References of "Gabelica, Valérie"
     in
Bookmark and Share    
Full Text
Peer Reviewed
See detailTridentate N-Donor Palladium(II) Complexes as Efficient Coordinating Quadruplex DNA Binders
Largy, Eric; Hamon, Florian; Rosu, Frédéric ULg et al

in Chemistry : A European Journal (2011), 17(47), 13274-13283

Fifteen complexes of palladium, platinum, and copper, featuring five different N-donor tridentate (terpyridine-like) ligands, were prepared with the aim of testing their G-quadruplexDNA binding properties ... [more ▼]

Fifteen complexes of palladium, platinum, and copper, featuring five different N-donor tridentate (terpyridine-like) ligands, were prepared with the aim of testing their G-quadruplexDNA binding properties. The fluorescence resonance energy transfer melting assay indicated a striking positive effect of palladium on G-quadruplex DNA stabilization compared with platinum and copper, as well as an influence of the structure of the organic ligand. Putative binding modes (noncoordinative p stacking and base coordination) of palladium and platinum complexes were investigated by ESI-MS and UV/Vis spectroscopy experiments, which all revealed a greater ability of palladium complexes to coordinate DNA bases. In contrast, platinum compounds tend to predominantly bind to quadruplex DNA in their aqua form by noncoordinative interactions. Remarkably, complexes of [Pd(ttpy)] and [Pd(tMebip)] (ttpy=tolylterpyridine, tMebip=2,2'-(4-p-tolylpyridine-2,6-diyl)bis(1-methyl-1H-benzo[d]imidazole)) coordinate efficiently G-quadruplex structures at room temperature in less than 1 h, and are more efficient than their platinum counterparts for inhibiting the growth of cancer cells. Altogether, these results demonstrate that both the affinity for G-quadruplex DNA and the binding mode of metal complexes can be modulated by modifying either the metal or the organic ligand. [less ▲]

Detailed reference viewed: 33 (1 ULg)
Full Text
Peer Reviewed
See detailEffective temperature of ions in traveling wave ion mobility spectrometry
Morsa, Denis ULg; Gabelica, Valérie ULg; De Pauw, Edwin ULg

in Analytical Chemistry (2011), 83(14), 5775-5782

Traveling wave ion mobility spectrometers (TW IMS) operate at significantly higher fields than drift tube ion mobility spectrometers. Here we measured the fragmentation of the fragile p ... [more ▼]

Traveling wave ion mobility spectrometers (TW IMS) operate at significantly higher fields than drift tube ion mobility spectrometers. Here we measured the fragmentation of the fragile p-methoxybenzylpyridinium ion inside the TW ion mobility cell of the first-generation SYNAPT HDMS spectrometer. The ion’s vibrational internal energy was quantified by a vibrational effective temperature Teff,vib, which is the mean temperature of the ions inside the cell that would result in the same fragmentation yield as observed experimentally. Significant fragmentation of the probe ion inside the TW IMS cell was detected, indicating that field heating of the ions takes place in TW IMS. For typical small molecule IMS conditions, Teff,vib = 555 ± 2 K. The variations of the effective temperature were studied as a function of the IMS parameters, and we found that Teff,vib decreases when the wave height decreases, when the pressure increases, or when the wave speed increases. The energy transfer efficiency of argon is higher than for He, N2 or CO2. Teff,vib being directly related to the ion speed inside the TW IMS, our results also provide new insight on the ion movement in TW IMS. We also discuss the influence of field heating of ions for calibration and structural studies in TW IMS. [less ▲]

Detailed reference viewed: 76 (24 ULg)
Full Text
Peer Reviewed
See detaild(CGGTGGT) forms an octameric parallel G-quadruplex via stacking of unusual G(:C):G(:C):G(:C):G(:C) octads
Borbone, Nicola; Amato, Jussara; Oliviero, Giorgia et al

in Nucleic Acids Research (2011)

Among non-canonical DNA secondary structures, G-quadruplexes are currently widely studied because of their probable involvement in many pivotal biological roles, and for their potential use in ... [more ▼]

