     by title

0-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

or enter first few letters:   
Full Text
Peer Reviewed
See detailFitness And Genetic Variation Of Viola Calaminaria, An Endemic Metallophyte: Implications Of Population Structure And History
Bizoux, Jean-Philippe ULg; Daïnou, Kasso ULg; Raspe, O. et al

in Plant Biology (2008), 10(6), 684-693

We investigated variations in genetic diversity and plant fitness in a rare endemic metallophyte of calamine soils, Viola calaminaria, in relation to population size, population connectivity and ... [more ▼]

We investigated variations in genetic diversity and plant fitness in a rare endemic metallophyte of calamine soils, Viola calaminaria, in relation to population size, population connectivity and population history in order to evaluate and discuss potential conservation strategies for the species. Mean population genetic diversity (Hs = 0.25) of V. calaminaria was similar to endemic non-metallophyte taxa. Twenty-one per cent of the genetic variation was partitioned among populations and a low (9%) but significant differentiation was found among geographical regions. Our results did not support the hypothesis that the acquisition of metal tolerance may result in reduced genetic diversity, and suggested that strict metallophytes do not exhibit higher inter-population differentiation resulting from scattered habitats. There were no relationships between population genetic diversity and population size. Significant correlations were found between plant fitness and (i) population size and (ii) connectivity index. Recently-founded populations exhibited the same level of genetic diversity as ancient populations and also possessed higher plant fitness. There was no indication of strong founder effects in recently-established populations. The results suggest that the creation of habitats through human activities could provide new opportunities for conservation of this species. [less ▲]

Detailed reference viewed: 95 (12 ULg)
Peer Reviewed
See detailFitness evaluation and molecular characterization of a recombinant murine norovirus (MuNoV) during serial passages in cell culture
Ferreira de Oliveira Filho, Edmilson; Di Felice, Elisabetta; Toffoli, Barbara et al

Conference (2015, September 01)

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a ... [more ▼]

