References of "THYS, Christine"
     in
Bookmark and Share    
Full Text
Peer Reviewed
See detailL'image du mois. Geyser endobronchique secondaire a une fistule broncho-oesophagienne.
DUYSINX, Bernard ULg; HEINEN, Vincent ULg; FRUSCH, Nicolas ULg et al

in Revue Médicale de Liège (2011), 66(10), 511-2

Detailed reference viewed: 10 (2 ULg)
Peer Reviewed
See detailMolecular detection of kobuviruses and recombinant noroviruses in cattle in continental europe
Mauroy, Axel ULg; Scipioni, Alexandra; Mathijs, Elisabeth et al

Poster (2009, August)

Introduction and Objectives Noroviruses (NoV) and Kobuviruses (KoV), belong to the family Caliciviridae genus Norovirus and to the family Picornaviridae genus Kobuvirus respectively. Both have a single ... [more ▼]

Introduction and Objectives Noroviruses (NoV) and Kobuviruses (KoV), belong to the family Caliciviridae genus Norovirus and to the family Picornaviridae genus Kobuvirus respectively. Both have a single stranded positive-sense RNA genome. They both infect the gastrointestinal tract of different animal species including human beings. Two NoV and one KoV prototype strains have been already identified in the bovine (Bo) species: Jena virus (JV) and Newbury 2 (NB2) for BoNoV; U1 for BoKoV. Genogroup (G) III gathers all BoNoV strains and is further subdivided into two genotypes where viruses genetically related to JV and NB2 are assigned to the genotype 1 and 2 respectively. Recombination is a common event in NoV and is usually reported near the overlapping region between open reading frame (ORF) 1 (end of the polymerase gene) and ORF2 (beginning of the single capsid protein gene). Two GIII.1/GIII.2 BoNoV recombinant strains have been described including the recombinant strain Bo/NoV/Thirsk10/00/UK (Thirsk10), identified in the year 2000 in Great Britain. To our knowledge, no other genetically related strains have been reported since [1]. Bovine KoV were detected by RT-PCR in stool samples of healthy calves from Japan, in samples from diarrhoeic calves from Thailand [2] and were also identified very recently in Hungary. Bovine NoV prevalence studies performed in different areas have shown the predominance of the GIII.2 genotype but this could reflect a GIII.1 specificity failure in the RT-PCR methods. The aim of this study was to screen cattle stool samples with two primer sets targeting the polymerase and the capsid region. The primer pair targeting the capsid region was designed based on a GIII.1 sequence in order to improve their detection. Materials and methods A stool bank (n=300) was created with calf and young stock diarrhoeic samples from five provinces in Belgium (Hainaut, Liège, Namur, Luxembourg, Walloon Brabant) and received from a Belgian diagnostic laboratory through the year 2008. Viral RNA extraction was performed and one step RT-PCR was carried out on 2 µl of each viral RNA extraction using the CBECu-F/R primers (nucleotidic position on JV: 4543-4565 and 5051-5074) and a primer pair, named AMG1-F/R, designed from the JV genomic sequence (F: tgtgggaaggtagtcgcgaca, nucleotidic position on JV: 5012-5032; R: cacatgggggaactgagtggc, 5462-5482). Combined approaches with the CBECu-F and AMG1-R primers, additional internal primers (F2: atgatgccagaggtttcca, position on JV: 4727-4745; R2: gcaaaaatccatgggtcaat, 5193-5211) or CBECu-F and a polyTVN-linker were also carried out on some positive samples. RT-PCR products were directly sequenced twice or cloned before sequencing. Sequencing was carried out at the GIGA facilities of the University of Liège with BigDye terminator kit. Nucleotidic sequences were analysed with the BioEdit software. Nucleotidic similarity with the NCBI genetic database was assessed using the BLAST tool. Phylogenetic inference was performed with the MEGA software. Phylogenetic tree was constructed by neighbour-joining analysis where evolutionary distances were computed using the Maximum Composite Likelihood method. The confidence values of the internal nodes were calculated by performing 1,000 replicate bootstrap values. Genetic recombination was analysed with the Simplot software and the Recombinant Detection Program. Results Twenty-eight positive samples were identified in the 300 samples: 24 and 23 BoNoV sequences with the CBECu and AMG1 primer pairs respectively, giving a combined apparent molecular prevalence of 9.33% (CI 95%: [9.27; 9.38%]). Using BLAST, three sequences amplified with CBECu-F/R (BV164, BV362, and BV416) were genetically more related to