Among non-canonical DNA secondary structures, G-quadruplexes are currently widely studied because of their probable involvement in many pivotal biological roles, and for their potential use in nanotechnology. The overall quadruplex scaffold can exhibit several morphologies through intramolecular or intermolecular organization of G-rich oligodeoxyribonucleic acid strands. In particular, several G-rich strands can form higher order assemblies by multimerization between several G-quadruplex units. Here, we report on the identification of a novel dimerization pathway. Our Nuclear magnetic resonance, circular dichroism, UV, gel electrophoresis and mass spectrometry studies on the DNA sequence dCGGTGGT demonstrate that this sequence forms an octamer when annealed in presence of K+ or NH4+ ions, through the 5′-5′ stacking of two tetramolecular G-quadruplex subunits via unusual G(:C):G(:C):G(:C):G(:C) octads. [less ▲]

Detailed reference viewed: 65 (5 ULg)
Full Text
Peer Reviewed
See detailTargeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences
Amato, Jussara; Pagano, Bruno; Borbone, Nicola et al

in Bioconjugate Chemistry (2011), 22

The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of ... [more ▼]

The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K+- or NH4+-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1 P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In Kþ buffer, P1-P4 bind the ckit87up quadruplex structure as “quadruplex-binding agents”. The same holds for P1 in NH4þ solution. On the contrary, in NH4þ solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as “quadruplex openers”. [less ▲]

Detailed reference viewed: 44 (6 ULg)
See detailMass Spectrometry Studies of G-quadruplex Nucleic Acid Self-Assembly
Gabelica, Valérie ULg

Conference (2010, November 12)

see attached file

Detailed reference viewed: 12 (1 ULg)
See detailMass spectrometry of G-quadruplexes
Gabelica, Valérie ULg

Conference (2010, May 31)

Detailed reference viewed: 74 (3 ULg)
Full Text
Peer Reviewed
See detailTetramolecular G-quadruplex formation pathways studied by electrospray mass spectrometry
Rosu, Frédéric ULg; Gabelica, Valérie ULg; Poncelet, Harmonie et al

in Nucleic Acids Research (2010)

Electrospray mass spectrometry was used to investigate the mechanism of tetramolecular G-quadruplex formation by the DNA oligonucleotide dTG5T, in ammonium acetate. The intermediates and products were ... [more ▼]

Electrospray mass spectrometry was used to investigate the mechanism of tetramolecular G-quadruplex formation by the DNA oligonucleotide dTG5T, in ammonium acetate. The intermediates and products were separated according to their mass (number of strands and inner cations) and quantified. The study of the temporal evolution of each species allows us to propose the following formation mechanism. (i) Monomers, dimers and trimers are present at equilibrium already in the absence of ammonium acetate. (ii) The addition of cations promotes the formation of tetramers and pentamers that incorporate ammonium ions and therefore presumably have stacked guanine quartets in their structure. (iii) The pentamers eventually disappear and tetramers become predominant. However, these tetramers do not have their four strands perfectly aligned to give five G-quartets: the structures contain one ammonium ion too few, and ion mobility spectrometry shows that their conformation is more extended. (iv) At 4°C, the rearrangement of the kinetically trapped tetramers with presumably slipped strand(s) into the perfect G-quadruplex structure is extremely slow (not complete after 4 months). We also show that the addition of methanol to the monomer solution significantly accelerates the cation-induced G-quadruplex assembly. [less ▲]

Detailed reference viewed: 124 (19 ULg)
Full Text
Peer Reviewed
See detailNew Advances in the Understanding of the In-Source Decay Fragmentation of Peptides in MALDI-TOF-MS.
Demeure, Kevin ULg; Gabelica, Valérie ULg; De Pauw, Edwin ULg

in Journal of the American Society for Mass Spectrometry (2010), 21(11), 1906-17

In-source decay (ISD) is a rapid fragmentation occurring in the matrix-assisted laser desorption/ionization (MALDI) source before the ion extraction. Despite the increasing interest for peptides de novo ... [more ▼]

