References of "Thiry, Etienne"
     in
Bookmark and Share    
Full Text
Peer Reviewed
See detailInfectivity of a recombinant murine norovirus (RecMNV) in Balb/cByJ mice
Mathijs, Elisabeth; de Oliveira-Filho, Edmilson; Dal Pozzo, Fabiana ULg et al

in Veterinary Microbiology (in press)

Detailed reference viewed: 23 (7 ULg)
Full Text
Peer Reviewed
See detailUlcerative pododermatitis and disseminated erosive lesions associated with cowpox virus infection in a domestic cat
Ludwig, Louisa ULg; Bohn, Jéromine ULg; Remy, Isabelle ULg et al

in Veterinary Record Case Reports (2016)

The authors report on a case of feline cowpox virus infection associated with severe ulcerative dermatitis of a paw and disseminated erosive lesions. While the anamnesis of the cat being a known rodent ... [more ▼]

The authors report on a case of feline cowpox virus infection associated with severe ulcerative dermatitis of a paw and disseminated erosive lesions. While the anamnesis of the cat being a known rodent-hunter, a typical seasonality of infection and the progression of clinical signs from a primary anterior lesion (forelimb) indicated a possible cowpox virus infection, the differential diagnosis was complicated by the resemblance of clinical signs to those induced by feline herpesvirus-dermatitis or feline calicivirus infection. These differential diagnoses were excluded by means of immunostaining and PCR, respectively. Detection of eosinophilic intracytoplasmic inclusion bodies in cells from biopsy material and positive PCR and sequencing results confirmed the diagnosis of cowpox virus infection. Genetic characterisation of the isolate, based on the highly diverse haemagglutinin gene, showed that the strain (Liege 2015; GenBank accession number: KU726584) clustered with other European isolates, mostly from exotic zoo animals. [less ▲]

Detailed reference viewed: 19 (2 ULg)
Full Text
Peer Reviewed
See detailSusceptibility of pigs to zoonotic hepatitis E virus genotype 3 isolated from a wild boar
Thiry, Damien ULg; Rose, Nicolas; Mauroy, Axel ULg et al

in Transboundary and Emerging Diseases (2016)

Detailed reference viewed: 9 (2 ULg)
Full Text
See detailRegain of fitness through in vitro replication for a recombinant murine norovirus
de Oliveira-Filho, Edmilson; Ludwig, Louisa ULg; Toffoli, Barbara et al

Poster (2016, March 18)

INTRODUCTION Molecular mechanisms driving norovirus evolution are the accumulation of point mutations and recombination. Recombination can create considerable changes in viruses, allowing for complete ... [more ▼]