the GIII.1 JV and Aba Z5/02/HUN sequences and one (BV168) to the recombinant strain Thirsk10. The others were genetically related to GIII.2 BoNoV. All the sequences amplified with AMG1-F/R but one genetically matched with GIII.2 BoNoV. The AMG1-amplicon of the BV416 sample matched with the recombinant strain Thirsk10. A 2410 nucleotide (nt)-large genomic sequence was obtained from BV416 with CBECu-F/TVN linker, which was a recombinant sequence genetically related to the Thirsk10 strain. This result was confirmed by phylogenetic and by Simplot analysis. The potential recombination breakpoint of BV416 was located near or within the ORF1/ORF2 overlapping region depending on the bioinformatic program used. Comparison between its different genomic regions and the JV, Newbury2 and Thirsk10 genomic sequences showed that the polymerase region of BV416 was genetically more related to the GIII.1 than to the recombinant strain. F2/R2 amplicons from BV164 and BV362 were genetically related to GIII.2 and GIII.1 BoNoV respectively. Surprisingly, three amplicons obtained with the combined primer pair CBECu-F/AMG1-R on BoNoV positive samples at the expected molecular weight did not match genetically with BoNoV but did so with different genomic regions of the BoKoV U1 strain (86%, 92% and 93% of nucleotidic identity by BLAST for BV228, 250 and 253 respectively on sequences of about 500-700 nt). Discussion and conclusions In this study, very few genotype 1 BoNoV were identified (BV362 was the sole GIII.1 sequence obtained in the ORF1/2 overlapping region), confirming results reported in a previous study on BoNoV infection in the same area [3]. A recombinant status was clarified for BV416. Co-infection with GIII.1 and GIII.2 BoNoV was evidenced in the BV164 sample but could not be excluded in the BV168 sample because an overlapping sequence could not be obtained, although genetic analyses related its CBECu-F/R sequence to the Thirsk10 sequence. These results raise issues about the genetic characterization by primers targeting either the polymerase region or the capsid region. By exclusion of the potential recombination breakpoint, these primers can lead to the misclassification of strains and to the underestimation of circulation of recombinant strains. Multiple alignment and bioinformatic analysis performed with JV, Aba Z5, NB2, Thirk10 and BV416 sequences has suggested a recombination breakpoint for BV416 located near the ORF1/ORF2 overlapping region and one quite similar to those determined for the Thirsk10 strain. Nevertheless the greater similarity of BV416 with the Jena and Aba Z5 viruses in the polymerase region and the exact localization of the recombination breakpoint suggest another origin or genetic evolution than the Thirsk10 strain. The identification, in geographically and temporally different samples, of sequences that could be genetically related to the recombinant Thirsk10 strain suggests at least that Thirsk10-related strains circulate in the north European cattle population. Furthermore, the low detection rate of GIII.1 BoNoV could reflect an evolution of the viral population pattern to the benefit of the Thirsk10-related and genotype 2 strains in the studied region. To date, BoKoV-related sequences have been very rarely identified, and in only three countries (namely Japan, Thailand and Hungary). Their detection in another European country suggests their wider distribution, making them at least emerging bovine viruses in the studied region. In conclusion, prevalence studies on BoNoV using RT-PCR assays, even targeting relatively well conserved genomic regions, need to take into account in their protocols both their high genetic variability and their relative genetic proximity with other viruses, in order to maximize sensitivity and specificity. This study also showed that recombination events could lead to emerging strains in the BoNoV population, as already found for HuNoV. The molecular detection of bovine kobuvirus-related sequences in the studied area extends the distribution of these viruses in Europe. [less ▲]

Detailed reference viewed: 16 (0 ULg)
Peer Reviewed
See detailDétection des sapovirus porcins par RT-PCR en temps réel
Mauroy, Axel ULg; Scipioni, Alexandra; Mathijs, Elisabeth et al

Poster (2009, April)

Les sapovirus appartiennent à la famille virale des Caliciviridae. Ces virus sont responsables de gastroentérites épidémiques dans l’espèce humaine et sont actuellement majoritairement détectés en Asie ... [more ▼]