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a recombinant Wu20/CW1 strain was obtained after in vitro coinfection of RAW264.7 cells with parental MuNoV strains CW1 and Wu20 (Mathijs et al 2010). The recombinant strain showed reduced plaque size compared to the parental strains and it was suggested that this was due to modified virulence properties in vitro. The aim of this study was to observe and molecularly characterize the natural genetic evolution of the recombinant MuNoV strain across in vitro replications. Methods: MNV strains used in this study were CW1, WU20 (Thackray et al., 2007, kindly provided by prof. H. Virgin) and Rec MNV (Mathijs et al., 2010). RAW 264.7 cells (ATCC TIB-71) grown in Dulbecco’s modified Eagle’s medium (Invitrogen) complemented (DMEMc) with 10 % heat inactivated FCS (BioWhittaker), 2 % penicillin (5000 U /ml) and streptomycin (5000 mg/ml) (PS; Invitrogen) and 1 % HEPES buffer (1 M; Invitrogen). The recombinant strain was serially replicated in vitro in RAW264.7 cells (up to 14 passages). RAW 264.7 (Mouse leukaemic monocyte macrophage) cells were infected with MNV for 72 hours and afterwards lysed by freeze and thaw and viruses purified by ultracentrifugation of both cells and supernatant. Viral plaque sizes of early and late progenies (30 for each virus) were compared with the Image J software. The experiment was repeated two times. RNA was extracted from 140 ml purified suspension 1:5 diluted using the QIAamp Viral RNA Mini KitTM (Qiagen) according to the manufacturer’s instructions. cDNA was generated using a poly-A primer tagged GCCAACGACCGGGAGGCCAGC(T)20 previously described (Müller et al 2007) using superscript ii reverse transcriptase kit (Invitrogen®) treated with RNase H or with other antisense primers using iScript select kit (Bio-Rad®). For the genetic characterization two different studies were conducted. The first study aimed to develop a sequencing strategy in order to obtain the complete genome of the recombinant MNV. Then, in the second study, sequences obtained from different viral passages into RAW cells (e.g. P5 and P14) were compared in order to study the viral adaptation. Primers were designed using the Primer Express® software and netprimer® (Premier biosoft). PCR was performed using taq polymerase with thermopol buffer (new England biolabs) as per manufacturer’s instructions. Afterwards, fragments were excised from agarose gel and DNA purified using the QIAquick Gel Extraction KitTM (Qiagen) and cloning using the PGEM T easy cloning kit (Promega) plasmid DNA was transferred to sequencing by GATC Biotech (Koblenz, Germany). Results: The size of the lysis plaque surface of P2 and P14 showed a considerable divergence. The average plaque size increased from the earlier to the later progenies (from 0.1 mm2 to around 0.5 mm2). A significant difference was demonstrated between them with the Mann and Whitney non parametric statistical test. The genetic characterization of the recombinant strain obtained in vitro was previously based on partial genomic sequences, which provided limited information. Accordingly to our initial molecular analysis of 1.5 kb partial genomic sequence comprising the part of the RdRp and the part of the VP1 did not show any genetic modifications between passage 4 (accession number HM044221) and passage 14 recMNV. Therefore, a strategy for sequencing the complete genome of the different MNV strains was established. The genome of the recombinant MNV was divided into seven regions and the amplification was performed using either new designed or previous published primers. Molecular analysis using the nearly complete genome of the recombinant MNV passage 14 and the two parental strains (CW1 and WU20) showed nine modifications in the genome, comprising three aminoacid changes. Accordingly, two modification were in the RdRp region aa position 1384 Glycine (G) instead of Aspartic acid (D) and aa position 1393 Serine (S) instead of Asparagine (N) and one modification was in the capsid region one modification on aa position 296 Glutamic Acid (E) instead of Lysine. Conclusion: Even preliminary, our data provide evidence of virus adaptation to a new environment (here a cell culture system) after a recombination event. In order to specify whether these hints of genetic mutations could explain fitness modifications during in vitro evolution we need to compare the sequences of passage 14 and the previous viral cellular passages. In addition, two other parameters of in vitro virulence modification will be investigated: (i) virus production and (ii) growth kinetics. The data should provide interesting information about genetic evolution in the genus Norovirus, especially regarding recombination events and explain how a recombinant strain, first disadvantaged compared to its parental strains, could regain fitness by genetic evolution. [less ▲]

Detailed reference viewed: 36 (4 ULg)
Peer Reviewed
Oliveira-Filho, Edmilson; Di Felice, Elisabetta; Toffoli, Barbara et al

Poster (2014, September 28)

Noroviruses are single stranded positive sense RNA viruses which can infect human and different animal species. Human norovirus (NoV) infections are among the most important causes of gastroenteritis in ... [more ▼]

Noroviruses are single stranded positive sense RNA viruses which can infect human and different animal species. Human norovirus (NoV) infections are among the most important causes of gastroenteritis in both children and adults. Infections often occur as outbreaks which may be foodborne. Due to the lack of an efficient cell culture system as well as a workable animal model, many aspects of the NoV infection in human are still poorly understood. The murine norovirus (MuNoV) grows easily in cell culture in contrast to the Human NoV, and constitutes an excellent animal model. Recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Recently, after in vitro coinfection of RAW264.7 cells with parental MuNoV strains CW1 and Wu20, we obtained a recombinant Wu20/CW1 strain. This recombinant strain showed reduced plaque size compared to the parental strains. The aim of the study was to observe and molecularly characterize the natural genetic evolution of the recombinant MuNoV strain across in vitro replications. Viral fitness is a complex concept. Here we defined this fitness as the ability of a viral population to adapt to the cell culture system. Thus, the recombinant strain was serially replicated in vitro in RAW264.7 cells (up to 14 passages). Viral plaque sizes of early and late progenies were compared with the Image J software. A significant difference was shown between them with the Mann and Whitney non parametric statistical test. Afterwards, viruses from different cell passages were cloned and sequenced. The average plaque size increased from the earlier to the later progenies (from 0.1 mm2 to around 0.5 mm2). Molecular investigations are currently performed in order to specify in which genetic region mutations occur and whether or not this could explain fitness modifications during in vitro evolution. In addition, two other parameters of in vitro virulence modification will be investigated: (i) virus production and (ii) one step growth kinetics. The data should provide interesting information about genetic evolution in the genus Norovirus, especially regarding recombination events and explain how a recombinant strain, first disadvantaged compared to its parental strains, could regain fitness by genetic evolution. [less ▲]