INTRODUCTION Molecular mechanisms driving norovirus evolution are the accumulation of point mutations and recombination. Recombination can create considerable changes in viruses, allowing for complete antigenic shifts, host jumps and fitness and pathogenesis modifications. Mathijs et al. recently isolated a viable recombinant murine norovirus (RecMNV) in vitro after coinfection of two parental MNV strains (MNV1-CW1 and -WU20) in a mouse leukaemic monocyte-macrophage cell line (RAW 264.7). The ensuing RecMNV possessed reduced in vitro fitness compared to its parental strains but has also been shown to have retained in vivo infectivity (Mathijs et al, submitted). The aim of this study was to follow the replicative and genetic adaptations of RecMNV over serial in vitro passages in order to characterise its capability of replicative fitness adaptation. MATERIALS AND METHODS: RecMNV was serially replicated in vitro in monolayers of RAW 264.7 cells over ten passages. Following a first initial infection at an MOI of 0.05, cell layers were consecutively infected with 100 μl neat supernatant of the preceding passage. Two independent lysis plaque assays were performed in triplicate with RecMNV progenies resulting from the first (early) and tenth (late) passage (RecE and RecL). Viral plaque sizes of RecE and RecL were measured with image processing program Image J and statistical analyses of plaque size diameters were subsequently performed. To obtain the complete genome sequences of RecE and RecL, a sequencing strategy was developed in which the MNV genome was divided into seven regions and amplification was performed using overlapping primers. Nucleotide sequences of RecE and RecL were analysed via BioEdit Sequence Editor. Growth curves of RecE and RecL progenies were established for high (10) or low MOI (0.01). RESULTS After ten in vitro passages, viral lysis plaque size diameters had increased significantly. Molecular analysis of RecMNV and both parental strains showed nine nucleotide mutations in the RecMNV genome, comprising three non-silent mutations. In addition, a mutation at position 7245 (A187G) introduced a stop codon, resulting in a 20 AA shorter VP2 in RecMNV (for both RecE and RecL). A comparison of RecE and RecL revealed four non-silent mutations in the NS1-2 and NS7 region of ORF1, two of which were present in the latter region (G1384D and S1393N). DISCUSSION This is the first study in which the fitness of a recombinant NoV strain was evaluated in vitro. Our data provides evidence of viral adaptation to a new environment (here a cell culture system) after a recombination event. Evidence of gain-of-function of RecMNV was demonstrated by differences in growth curves and viral lysis plaque size. In addition, non-silent mutations associated to the gain-of-function/in vitro adaptation were detected. It is noteworthy, that the mutation causing a shorter VP2 in RecE and RecL did not compromise its ability to infect and replicate either in vitro or in vivo (Mathijs et al, submitted). As a perspective we should like to characterise the precise mutation(s) responsible for the fitness regain via infectious clone assay. [less ▲]

Detailed reference viewed: 25 (4 ULg)
Peer Reviewed
See detailInfection expérimentale de porcs, par voie intraveineuse ou orale, avec une souche du virus de l’hépatite E (HEV) de sanglier, une souche de HEV porcine et une souche de HEV de sanglier préalablement passée en modèle porcin
Thiry, Damien ULg; Rose, Nicolas; Mauroy, Axel ULg et al

Poster (2016, March)

La transmission zoonotique du HEV est particulièrement mise en cause dans les pays développés dans lesquels la transmission via les eaux usées est beaucoup moins fréquente que dans les pays en voie de ... [more ▼]

La transmission zoonotique du HEV est particulièrement mise en cause dans les pays développés dans lesquels la transmission via les eaux usées est beaucoup moins fréquente que dans les pays en voie de développement. Des séroprévalences élevées sont observées chez certaines espèces animales dans plusieurs pays européens. Cette étude a porté sur la transmission potentielle au porc d\'une souche de HEV provenant du sanglier (WbHEV) par inoculation intraveineuse ou par voie orale et sur l’étude des conséquences de l’infection du porc par une souche de WbHEV, une souche de WbHEV précédemment passée chez le porc et une souche porcine de HEV après inoculation orale. Tout d\'abord, une infection par voie intraveineuse a été réalisée au cours de laquelle cinq porcelets ont été répartis en deux groupes. Le premier était constitué de trois porcs inoculés avec du WbHEV et le second, de deux porcs inoculés avec un foie de porc négatif envers le HEV. Tous les porcs ont été euthanasiés et autopsiés 8, 9 et 10 jours après l’inoculation. Cette première expérience avait pour objectif d’obtenir suffisamment de virus en vue de réaliser les inoculations par voie orale. Elle a également permis d’étudier l’infectivité d’une souche de HEV-3 provenant du sanglier chez le porc. Ensuite, une infection par voie orale a été réalisée sur 12 porcelets répartis en 4 groupes inoculés respectivement avec une souche de WbHEV, une souche de WbHEV précédemment passée chez le porc, une souche porcine de HEV et un foie de porc HEV négatif. Cette expérience a duré 56 jours. Les échantillons récoltés ont ensuite été analysés par qRT-PCR, ELISA, Western blot et histopathologie. Le nombre de porcs virémiques était plus faible après infection orale qu’après inoculation intraveineuse. Ce résultat contraste avec la présence du HEV dans les matières fécales des porcs au cours des deux expériences. Les résultats montrent également une propagation du virus dans différents organes après inoculation intraveineuse, mais pas après inoculation par voie orale. Cette étude fournit la première preuve expérimentale de la propagation précoce du virus dans l\'organisme après infection intraveineuse avec une souche de HEV provenant du sanglier et montre qu’une telle souche pourrait être naturellement transmise entre les sangliers et les porcs, mais aussi entre porcs et donc survivre dans la population porcine. [less ▲]