In-source decay (ISD) is a rapid fragmentation occurring in the matrix-assisted laser desorption/ionization (MALDI) source before the ion extraction. Despite the increasing interest for peptides de novo sequencing by ISD, the influence of the matrix and of the peptide itself is not yet fully understood. Here we compare matrices with high ISD efficiencies to gain deeper insight in the ISD fragmentation process(es). The major ISD fragments are the c- and z-ions, but other types of fragments are also observed, and their origin is studied here. Two main pathways lead to fragmentation in the source: a radical-induced pathway that leads to c-, z-, w-, and d-ions, and a thermally activated pathway that leads to y-, b-, and a-ions. A detailed analysis of the ISD spectra of selected peptides revealed that (1) the extents of the two in-source pathways are differently favored depending on the matrix used, that (2) the presence of a positive/negative charge on the radical-induced fragments is necessary for their observation in positive/negative mode, respectively, and that (3), for a same peptide, the patterns of the different types of fragments differ according to the matrix used. [less ▲]

Detailed reference viewed: 67 (13 ULg)
See detailElectronic spectroscopy of nucleic acids in the gas phase
Gabelica, Valérie ULg; Rosu, Frédéric ULg; Joly, Laure ULg et al

Conference (2010)

DNA polyanions trapped in a mass spectrometer undergo electron detachment following UV irradiation. Photodetachment is a single-photon process. Its efficiency depends on the nature of the DNA bases, the ... [more ▼]

DNA polyanions trapped in a mass spectrometer undergo electron detachment following UV irradiation. Photodetachment is a single-photon process. Its efficiency depends on the nature of the DNA bases, the ion's charge, and the excitation wavelength. Photodetachment can therefore be used to perform ion spectroscopy experiments, which probe electronic excitation within the initial charge state of the nucleic acids. Ion spectroscopy experiments on trapped nucleic acid cations and anions were performed from 4 to 20 eV using an OPO laser or using synchrotron radiation. Photoelectron spectroscopy experiments were also performed on multiply charged anions to probe direct detachment cross sections and electronic excitations within the final charge. The electronic spectra obtained from photodetachment integral cross sections show several resonances, provided that the photon energy is larger than the electron binding energy. We will also discuss whether the electronic spectra obtained via photodetachment can be used to probe gas phase ion structure. [less ▲]

Detailed reference viewed: 77 (5 ULg)
See detailInternal energy content of ions in a travelling wave ion guide
Morsa, Denis ULg; Gabelica, Valérie ULg; Rosu, Frédéric ULg et al

Conference (2010)

Travelling wave ion guides (TWIGs) separate of ions according to their mobility and, at constant charge, according to their shape. The ion mobility separation itself should not modify the shape of the ... [more ▼]

Travelling wave ion guides (TWIGs) separate of ions according to their mobility and, at constant charge, according to their shape. The ion mobility separation itself should not modify the shape of the systems investigated. It was recently suggested by Shvartsburg et al. that the higher fields used in TWIGs than in traditional drift tubes would cause significant heating of the ions. We present a quantitative analysis of the amount of internal energy imparted to ions as they are separated in TWIGs. Benzylpyridinium ions were chosen as “thermometer” ions. Based on arrival time distributions, the fragment ion population is separated as a function of the place of formation: before, in, or after the TWIG. Fragmentation all along the TWIG was observed. The roles of the travelling wave’s voltage, speed, and of the gas nature and pressure will be discussed in detail as well of the consequences on instruments performances. [less ▲]

Detailed reference viewed: 33 (3 ULg)
Full Text
Peer Reviewed
See detailStructure-based design of selective high-affinity telomeric quadruplex-binding ligands
Lombardo, Caterina M.; Martínez, Iria S.; Haider, Shozeb et al

in Chemical Communications (2010), 46

A library of triazole-based telomeric quadruplex-selective ligands has been developed that mimic an established family of tri-substituted acridine-based ligands, using crystal structure data as a starting ... [more ▼]

A library of triazole-based telomeric quadruplex-selective ligands has been developed that mimic an established family of tri-substituted acridine-based ligands, using crystal structure data as a starting-point for computer-based design. Binding affinities, estimated by electrospray mass spectrometry, are in accord with the design concept [less ▲]