Detailed reference viewed: 39 (5 ULg)
See detailFitness evolution of a recombinant murine norovirus during serial passages in cell culture
Oliveira-Filho, Edmilson; Di Felice, Elisabetta; Toffoli, Barbara et al

Poster (2014, October 17)

Human norovirus (NoV) infections are among the most important causes of gastroenteritis in both children and adults and often occur as outbreaks which may be foodborne. Recombination can dramatically ... [more ▼]

Human norovirus (NoV) infections are among the most important causes of gastroenteritis in both children and adults and often occur as outbreaks which may be foodborne. Recombination can dramatically change virulence properties of the viruses and has been often evidenced in silico for different NoV strains. Recently, after in vitro coinfection of RAW264.7 cells with parental murine norovirus (MuNoV) strains CW1 and Wu20, we obtained a recombinant Wu20/CW1 strain (Mathijs et al., 2010). This recombinant strain showed reduced plaque size compared to the parental strains. The aim of the study was to observe and molecularly characterize the natural genetic evolution of the recombinant MuNoV strain across in vitro replications. The recombinant strain was serially replicated in vitro (up to 14 passages). Viral plaque diameters of early and late progenies were compared with the Image software. A significant difference was shown between them with the Mann and Whitney non parametric statistical test. The average size of plaques increased from the earlier to the later progenies (from 0.1 mm2 to around 0.5 mm2). Molecular investigations are currently performed in order to specify in which genetic region mutations occur and whether or not this could explain fitness modifications during in vitro evolution. In addition two other parameters of in vitro virulence modification will be investigated (i) virus production and (ii) one step growth kinetics. The data should provide interesting information about genetic evolution in the genus Norovirus, especially regarding recombination events and explain how a recombinant strain, first disadvantaged compared to its parental strains, could regain fitness by genetic evolution. Mathijs, E., Muylkens, B., Mauroy, A., Ziant, D., Delwiche, T., Thiry, E., 2010. Experimental evidence of recombination in murine noroviruses. J Gen Virol 91, 2723-2733. [less ▲]

Detailed reference viewed: 9 (0 ULg)
Full Text
Peer Reviewed
See detail"Fitness" versus "fatness": impacts cardio-metaboliques respectifs aux differents ages de la vie.
ESSER, Nathalie ULg; Paquot, Nicolas ULg; Scheen, André ULg

in Revue Médicale de Liège (2010), 65(4), 199-205

Almost 35% of overweight or obese individuals are free of any metabolic disorder. This may be explained by a favourable fat distribution. However, those individuals also have a higher level of physical ... [more ▼]

Almost 35% of overweight or obese individuals are free of any metabolic disorder. This may be explained by a favourable fat distribution. However, those individuals also have a higher level of physical fitness. Therefore, deleterious cardiometabolic effects of excessive fat mass ("fatness") might be counterbalanced by regular physical activity leading to high cardiorespiratory fitness ("fitness"). The present article first analyzes the various pathophysiological mechanisms explaining why muscular exercise has beneficial effects and second, describes the relationship between "fitness" and "fatness" and their respective cardiometabolic consequences at various ages: adolescents, adults and elderly people. [less ▲]

Detailed reference viewed: 97 (4 ULg)
Full Text
Peer Reviewed
See detailFitness-related parameters improve presence-only distribution modelling for conservation practice: The case of the red-backed shrike
Titeux, N.; Dufrêne, Marc ULg; Radoux, J. et al

in Biological Conservation (2007), 138(1-2), 207-223

The red-backed shrike (Lanius collurio L.) is a bird living in human-altered agricultural areas that are managed by extensive farming techniques. This passerine species has declined significantly in ... [more ▼]