Detailed reference viewed: 27 (3 ULg)
Full Text
Peer Reviewed
See detailDiversity and ecology survey of mosquitoes potential vectors in Belgian equestrian farms: A threat prevention of mosquito-borne equine arboviruses
Boukraa, Slimane ULg; de la Grandière, Maria Ana ULg; Bawin, Thomas ULg et al

in Preventive Veterinary Medicine (2016), 124

Emergence of West Nile Virus was recently recorded in several European countries, which can lead to severe health problems in horse populations. Europe is also at risk of introduction of mosquito-borne ... [more ▼]

Emergence of West Nile Virus was recently recorded in several European countries, which can lead to severe health problems in horse populations. Europe is also at risk of introduction of mosquito-borne equine alphavirus from Americas. Prevention of these arboviruses requires a clear understanding of transmission cycles, especially their vectors. To characterize mosquito fauna, their ecology and identify potential vectors of equine arboviruses in Belgium, entomological surveys of six equestrian farms located in the Wolloon Region were conducted during 2011–2012. The harvest of mosquitoes was based on larval sampling (272 samples from 111 breeding sites) and monthly adults trapping (CO2-baited traps, Mosquito Magnet Liberty Plus). Among 51,493 larvae and 319 adult mosquitoes collected, morphological identification showed the presence of 11 species: Anopheles claviger (Meigen), An. maculipennis s.l. (Meigen), An. plumbeus (Stephens), Culex hortensis (Ficalbi), Cx. territans (Walker), Cx. pipiens s.l. L., Cx. torrentium (Martini), Coquillettidia richiardii (Ficalbi), Culiseta annulata (Schrank), Aedes cantans (Meigen), Ae. geniculatus (Olivier). Molecular identification of Cx. pipiens species complex allowed the detection of three molecular forms, Pipiens (92.3%), Molestus (4.6%) and Hybrid (3.1%). Larvae of Cx. pipiens sl and Cx. torrentium were omnipresent and the most abundant species. Water troughs, ponds and slurry (liquid manure) were the most favorable breeding sites of mosquito larvae. Based upon behavior and ecology of the identified mosquito species, Studied Belgian equestrian farms seem to provide a suitable environment and breeding sites for the proliferation of potential vectors of arboviruses and those being a real nuisance problem for horses and neighboring inhabitants. [less ▲]

Detailed reference viewed: 49 (11 ULg)
Full Text
Peer Reviewed
See detailMolecular detection of bovine noroviruses in Argentinean dairy calves: Circulation of a tentative new genotype
Ferragut, Fatima; Vega, Celina; Mauroy, Axel ULg et al

in Infection, Genetics and Evolution : Journal of Molecular Epidemiology and Evolutionary Genetics of Infectious Diseases (2016), 40

Detailed reference viewed: 25 (8 ULg)
Full Text
Peer Reviewed
See detailHuman norovirus infection in Latin America
da Silva Polo, Tatiane; Peiro, Juliana; Claudio Nogueira Mendes, Luiz et al

in Journal of Clinical Virology (2016), 78

Detailed reference viewed: 10 (3 ULg)
Full Text
Peer Reviewed
See detailRisk factors and effect of selective removal on retroviral infections prevalence in Belgian stray cats.
Garigliany, Mutien-Marie ULg; Jolly, Sandra ULg; Dive, M. et al

in The Veterinary record (2016), 178(2), 45

The aim of this study was to evaluate the effect of several risk/protective factors and predictors on the prevalence of feline immunodeficiency virus (FIV) and feline leukaemia virus (FeLV) infections in ... [more ▼]