Les sapovirus appartiennent à la famille virale des Caliciviridae. Ces virus sont responsables de gastroentérites épidémiques dans l’espèce humaine et sont actuellement majoritairement détectés en Asie. Des souches de sapovirus ont également été isolées dans l’espèce porcine. Trois pays européens seulement ont rapporté la présence de souches de sapovirus porcins dans leurs troupeaux: la Hongrie (Reuter et al., 2007), l’Italie (Martella et al., 2008) et tout récemment la Belgique (Mauroy et al., 2008). La détection moléculaire de la présence de séquences de sapovirus porcins dans des pays où densités d’élevages et de population humaine se conjuguent posent des questions d’ordre zoonotique, problème déjà en discussion pour des virus qui leur sont proches: les norovirus humains et animaux (Scipioni et al., 2008). De plus l’identification de ces nouveaux pathogènes pour l’espèce porcine suggèrent également d’en évaluer les impacts économique, sanitaire et clinique pour cette filière. Ces questions ne pourront être correctement évaluées que si ces virus sont recherchés et que des méthodes fiables de détection sont développées. Dans une précédente étude (Mauroy et al., 2008), le couple d’amorce p289/p290, développé par Jiang et collaborateurs (1999) pour la détection des calicivirus humains (norovirus et sapovirus), avait permis la détection de séquences génomiques de sapovirus et de norovirus porcins. Les amorces p289/290 ont été utilisées dans cette étude dans une RT-PCR en temps réel mettant à profit la technologie SYBR green. L’étude des courbes de dissociation obtenues nous a permis de pouvoir différencier des échantillons de matières fécales positifs pour la présence de séquences génomiques de sapovirus porcins de ceux qui étaient positifs pour la présence de différents calicivirus humains ou animaux (norovirus humains, sapovirus humains, norovirus bovin et porcin, vésivirus félin isolé de tractus respiratoire, vésivirus félin isolé de tractus digestif). Cette méthode devra être dans un premier temps appliquée à un échantillon plus important de matières fécales confirmées positives pour la présence de sapovirus porcins pour pouvoir être validée. La validation de cette méthode pourra ensuite permettre aux laboratoires de diagnostic de disposer d’une méthode rapide et fiable de détection de ces virus dans les filières concernées. [less ▲]

Detailed reference viewed: 9 (0 ULg)
Peer Reviewed
See detailNorovirus and sapovirus in pigs in Belgium
Mauroy, Axel ULg; Scipioni, Alexandra; Mathijs, Elisabeth et al

Poster (2008, September)

Noroviruses and sapoviruses belong to the norovirus and sapovirus genera respectively in the family Caliciviridae. These positive single stranded RNA viruses are known as common gastroenteritis agents in ... [more ▼]

Noroviruses and sapoviruses belong to the norovirus and sapovirus genera respectively in the family Caliciviridae. These positive single stranded RNA viruses are known as common gastroenteritis agents in human and have been also identified in other species like swine (1). Porcine noroviruses and sapoviruses have been to date poorly detected in European countries. Porcine sapovirus have been only reported in 2 European countries, namely Hungary and Italy (2; 3) and porcine norovirus sequences were detected in The Netherlands (4). In this study, both porcine noroviruses and sapoviruses were detected in swine stools showing their circulation in Belgian premises. Seven samples gave positive amplicons. Using BLAST and phylogenetic analysis, two porcine norovirus strains were identified and are genetically related to genotype 19 strains. Five samples contained porcine sapoviruses and are genetically related to the Porcine Enteric Calicivirus Cowden and newly described porcine strains. Sapovirus sequences were mainly detected in stool of piglets (less than 8 weeks old). Only one sequence was detected in an older pig (16-20 weeks). Norovirus sequences were detected in stools of fattening pigs (16-20 weeks). Neither sapovirus nor norovirus detected sequences could be associated with clinical signs of gastroenteritis. In conclusion, the circulation of both porcine sapovirus and norovirus was shown in Belgium, extending their European distribution. Given uncertainties on the zoonotic risk, countries where swine and humans are relatively closed should develop surveillance programs where both human and animal calicivirus strains are screened in gastroenteritis outbreaks, wastewaters and veterinary diagnostic samples. [less ▲]

Detailed reference viewed: 21 (0 ULg)
Peer Reviewed
See detailNorovirus bovins isolés en Belgique en 2007 et investigation de leur potentiel zoonotique par l’étude des interactions virus-celllules
Mauroy, Axel ULg; Scipioni, Alexandra; Mathijs, Elisabeth et al

Poster (2008, March)