The red-backed shrike (Lanius collurio L.) is a bird living in human-altered agricultural areas that are managed by extensive farming techniques. This passerine species has declined significantly in Western Europe over the last 30-40 years. The development of efficient species-specific conservation strategies relies on fine-grained information about the ecological resources and environmental conditions that constitute its reproductive habitat in this agricultural landscape. Species distribution models are used increasingly in conservation biology to provide such information. Most studies investigate the environmental pattern of species distribution, assuming that species records are reliable indicators of habitat suitability. However, ecological theory on source-sink dynamics and ecological traps points out that some individuals may be located outside the environmental bounds of their species' reproductive niche. Those individuals could reduce model accuracy and limit model utility. Parameters related to the reproductive success of this shrike in Southern Belgium were integrated into a fine-scale presence-only modelling framework to demonstrate this problem and to address critical habitat requirements of this species relative to conservation management. Integrating reproductive parameters into the modelling framework showed that individuals occurred, but did not reproduce successfully, above a certain environmental threshold. This indicated that the reproductive niche of the shrike is ecologically narrower than standard practice in species distribution modelling would suggest. The major resources (nest sites availability, distance to human settlements, suitable perching sites, foraging areas and insect abundance) required for the reproduction of the red-backed shrike were quantified and ranked to offer concrete species-specific conservation management guidelines. © 2007 Elsevier Ltd. All rights reserved. [less ▲]

Detailed reference viewed: 30 (14 ULg)
Full Text
Peer Reviewed
See detailFitting lactation curves of dairy cattle in different types of herds in Tunisia
Rekik, Boulbaba; Ben Gara, Abderrahmen; Ben Hamouda, Mohamed et al

in Livestock Production Science (2003), 83(2-3), 309-315

The incomplete gamma function was used to fit lactation curves of Holstein-Friesian cows in four types of herds in Tunisia. A total of 8640 records were used in the analysis. These included 1269, 637, 239 ... [more ▼]

The incomplete gamma function was used to fit lactation curves of Holstein-Friesian cows in four types of herds in Tunisia. A total of 8640 records were used in the analysis. These included 1269, 637, 239, and 498 first lactation and 2986, 1441, 650, and 920 second and later lactation records in four herd groups namely investors, state, cooperative, and farmers' herds, respectively. The effects of environmental variables, production sector, herd, parity, first test-day date, calving year, and calving season on the main lactation curve traits were analysed. The factors associated with milk yield at the beginning of lactation and the decreasing phase of the curve, persistency, and peak yield varied significantly (P<0.01) with all variables. The ascending phase of the lactation curve was not affected by parity and calving year, while days in milk until peak depended only on the rank of lactation. The state herds had the lowest peak and total yields. The summer season was unfavourable for milk production. In contrast to first lactation cows, third lactation cows had the highest peak and total yields. Milk yield was highly correlated with peak yield (r = 0.79) and was not related to persistency measure. (C) 2003 Elsevier B.V. All rights reserved. [less ▲]

Detailed reference viewed: 227 (6 ULg)
See detailFive Blind Boys of Alabama
Sacré, Robert ULg

Article for general public (2005)

Detailed reference viewed: 18 (0 ULg)
Peer Reviewed
See detailFive cases of infection due to Scedosporium apiospermum
Hayette, Marie-Pierre ULg; Peguet, C.; de Bièvre, Claude et al

Poster (1995)

We report five cases of infection due to Scedosporium apiospermum and his teleomorph Pseudallescheria boydii (Ascomycete), diagnosed in the University Amiens Hospital. The most important clinical ... [more ▼]