The aim of this study was to evaluate the effect of several risk/protective factors and predictors on the prevalence of feline immunodeficiency virus (FIV) and feline leukaemia virus (FeLV) infections in 302 stray cats captured during a trap-neuter-release programme in a mixed urban-rural area from Belgium, from 2010 to 2012. The impact of selective removal of FIV-positive cats on the apparent prevalence in the remaining population over this three-year period was also assessed. The seroprevalences over three years were 18.8 per cent for FIV and 0.7 per cent for FeLV. For FIV, the seroprevalence decreased significantly from the first year of the programme (2010; 30.5 per cent) to the last (2012; 13.1 per cent). Sex (male) and age (adult and old cats) were risk factors, while the year of sampling (years 2011 and 2012) was a protective factor. Age, sex and location were the most relevant predictors of FIV status. The data presented in this study revealed a very high FIV seroprevalence in Belgian stray cats, while FeLV was almost absent. The selective removal of positive cats had a drastic effect on the FIV seroprevalence in the remaining cat population. [less ▲]

Detailed reference viewed: 15 (5 ULg)
Full Text
Peer Reviewed
See detailBovine noroviruses: A missing component of calf diarrhoea diagnosis
Di Felice, Elisabetta; Mauroy, Axel ULg; Dal Pozzo, Fabiana ULg et al

in Veterinary Journal (2016), 207

Detailed reference viewed: 95 (17 ULg)
Full Text
Peer Reviewed
See detailComparative virucidal efficacy of seven disinfectants against murine norovirus and feline calicivirus, surrogates of human norovirus
Zonta, William ULg; Mauroy, Axel ULg; Farnir, Frédéric ULg et al

in Food and Environmental Virology (2016)

Human noroviruses (HuNoV) are the leading cause of acute nonbacterial gastroenteritis in humans and can be transmitted either by person-to-person contact or by consumption of contaminated food. Knowledge ... [more ▼]

Human noroviruses (HuNoV) are the leading cause of acute nonbacterial gastroenteritis in humans and can be transmitted either by person-to-person contact or by consumption of contaminated food. Knowledge of an efficient disinfection for both hands and food contact surfaces is helpful for the food sector and provides precious information for public health. The aim of this study was to evaluate the effect of seven disinfectants belonging to different groups of biocides (alcohol, halogen, oxidizing agents, quaternary ammonium compounds, aldehyde and biguanide) on infectious viral titre and on genomic copy number. Due to the absence of a cell culture system for HuNoV, two HuNoV surrogates such as murine norovirus (MNV) and feline calicivirus (FCV), were used and the tests were performed in suspension, on gloves and on stainless steel discs. When, as criteria of efficacy, a log reduction > 3 of the infectious viral titre on both surrogates and in the three tests is used, the most efficacious disinfectants in this study appear to be biocidal products B, C and D, representing the halogens, the oxidizing agents group and a mix of QAC, alcohol and aldehyde, respectively. In addition, these three disinfectants also elicited a significant effect on genomic copy number for both surrogate viruses and in all three tests. The results of this study demonstrate that a halogen compound, oxidizing agents and a mix of QAC, alcohol and aldehyde are advisable for HuNoV disinfection of either potentially contaminated surfaces or materials in contact with foodstuffs. [less ▲]

Detailed reference viewed: 38 (8 ULg)
Full Text
Peer Reviewed
See detailBelgian Wildlife as Potential Zoonotic Reservoir of Hepatitis E virus
Thiry, Damien ULg; Mauroy, Axel ULg; Saegerman, Claude ULg et al

in Transboundary and Emerging Diseases (2015)