Appartenant à la famille des Caliciviridae, les norovirus sont des virus non enveloppés. Leur génome est composé d’un ARN monocaténaire de polarité positive d’approximativement 7,5 kb. Trois cadres ... [more ▼]

Appartenant à la famille des Caliciviridae, les norovirus sont des virus non enveloppés. Leur génome est composé d’un ARN monocaténaire de polarité positive d’approximativement 7,5 kb. Trois cadres ouverts de lecture (ORFs) y sont décrits et l’ORF 2 code pour l’unique protéine composant leur capside. Les norovirus infectent l’homme et les animaux (bovins, porcins, murins). Chez l’homme, ils sont des agents majeurs de gastroentérite sporadique ou épidémique d’origine souvent alimentaire. Chez le bovin, ils seraient également les agents d’entérite bénigne bien qu’à l’heure actuelle aucune épidémie à norovirus n’ait été décrite chez cette espèce. La voie d’infection des norovirus est habituellement oro-fécale, ils sont très résistants dans l’environnement et une infection peut survenir même avec une très faible dose infectieuse. Les norovirus humains et animaux sont relativement proches génétiquement et coexistent parfois de manière très étroite dans nos pays d’Europe du nord. Il est donc logique d’envisager le risque zoonotique lié aux norovirus animaux et plus particulièrement celui lié aux norovirus bovins. Ces derniers sont considérés comme endémiques dans des pays proches de la Belgique et une forte séroprévalence apparente a été montrée dans ce pays. Ce travail avait pour but l’étude moléculaire des souches de norovirus bovins ayant circulé au cours de l’année 2007. L’investigation préliminaire de leur potentiel zoonotique a également été étudiée au travers des interactions virus-cellules. Une banque d’échantillons de matières fécales bovines en provenance d’un laboratoire d’analyse et de diagnostic vétérinaire installé en Région Wallonne (ARSIA) a été constituée tout au long de l’année. Un diagnostic rapide par RT PCR a été effectué pour détecter des séquences de norovirus bovins des deux génotypes décrits actuellement. Les couples d’amorces utilisés, JV12-13, BEC et CBECu s’hybridaient dans les régions codant pour la polymérase virale et dans le début de l’ORF2, régions assez conservées. Ces séquences ont été analysées comparativement à celles isolées dans les années précédentes. Parallèlement, des pseudoparticules d’une souche de norovirus bovin (B309) et d’une souche de norovirus humain (HV) ont été produites comme décrit précédemment avec de légères modifications. Leur concentration protéique a été obtenue par BCA et des lapins ont été immunisés avec ces antigènes. Trois injections de 25 µg d’antigènes dilués dans du PBS et complétées avec les adjuvants complet et incomplet de Freund ont été réalisées. La production d’un sérum hyperimmun dirigé contre la protéine de capside des norovirus a été contrôlée par ELISA. Les pseudoparticules ont ensuite été utilisées pour des études de liaisons sur différents types cellulaires dont les Caco2, cellules connues pour exprimer à leur surface des oligosaccharides proches de ceux des systèmes ABO et de Lewis, ces oligosaccharides étant impliqués comme récepteurs cellulaires pour de nombreux norovirus humains. L’attachement des pseudoparticules a été mis en évidence par immunofluorescence indirecte en utilisant les sérums polyclonaux et un anticorps secondaire anti-lapin couplé à l’Alexa fluor 488. Des séquences de norovirus bovins ont pu être identifiées dans les prélèvements de matières fécales bovines tout au long de la période de constitution de la banque, ces séquences étant proches de celles des norovirus bovins de génotype 2. Une prévalence apparente dans les cheptels bovins de Wallonie a put être déterminée. Au cours de premiers tests réalisés, si les pseudoparticules de HV se sont liées aux cellules Caco2, aucun attachement des pseudoparticules du norovirus bovin à ces mêmes cellules n’a pu être démontré. Nous avons donc montré que les norovirus sont largement répandus en Belgique et leur diagnostic tout au long de la période d’échantillonnage prouve un certain caractère endémique de ces virus en Belgique ; cette constatation rejoignant celles en provenance de pays proches (Grande Bretagne, Allemagne) et de séroprévalence. De ce fait, ils pourraient constituer un risque zoonotique, risque qui pourrait être cependant pondéré par les études préliminaires d’interaction virus-cellules. Des études plus approfondies ont besoin d’être conduites à ce sujet. [less ▲]

Detailed reference viewed: 13 (1 ULg)