We report five cases of infection due to Scedosporium apiospermum and his teleomorph Pseudallescheria boydii (Ascomycete), diagnosed in the University Amiens Hospital. The most important clinical, epidemiological and diagnostic aspects a summurized in the next table. Nb year sex age job clinical statute site mycology (direct culture histology) Ampho B (S or R) TT 1 1992 F 31 secretary sinusitis sinus + S. apiospermum + S surg 2 1993 F 8 schoolgirl cystic fibrosis lung + P. boydii NR R physio 3 1993 M 66 pensioner corticoid cut/scut + S. apiospermum + R keto 4 1994 M 54 farmer corticoid sinus + P. boydii + S surg 5 1994 M 69 pensioner corticoid scut + S. apiospermum NR R surg ampho B: amphotericin B; tt: treatment; histo: histology; S or R: sensitive or resistant; surg: surgery; NR: non realized; physio: physiotherapy, cut/scut: cutaneous/subcutaneous. keto: ketoconazole. Epidemiology. The five cases concern french people living in Picardy (France). All have risk factors: corticotherapy, cystic fibrosis, sinusitis. The average age is 46 years with a sex-ratio 1,5. All the people are living in a rural area and one of them is farmer. The mode of contamination is probably the respiratory tract for the cases 1, 2 and 4. For the third one, the patient reported pricks during a walk in forest. The case 5 occured after forearm surgery. Clinical aspects. The young woman had a past of bacterial sinusal infection with posterior discharge since one year. Unsuccessful treatment With antibiotics and corticoids could explain the development of the fungus. The young girl affected by cystic fibrosis had no modification of the respiratory capacity and we concluded to a simple colonisation of the respiratory tract. For the case 5, the infection by Scedosporium didn't explain the death of the patient three days later. No case led to disseminated infection even for the patients under long-term corticotherapy. Mycology. The teleomorph, P. boydii was observed in only two cases with development of cleistothecia after several weeks of culture at room temperature. In all cases, direct examination showed numerous hyphae excepted the case 4, which showed numerous fungal cells with rare hyphae. Three of the five strains were "in vitro" resistant to amphotericine B and all were sensitive to ketoconazole. Treatment. The treatment were successful in all cases. Conclusion. These five cases of infection due to S. apiospermum are very similar to those described in the literature. Surgery seems to be the best treatment possible. All the strains exhibited low pathogenic power that proves the opportunistic character of this fungus. [less ▲]

Detailed reference viewed: 54 (1 ULg)
Full Text
Peer Reviewed
See detailFive labdane diterpenoids from the seeds of Aframomum zambesiacum
Kenmogne, Marguerite; Prost, Elise; Harakat, Dominique et al

in Phytochemistry (2006), 67(5), 433-438

Five labdane diterpenoids, (3-5), zambesiacolactone A (7) and zambesiacolactone B (8), were isolated from the seeds of Aframomum zambesiacum (Baker) K. Schum., along with five known labdanes and a linear ... [more ▼]

Five labdane diterpenoids, (3-5), zambesiacolactone A (7) and zambesiacolactone B (8), were isolated from the seeds of Aframomum zambesiacum (Baker) K. Schum., along with five known labdanes and a linear sesquiterpene, nerolidol. Their structures were elucidated by spectroscopic analysis. Their antiplasmodial activity was evaluated in vitro against Plasmodium falciparum. Compound 3 was the most active with an IC50 value of 4.97 mu M. (c) 2005 Elsevier Ltd. All rights reserved. [less ▲]

Detailed reference viewed: 91 (7 ULg)
Full Text
Peer Reviewed
See detailFive transiting hot Jupiters discovered using WASP-South, Euler, and TRAPPIST: WASP-119 b, WASP-124 b, WASP-126 b, WASP-129 b, and WASP-133 b
Maxted, P. F. L.; Anderson, D. R.; Collier Cameron, A. et al

in Astronomy and Astrophysics (2016), 591

We have used photometry from the WASP-South instrument to identify 5 stars showing planet-like transits in their light curves. The planetary nature of the companions to these stars has been confirmed ... [more ▼]