Detailed reference viewed: 52 (18 ULg)
See detailComparative study of experimental infection of piglets with a field strain of wild boar HEV, a wild boar HEV strain previously passed in porcine model and a swine HEV strain
Thiry, Damien ULg; Rose, Nicolas; Mauroy, Axel ULg et al

Poster (2015, October)

Domestic pig and wild boar are reservoirs for hepatitis E virus (HEV). This study aims to investigate the infection of pigs with HEV strains from wild boar and to compare the behaviour of a wild boar ... [more ▼]

Domestic pig and wild boar are reservoirs for hepatitis E virus (HEV). This study aims to investigate the infection of pigs with HEV strains from wild boar and to compare the behaviour of a wild boar strain to a pig strain in vivo. The objective is to contribute to the elucidation of the crossing barrier between wild boar and pig with this zoonotic virus. A total of 12 specific pathogen free piglets were divided into four groups and orally inoculated respectively with a wild boar HEV strain previously passed in pigs (WbHEV), a wild boar HEV (WbHEVs), a swine HEV (SwHEV) and a negative control group. One pig from each group was euthanized 15 days after inoculation. The remaining pigs were sacrificed on day 56. A serological monitoring by ELISA was realized throughout the experiment, the viral load was determined in different organs by qRT-PCR. Viral RNA was found in several organs and tissues of the inoculated pigs. Most of the pigs were HEV positive at the 15th day and no clinical signs were observed during infection. Liver enzymes (ALT and AST) remained within the reference values. This study provides experimental evidence of the swine infection with a strain of HEV isolated from wild boar and previously passed in pig. Furthermore, these data indicate the possibility of the transfer of the virus from wild boar to pig, for example, in the context of outdoor pig breeding. [less ▲]

Detailed reference viewed: 26 (2 ULg)
Peer Reviewed
See detailFitness evaluation and molecular characterization of a recombinant murine norovirus (MuNoV) during serial passages in cell culture
Ferreira de Oliveira Filho, Edmilson; Di Felice, Elisabetta; Toffoli, Barbara et al

Conference (2015, September 01)

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a ... [more ▼]