Detailed reference viewed: 36 (2 ULg)
Full Text
Peer Reviewed
See detailCation Involvement in Telomestatin Binding to G-Quadruplex DNA
Rosu, Frédéric ULg; Gabelica, Valérie ULg; Smargiasso, Nicolas ULg et al

in Journal of Nucleic Acids (2010)

The binding mode of telomestatin to G-quadruplex DNA has been investigated using electrospray mass spectrometry, by detecting the intact complexes formed in ammonium acetate. The mass measurements show ... [more ▼]

The binding mode of telomestatin to G-quadruplex DNA has been investigated using electrospray mass spectrometry, by detecting the intact complexes formed in ammonium acetate. The mass measurements show the incorporation of one extra ammonium ion in the telomestatin complexes. Experiments on telomestatin alone also show that the telomestatin alone is able to coordinate cations in a similar way as a crown ether. Finally, density functional theory calculations suggest that in the G-quadruplex-telomestatin complex, potassium or ammonium cations are located between the telomestatin and a G-quartet. This study underlines that monovalent cation coordination capabilities should be integrated in the rational design of G-quadruplex binding ligands. [less ▲]

Detailed reference viewed: 129 (21 ULg)
Full Text
Peer Reviewed
See detailElectrospray Mass Spectrometry of Telomeric RNA (TERRA) Reveals the Formation of Stable Multimeric G-Quadruplex Structures
Collie, Gavin W.; Parkinson, Gary N.; Neidle, Stephen et al

in Journal of the American Chemical Society (2010), 132(27), 93289334

We report on the self-assembled structures formed by 12-mer, 22-mer, and 45-mer telomeric RNA (telRNA/TERRA) sequences compared to their DNA analogues, as studied by electrospray mass spectrometry ... [more ▼]

We report on the self-assembled structures formed by 12-mer, 22-mer, and 45-mer telomeric RNA (telRNA/TERRA) sequences compared to their DNA analogues, as studied by electrospray mass spectrometry, circular dichroism, and thermal denaturation. The major difference between telomeric RNA and DNA sequences is the ability of telomeric RNA to form higher-order dimeric assemblies, initiated by cation-mediated stacking of two parallel G-quadruplex subunits. The 5′-5′ stacking had been observed recently by NMR for the r(GGGUUAGGGU) 10-mer (Martadinata, H.; Phan, A. T. J. Am. Chem. Soc. 2009, 131, 2570); the present work shows that stacking also occurs for the 22-mer containing four G-tracts and for the 45-mer containing eight G-tracts, suggesting a general structural feature of telomeric RNA. The importance of kinetic effects in multimer formation, unfolding, and structural rearrangements is also highlighted. [less ▲]

Detailed reference viewed: 68 (5 ULg)
See detailElectrospray mass spectrometry of noncovalent complexes between small molecule ligands and nucleic acids
Gabelica, Valérie ULg

in Joseph H., Banoub; Patrick A., Limbach (Eds.) Mass spectrometry of nucleosides and nucleic acids (2010)

CONTENTS 8.1 Introduction 8.1.1 ESI-MS of Noncovalent Complexes 8.1.2 Nucleic Acid Targeting by Small Molecules 8.2 Electrospray Mass Spectrometry of Nucleic Acid Noncovalent Complexes 8.2.1 ... [more ▼]

CONTENTS 8.1 Introduction 8.1.1 ESI-MS of Noncovalent Complexes 8.1.2 Nucleic Acid Targeting by Small Molecules 8.2 Electrospray Mass Spectrometry of Nucleic Acid Noncovalent Complexes 8.2.1 Stoichiometries: Number of Strands and Detection of Nucleic Acid Higher-Order Structures 8.2.2 Stoichiometries: Number of Bound Ligands 8.2.3 Role of Cations in Nucleic Acid Structure and Ligand Binding 8.2.4 Determination of Equilibrium Binding Constants 8.2.5 Are the Relative Intensities Proportional to the Abundances in Solution? 8.3 Characterizing Noncovalent Ligand Binding by MS/MS of the Complexes 8.3.1 Overview of Dissociation Pathways 8.3.2 How Observed Pathways Depend on Instrumental Parameters 8.3.3 How Observed Pathways Depend on Ligand Binding 8.3.4 Probing the Energetics of Ligand-DNA Interactions 8.3.5 Determining the Ligand Binding Mode 8.3.6 Determining the Ligand Binding Site by MS/MS 8.4 Conclusion and Outlook References [less ▲]