We have used photometry from the WASP-South instrument to identify 5 stars showing planet-like transits in their light curves. The planetary nature of the companions to these stars has been confirmed using photometry from the EulerCam instrument on the Swiss Euler 1.2-m telescope and the TRAPPIST telescope, and spectroscopy obtained with the CORALIE spectrograph. The planets discovered are hot Jupiter systems with orbital periods in the range 2.17 to 5.75 days, masses from 0.3 M[SUB]Jup[/SUB] to 1.2 M[SUB]Jup[/SUB] and with radii from 1 R[SUB]Jup[/SUB] to 1.5 R[SUB]Jup[/SUB]. These planets orbit bright stars (V = 11-13) with spectral types in the range F9 to G4. WASP-126 is the brightest planetary system in this sample and hosts a low-mass planet with a large radius (0.3 M[SUB]Jup[/SUB],0.95 R[SUB]Jup[/SUB]), making it a good target for transmission spectroscopy. The high density of WASP-129 A suggests that it is a helium-rich star similar to HAT-P-11 A. WASP-133 A has an enhanced surface lithium abundance compared to other old G-type stars, particularly other planet host stars. These planetary systems are good targets for follow-up observations with ground-based and space-based facilities to study their atmospheric and dynamical properties. Full Tables 2 and 3 are only available at the CDS via anonymous ftp to <A href=""></A> (<A href=""></A>) or via <A href=""></A> [less ▲]

Detailed reference viewed: 3 (1 ULg)
Peer Reviewed
See detailFive Years of aphidophagous species sampling in belgian corn
Vandereycken, Axel ULg; Fassotte, Bérénice ULg; Durieux, Delphine ULg et al

Poster (2014, May 20)

The community of aphidophagous species present in agroecosystems is disturbed since the introduction of an exotic species the Multicoloured Asian Ladybird, Harmonia axyridis Pallas (Coleoptera ... [more ▼]

The community of aphidophagous species present in agroecosystems is disturbed since the introduction of an exotic species the Multicoloured Asian Ladybird, Harmonia axyridis Pallas (Coleoptera: Coccinellidae). In this intensive agricultural area, five aphids predator species are commonly observed: three coccinellids H. axyridis, Coccinella septempunctata, Propylea quatuordecimpunctata, one hoverfly Episyrphus balteatus, and one lacewing Chrysoperla carnea. This study focuses on the occurrence of the five most abundant aphid predators and their seasonal abundance in corn. The abundance of adults and larvae of these species was evaluated over a five-year period, from 2009 to 2013. The sampling method consisted in the counting of aphids and all developmental stages of aphidophages present in quadrats of 1m² from April to November. Densities of aphid predators changed during five years studies. Since 2011, H. axyridis was the most abundant aphids predators in corn. H. axyridis numbers were found to increase over the first four inventoried year, reaching in 2012 86% for adult stage (119,7±7,8 adults/100m2) and 76% for larvae stages (242,8±14,2 larvae/100m2) of the aphid predators, while in 2009 these ratios were 14% and 23% respectively. For C. septempunctata and P. quatuordecimpunctata the population densities decrease at the end of the five years period. Population densities of C. carnea and E. balteatus were variable during the sampling period but increased in 2013. Phenology of the five studied species presents similar curves following the aphid abundance. The most abundant observed aphids were metopolophium dirhodum, rhopalosiphum padi, rhopalosiphum maidis, sitobion avenae and sitobion fragariae. H. axyridis starts reproducing after the peak in aphid population, suggesting that H. axyridis is able to complete its development by feeding on alternative prey such as larvae and pupae of conspecific and heterospecific. H. axyridis is a bivoltine species but the second generation was stop by the corn harvesting. [less ▲]

Detailed reference viewed: 29 (10 ULg)
Full Text
See detailFive years of comet narrow band photometry and imaging with TRAPPIST
Opitom, Cyrielle ULg; Jehin, Emmanuel ULg; Manfroid, Jean ULg et al

in Bulletin of the American Astronomical Society (2015, November 01), 47

TRAPPIST is a 60-cm robotic telescope in La Silla Observatory [1] mainly dedicated to the study of exoplanets and comets. The telescope is equipped with a set of narrow band cometary filters designed by ... [more ▼]