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a recombinant Wu20/CW1 strain was obtained after in vitro coinfection of RAW264.7 cells with parental MuNoV strains CW1 and Wu20 (Mathijs et al 2010). The recombinant strain showed reduced plaque size compared to the parental strains and it was suggested that this was due to modified virulence properties in vitro. The aim of this study was to observe and molecularly characterize the natural genetic evolution of the recombinant MuNoV strain across in vitro replications. Methods: MNV strains used in this study were CW1, WU20 (Thackray et al., 2007, kindly provided by prof. H. Virgin) and Rec MNV (Mathijs et al., 2010). RAW 264.7 cells (ATCC TIB-71) grown in Dulbecco’s modified Eagle’s medium (Invitrogen) complemented (DMEMc) with 10 % heat inactivated FCS (BioWhittaker), 2 % penicillin (5000 U /ml) and streptomycin (5000 mg/ml) (PS; Invitrogen) and 1 % HEPES buffer (1 M; Invitrogen). The recombinant strain was serially replicated in vitro in RAW264.7 cells (up to 14 passages). RAW 264.7 (Mouse leukaemic monocyte macrophage) cells were infected with MNV for 72 hours and afterwards lysed by freeze and thaw and viruses purified by ultracentrifugation of both cells and supernatant. Viral plaque sizes of early and late progenies (30 for each virus) were compared with the Image J software. The experiment was repeated two times. RNA was extracted from 140 ml purified suspension 1:5 diluted using the QIAamp Viral RNA Mini KitTM (Qiagen) according to the manufacturer’s instructions. cDNA was generated using a poly-A primer tagged GCCAACGACCGGGAGGCCAGC(T)20 previously described (Müller et al 2007) using superscript ii reverse transcriptase kit (Invitrogen®) treated with RNase H or with other antisense primers using iScript select kit (Bio-Rad®). For the genetic characterization two different studies were conducted. The first study aimed to develop a sequencing strategy in order to obtain the complete genome of the recombinant MNV. Then, in the second study, sequences obtained from different viral passages into RAW cells (e.g. P5 and P14) were compared in order to study the viral adaptation. Primers were designed using the Primer Express® software and netprimer® (Premier biosoft). PCR was performed using taq polymerase with thermopol buffer (new England biolabs) as per manufacturer’s instructions. Afterwards, fragments were excised from agarose gel and DNA purified using the QIAquick Gel Extraction KitTM (Qiagen) and cloning using the PGEM T easy cloning kit (Promega) plasmid DNA was transferred to sequencing by GATC Biotech (Koblenz, Germany). Results: The size of the lysis plaque surface of P2 and P14 showed a considerable divergence. The average plaque size increased from the earlier to the later progenies (from 0.1 mm2 to around 0.5 mm2). A significant difference was demonstrated between them with the Mann and Whitney non parametric statistical test. The genetic characterization of the recombinant strain obtained in vitro was previously based on partial genomic sequences, which provided limited information. Accordingly to our initial molecular analysis of 1.5 kb partial genomic sequence comprising the part of the RdRp and the part of the VP1 did not show any genetic modifications between passage 4 (accession number HM044221) and passage 14 recMNV. Therefore, a strategy for sequencing the complete genome of the different MNV strains was established. The genome of the recombinant MNV was divided into seven regions and the amplification was performed using either new designed or previous published primers. Molecular analysis using the nearly complete genome of the recombinant MNV passage 14 and the two parental strains (CW1 and WU20) showed nine modifications in the genome, comprising three aminoacid changes. Accordingly, two modification were in the RdRp region aa position 1384 Glycine (G) instead of Aspartic acid (D) and aa position 1393 Serine (S) instead of Asparagine (N) and one modification was in the capsid region one modification on aa position 296 Glutamic Acid (E) instead of Lysine. Conclusion: Even preliminary, our data provide evidence of virus adaptation to a new environment (here a cell culture system) after a recombination event. In order to specify whether these hints of genetic mutations could explain fitness modifications during in vitro evolution we need to compare the sequences of passage 14 and the previous viral cellular passages. In addition, two other parameters of in vitro virulence modification will be investigated: (i) virus production and (ii) growth kinetics. The data should provide interesting information about genetic evolution in the genus Norovirus, especially regarding recombination events and explain how a recombinant strain, first disadvantaged compared to its parental strains, could regain fitness by genetic evolution. [less ▲]

Detailed reference viewed: 37 (4 ULg)
Full Text
See detailRare recombination events and occurrence of superinfection exclusion during synchronous and asynchronous infection with homologous murine norovirus strains
Elisabetta, Di Felice; Ludwig, Louisa ULg; Toffoli, Barbara et al

Poster (2015, September 01)

Objective: Human noroviruses (HuNoVs) are recognised as one of the major global causes of non-bacterial gastroenteritis with significant morbidity and mortality in developing countries and a high economic ... [more ▼]