Detailed reference viewed: 127 (10 ULg)
See detailDetermination of equilibrium association constants of ligand-DNA complexes by electrospray mass spectrometry
Gabelica, Valérie ULg

in Keith R., Fox (Ed.) Drug-DNA Interaction Protocols (2010)

Electrospray mass spectrometry can be used to detect ligand-DNA noncovalent complexes formed in solution. This chapter describes how to determine equilibrium association constants of the complexes ... [more ▼]

Electrospray mass spectrometry can be used to detect ligand-DNA noncovalent complexes formed in solution. This chapter describes how to determine equilibrium association constants of the complexes. Particular attention is devoted to describing how to tune an electrospray mass spectrometer using a 12-mer oligodeoxynucleotides duplex in order to perform these experiments. This protocol can then be applied to any nucleic acid structure that can be ionized with electrospray mass spectrometry. [less ▲]

Detailed reference viewed: 95 (13 ULg)
Full Text
Peer Reviewed
See detailZwitterionic i-motif structures are preserved in DNA negatively charged ions produced by electrospray mass spectrometry
Rosu, Frédéric ULg; Gabelica, Valérie ULg; Joly, Laure ULg et al

in Physical Chemistry Chemical Physics [=PCCP] (2010), 12

DNA cytosine-rich strands can fold into an intercalated motif (i-motif) structure. The i-motif is formed by mutually intercalated duplexes containing proton-mediated C-H(+)-C (cytosine-proton-cytosine ... [more ▼]

DNA cytosine-rich strands can fold into an intercalated motif (i-motif) structure. The i-motif is formed by mutually intercalated duplexes containing proton-mediated C-H(+)-C (cytosine-proton-cytosine) base pairs. Negatively charged ions of DNA i-motifs produced by electrospray mass spectrometry are therefore zwitterionic if the base pairing motif is preserved in the gas phase. Here we used IRMPD spectroscopy and ion mobility spectrometry to assess whether i-motif structures were preserved in the gas phase. We first investigated the IRMPD spectral signature of the tetramer [dC(6)](4), which can only be formed via C-H(+)-C base pairing, compared to the single strand dC(6). The IR signature of i-motif formation is an apparent broadening of the band at 1650 cm(-1). DFT calculations show this apparent broadening is actually due to blue-shifts of the NH(2) scissoring modes and red shifts of C[double bond, length as m-dash]O stretching modes. We then investigated the gas-phase conformations of the telomeric sequence d(CCCAAT)(3)CCC, that can form an intramolecular i-motif, by performing IRMPD spectroscopy and ion mobility spectrometry as a function of the charge state. We show that the negative ions of the lowest charge states correspond to a preserved i-motif structure. This is the first demonstration of the native extraction of solution-phase zwitterionic nucleic acids using negative electrospray ionization. [less ▲]

Detailed reference viewed: 64 (9 ULg)
Full Text
Peer Reviewed
See detailSelectivity in small molecule binding to human telomeric RNA and DNA quadruplexes
Collie, Gavin; Reszka, Anthony P.; Haider, Shozeb M. et al

in Chemical Communications (2009), (48), 7482-7484

Quadruplex RNAs are less well understood than their DNA counterparts, yet of potentially high biological relevance. The interactions of several quadruplex-binding ligands with telomeric RNA quadruplexes ... [more ▼]

Quadruplex RNAs are less well understood than their DNA counterparts, yet of potentially high biological relevance. The interactions of several quadruplex-binding ligands with telomeric RNA quadruplexes are reported and compared with their binding to the analogous DNA quadruplexes. [less ▲]

Detailed reference viewed: 61 (3 ULg)
See detailIR and UV spectroscopic signatures of DNA structures in the gas phase
Gabelica, Valérie ULg

Conference (2009, July 08)

Detailed reference viewed: 13 (0 ULg)