TRAPPIST is a 60-cm robotic telescope in La Silla Observatory [1] mainly dedicated to the study of exoplanets and comets. The telescope is equipped with a set of narrow band cometary filters designed by the NASA for the Hale-Bopp observing campaign [2]. Since its installation in 2010, we gathered a high quality and homogeneous data set of more than 30 bright comets observed with narrow band filters. Some comets were only observed for a few days but others have been observed weekly during several months on both sides of perihelion. From the images, we derived OH, NH, CN, C[SUB]2[/SUB], and C[SUB]3[/SUB] production rates using a Haser [3] model in addition to the Afρ parameter as a proxy for the dust production. We computed production rates ratios and the dust color for each comet to study their composition and followed the evolution of these ratios and colors with the heliocentric distance.The TRAPPIST data set, rich of more than 10000 images obtained and reduced in an homogeneous way, allows us to address several fundamental questions such as the pristine or evolutionary origin of composition differences among comets. The evolution of comet activity with the heliocentric distance, the differences between species, and from comet to comet, will be discussed. Finally, the first results about the one year campaign on comet C/2013 US10 (Catalina) and our recent work on the re-determination of Haser scalelengths will be presented.[1] Jehin et al., The Messenger, 145, 2-6, 2011[2] Farnham et al., Icarus, 147, 180-204, 2000[3] Haser, Bulletin de l’Académie Royal des Sciences de Belgique,63, 739, 1957 [less ▲]

Detailed reference viewed: 24 (6 ULg)
Full Text
Peer Reviewed
See detailFive years of denosumab exposure in women with postmenopausal osteoporosis: Results from the first two years of the FREEDOM extension.
Papapoulos, S.; Chapurlat, R.; Libanati, C. et al

in Journal of Bone and Mineral Research (2012), 27(3), 694-701

The 3-year FREEDOM trial assessed the efficacy and safety of 60 mg denosumab every 6 months for treatment of postmenopausal women with osteoporosis. Participants who completed FREEDOM were eligible to ... [more ▼]

The 3-year FREEDOM trial assessed the efficacy and safety of 60 mg denosumab every 6 months for treatment of postmenopausal women with osteoporosis. Participants who completed FREEDOM were eligible to enter an extension to continue the evaluation of denosumab efficacy and safety for up to 10 years. For the extension results presented here, women from the FREEDOM denosumab group had 2 more years of denosumab treatment (long-term group) and those from the FREEDOM placebo group had 2 years of denosumab exposure (cross-over group). We report results for bone turnover markers (BTMs), bone mineral density (BMD), fractures rates, and safety. A total of 4550 women enrolled in the extension (2343 long-term; 2207 cross-over). Reductions in BTMs were maintained (long-term group) or occurred rapidly (cross-over group) following denosumab administration. In the long-term group, lumbar spine and total hip BMD increased further, resulting in 5-year gains of 13.7% and 7.0%, respectively. In the cross-over group, BMD increased at the lumbar spine (7.7%) and total hip (4.0%) during the 2-year denosumab treatment. Yearly fracture incidences for both groups were below rates observed in the FREEDOM placebo group and below rates projected for a "virtual untreated twin" cohort. Adverse events did not increase with long-term denosumab administration. Two adverse events in the cross-over group were adjudicated as consistent with osteonecrosis of the jaw (ONJ). Five-year denosumab treatment of women with postmenopausal osteoporosis maintained BTM reduction and increased BMD, and was associated with low fracture rates and a favorable risk/benefit profile. (c) 2011 American Society for Bone and Mineral Research. [less ▲]

Detailed reference viewed: 41 (12 ULg)
Full Text
Peer Reviewed
See detailFive years of experience for the promotion of a better nutritional environment in schools : The programme "Je mange bien à l'école" (I eat well at school) an innovatie project developed in the French-speaking Community of Belgium
Vandoorne, Chantal ULg

in Bouwman, L. I.; Boonekamp, G. M. M.; Koelen, M. A. (Eds.) Proceedings of the International conference on Health Promotion and Nutrition (1996)

Detailed reference viewed: 29 (14 ULg)
See detailFive years on for Fukushima's IDPs: Life with radiological risk and without a community safety net
Hasegawa, Reiko ULg