Objective: Human noroviruses (HuNoVs) are recognised as one of the major global causes of non-bacterial gastroenteritis with significant morbidity and mortality in developing countries and a high economic impact in developed countries. Spread primarily via the faecal-oral route, HuNoV infection is typically an acute self-limiting gastrointestinal illness. However, chronic HuNoV infection of immunocompromised persons has been identified as a persistent cause of disease and viral populations in such patients have been postulated as possible reservoirs for novel NoV variants. The Norovirus genus belongs to the Caliciviridae family of small, non-enveloped, positive sense, single-stranded RNA viruses. This genus is subdivided into at least six genogroups, which infect humans and various animal species. Until the recent report of low-level infection of cultured human B cells, no viable cell culture system existed for the study of HuNoVs. The robustness of this new cell culture system still poses a major hurdle, so that the murine norovirus (MuNoV), replicating efficiently in murine dendritic or macrophage cells, remains the model of choice for in vitro study of noroviruses. The molecular mechanisms driving viral evolution and specifically that of NoVs, are accumulation of point mutations and recombination, which enables the emergence of new combinations of genetic materials to generate potentially dramatic genomic changes in a recombinant NoV, which clusters within two distinct groups of NoV strains when two different genomic regions are phylogenetically analysed. The mechanism for NoV recombination is proposed to follow the copy-choice mechanism, involving a template shift during simultaneous replication of two strains infecting the same cell. Numerous NoV recombination events have been highlighted by in silico methods and the phenomenon has recently been shown in vitro with two homologous MuNoV strains. The object of this study was to qualitatively and quantitatively assess virus progenies generated by the use of different parameters of co- and superinfection of RAW264.7 cells with two homologous MuNoV strains (CW1 and Wu20) and thus help to specify important parameters for the occurrence of recombination events. As prerequisite for recombination events, co-and superinfection are of special interest in viral diseases, such as NoV, for which a persistent stage can be developed. Methods: Viruses and Cells Murine NoVs isolates CW1 and Wu20 were plaque purified and propagated in RAW 264.7 cells (ATCC TIB-71).Virus stocks were produced by infection of RAW 264.7 cells at an MOI of 0.05 and clarified by centrifugation. Passages 8 and 7 for CW1 and Wu20, respectively, were used for the experiments. Co-infection and superinfection experiments Monolayers of RAW 264.7 cells were infected with Wu20 at a MOI of 1 on ice. After 1 h, the Wu20 inoculums were removed and stored. The cells were washed twice with PBS and infected with CW1 at various MOI (0.1 ; 1 ; 10) and at various delays of co- or superinfection (0 min, 30 min, 1 h, 2 h, 4 h, 8 h, 12 h and 24 h). For co-infections, CW1 and Wu20 were simultaneously inoculated on the cells for 1 h on ice. Twenty-four hours after CW1 co- or superinfections, cells and supernatants were collected. Molecular analysis RNA was extracted both from supernatants from the experiment and from propagations of individual plaques, reverse transcribed into cDNA and analysed via two parallel real time PCR reactions allowing discrimination between CW1 and Wu20 at both genomic extremities (regions 1 and 5, located at the ORF1 and ORF3 terminal respectively), as previously described by Mathijs et al., 2010. For analysis of the supernatants, quantifications were also performed via real time PCR. Accordingly, amplicons corresponding to region 1 were amplified for both CW1 and Wu20, then cloned and in vitro transcribed to provide a standard curve for RNA copies. Following this, values for genomic copies were deduced and results were normalised with GAPDH gene transcripts. Isolation and screening of progeny viruses A plaque assay for virus isolation from the co- or superinfection experiments was set up by modifying the protocol described by Hyde et al. (2009). Thus, after 24 h of incubation, 36 plaques were randomly picked for each condition and propagated by inoculation onto RAW 264.7 cells. After this amplification step, monitoring of recombination events was performed by PCR and Real-Time PCR on extracted, reverse transcribed viral RNA, using two sets of primers to amplify regions 1 and 5. The use of two pairs of TaqMan probes allowed discrimination of the strains WU20 and CW1 in two different regions and identification of recombinant strains. Results: Molecular analysis The Real-Time PCR performed on supernatants collected at 24 h post infection showed a greater number of copies of MuNoV Wu20 cDNA in almost all conditions, except t 0 h, 0.5 h, 1 h, 2 h at the MOI 10, where an increase in the number of copies of the CW1 strain was noted. In particular, the latter showed a peak at 1 h at the MOI 10 (89%) followed by a rapid reduction in later times (t 8 h: 20%). Interestingly, for both viruses expected ratios were never attained during the study with the notable exception of the MOI ratio 0.1/1 and the condition t1 MOI 10/1. Isolation and screening of progeny viruses Molecular analysis conducted on plaques selected in the condition of coinfection at MOI 1 and 10 highlighted a predominance of the strain MuNoV CW1 (90%) from t 0h to t 2h, followed by a sharp reduction from t 4h leading to complete absence at t 24h. The Wu20 strain showed a progressive increase from 4h (10%) to 24h (100%). Overall, the occurrence of recombination events was very rare. Only three putative recombination events were detected at t1 h MOI 1/1 and t 4 h MOI 1/1. Conclusion: The profiles of viral ratios over time are highly interesting. Particularly the infection with CW1 at the MOI 10, with a relative percentage of genomic quantifications of about 50% at the two first time points is intriguing. While the percentage is changed completely at t1 MOI 1 to give the expected ratio of 90/10, it then gradually decreases over the next time points to less than 10% at 24 h post infection. The presence of numerous recombinant viruses as a possible explanation for the t1 MOI 1 peak seems unlikely, as very few putative recombinants were detected during the screening process. The single-step growth kinetics established by Mathijs et al in 2010, showing great similarities for both strains, indicate that the replicative cycle dynamics of the viruses are probably also not responsible. The decrease, especially marked after 8 h, is suggestive of a superinfection exclusion mechanism, where productive infection with Wu20 induces a resistance of the cells to infection with the homologous CW1. Alternatively, in view of the above-mentioned growth curve at high MOI, the decrease might also be due to the end of the first replication cycle having been reached, with no more viable cells left for infection. Considering the 50% viral ratio estimated by genomic copies for the early time-points, the identification of CW1 as the predominant strain (90%) after plaque purification for the same time appears to be somewhat of a discrepancy and merits further investigation Although circulating recombinant NoV strains seem to be common, in vitro recombination is a rare event, at least in the protocol described above, and does not seem to be easily influenced by parameter changes such as time of infection and MOI. Parameters where putative recombinations were identified include t1 MOI 1 and t4 MOI 1. The possible recombinants are yet to be confirmed by sequencing reactions. Further study is necessary to understand mechanisms favouring the predominance of replication of recombinant virus strain in vivo and the challenges of such a replication in vitro. The occurrence of recombination was theoretically limited to one cycle of replication by the protocol (MOI 1 of Wu20). More than one replication cycle might be necessary to enhance the process of recombination by increasing the number of replicating events that could favour recombination. Thus, initial infection at a lower MOI might be an interesting future consideration. Other mechanisms than a time-dependent coinfection might also be worth exploring. Acknowledgements: We thank Professor Herbert Virgin and Dr Larissa Thackray (Washington University, St Louis, MO, USA) for providing the MNV isolates and RAW 264.7 cells. [less ▲]

