas that are managed by extensive farming techniques. This passerine species has declined significantly in ... [more ▼]

The red-backed shrike (Lanius collurio L.) is a bird living in human-altered agricultural areas that are managed by extensive farming techniques. This passerine species has declined significantly in Western Europe over the last 30-40 years. The development of efficient species-specific conservation strategies relies on fine-grained information about the ecological resources and environmental conditions that constitute its reproductive habitat in this agricultural landscape. Species distribution models are used increasingly in conservation biology to provide such information. Most studies investigate the environmental pattern of species distribution, assuming that species records are reliable indicators of habitat suitability. However, ecological theory on source-sink dynamics and ecological traps points out that some individuals may be located outside the environmental bounds of their species' reproductive niche. Those individuals could reduce model accuracy and limit model utility. Parameters related to the reproductive success of this shrike in Southern Belgium were integrated into a fine-scale presence-only modelling framework to demonstrate this problem and to address critical habitat requirements of this species relative to conservation management. Integrating reproductive parameters into the modelling framework showed that individuals occurred, but did not reproduce successfully, above a certain environmental threshold. This indicated that the reproductive niche of the shrike is ecologically narrower than standard practice in species distribution modelling would suggest. The major resources (nest sites availability, distance to human settlements, suitable perching sites, foraging areas and insect abundance) required for the reproduction of the red-backed shrike were quantified and ranked to offer concrete species-specific conservation management guidelines. © 2007 Elsevier Ltd. All rights reserved. [less ▲]

Detailed reference viewed: 30 (14 ULg)
Full Text
Peer Reviewed
See detailFitting lactation curves of dairy cattle in different types of herds in Tunisia
Rekik, Boulbaba; Ben Gara, Abderrahmen; Ben Hamouda, Mohamed et al

in Livestock Production Science (2003), 83(2-3), 309-315

The incomplete gamma function was used to fit lactation curves of Holstein-Friesian cows in four types of herds in Tunisia. A total of 8640 records were used in the analysis. These included 1269, 637, 239 ... [more ▼]

The incomplete gamma function was used to fit lactation curves of Holstein-Friesian cows in four types of herds in Tunisia. A total of 8640 records were used in the analysis. These included 1269, 637, 239, and 498 first lactation and 2986, 1441, 650, and 920 second and later lactation records in four herd groups namely investors, state, cooperative, and farmers' herds, respectively. The effects of environmental variables, production sector, herd, parity, first test-day date, calving year, and calving season on the main lactation curve traits were analysed. The factors associated with milk yield at the beginning of lactation and the decreasing phase of the curve, persistency, and peak yield varied significantly (P<0.01) with all variables. The ascending phase of the lactation curve was not affected by parity and calving year, while days in milk until peak depended only on the rank of lactation. The state herds had the lowest peak and total yields. The summer season was unfavourable for milk production. In contrast to first lactation cows, third lactation cows had the highest peak and total yields. Milk yield was highly correlated with peak yield (r = 0.79) and was not related to persistency measure. (C) 2003 Elsevier B.V. All rights reserved. [less ▲]

Detailed reference viewed: 251 (6 ULg)