E-print/Working paper (2016)

On the fifth anniversary of the Fukushima nuclear accident, the article analyses what are at stake in the communities affected by the disaster, based on the result of the field interviews conducted in ... [more ▼]

On the fifth anniversary of the Fukushima nuclear accident, the article analyses what are at stake in the communities affected by the disaster, based on the result of the field interviews conducted in Fukushima. [less ▲]

Detailed reference viewed: 18 (0 ULg)
Full Text
Peer Reviewed
See detailFive years treatment with strontium ranelate reduces vertebral and nonvertebral fractures and increases the number and quality of remaining life-years in women over 80 years of age.
Seeman, Ego; Boonen, Steven; Borgstrom, Frederik et al

in BONE (2010), 46(4), 1038-42

INTRODUCTION: Longevity has resulted in a greater proportion of the population entering a time of life when increasing bone fragility and falls predispose to fractures, particularly nonvertebral fractures ... [more ▼]

INTRODUCTION: Longevity has resulted in a greater proportion of the population entering a time of life when increasing bone fragility and falls predispose to fractures, particularly nonvertebral fractures. Women over 80 years of age constitute 10% of the population but contribute 30% of all fractures and 60% of all nonvertebral fractures. Despite this, few studies have examined antifracture efficacy of treatments in this high-risk group and none has provided evidence for benefits beyond 3 years. MATERIALS AND METHODS: To determine whether strontium ranelate reduces the risk of vertebral and nonvertebral fractures during 5 years, we analyzed a subgroup of 1489 female patients over 80 years of age (mean 83.5+/-3.0 years) with osteoporosis from the SOTI (spinal osteoporosis therapeutic intervention) and TROPOS (treatment of peripheral osteoporosis) studies randomized to strontium ranelate 2 g/d or placebo. All received a supplement of calcium plus vitamin D. RESULTS: By intention to treat, vertebral fracture risk was reduced by 31% (relative risk, RR=0.69; 95% confidence interval, CI 0.52-0.92), nonvertebral fracture risk by 27% (RR=0.73; 95% CI 0.57-0.95), major nonvertebral fracture risk by 33% (RR=0.67; 95% CI 0.50-0.89) and hip fracture risk by 24% (RR=0.76; 95% CI 0.50-1.15, not significant). Treatment was cost-saving as it decreased cost and increased QALYs and life-years. DISCUSSION: Strontium ranelate safely produced a significant reduction in vertebral and nonvertebral fracture risk during 5 years in postmenopausal women over 80 years of age and was cost saving. [less ▲]

Detailed reference viewed: 14 (1 ULg)
Full Text
Peer Reviewed
See detailFive-spring model for complete shear behaviour of deep beams
Mihaylov, Boyan ULg

in Structural Concrete (2015), 16(1), 71-83

This paper presents a five-spring model capable of predicting the complete pre- and post-peak shear behaviour of deep beams. The model stems from a two-parameter kinematic theory (2PKT) for the shear ... [more ▼]

This paper presents a five-spring model capable of predicting the complete pre- and post-peak shear behaviour of deep beams. The model stems from a two-parameter kinematic theory (2PKT) for the shear strength and displacement capacity of deep beams under single curvature. Four of the springs of the model represent the shear resistance mechanisms of the beam, while the fifth spring models the flexural behaviour. The model predicts not only the load–displacement response, but also the deformation patterns of the beam and how these patterns change with increasing load. Validation studies are performed by using 28 tests from the literature, showing excellent results. The model is used to interpret the tests and to draw conclusions about the behaviour of deep beams. It is shown that shear strength variations of up to 60 % between nominally identical specimens can be caused by variations in the path of the critical shear cracks. It is also demonstrated that loss of bond of large reinforcing bars increases the shear capacity of deep beams. Finally, the five-spring model is shown to predict the post-peak shear behaviour effectively, which is important for the analysis of structures under extreme loading. [less ▲]

Detailed reference viewed: 78 (10 ULg)