Detailed reference viewed: 105 (11 ULg)
Full Text
Peer Reviewed
See detailBorna disease virus infection in cats : ABCD guidelines on prevention and mangement
Lutz, H.; Addie, D.D.; Boucraut-Baralon, C. et al

in Journal of Feline Medicine and Surgery (2015), 17

Detailed reference viewed: 7 (1 ULg)
Full Text
Peer Reviewed
See detailWest Nile virus infection in cats : ABCD guidelines on prevention and management
Egberink, H.; Addie, D.D.; Boucraut-Baralon et al

in Journal of Feline Medicine and Surgery (2015), 17

Detailed reference viewed: 18 (1 ULg)
Full Text
Peer Reviewed
See detailFeline injection-site sarcoma : ABCD guidelines on prevention and management
Hartmann, K.; Day, M.J.; Thiry, Etienne ULg et al

in Journal of Feline Medicine and Surgery (2015), 17

Detailed reference viewed: 25 (3 ULg)
Full Text
Peer Reviewed
See detailDisinfectant choices in veterinary practices, shelters and households : ABCD guidelines on safe and effective disinfection for feline environments
Addie, D.D.; Boucraut-Baralon, C.; Egberink, H. et al

in Journal of Feline Medicine and Surgery (2015), 17

Detailed reference viewed: 16 (2 ULg)