References of "Mauroy, Axel"
     in
Bookmark and Share    
Full Text
Peer Reviewed
See detailMolecular detection of bovine noroviruses in Argentinean dairy calves: Circulation of a tentative new genotype
Ferragut, Fatima; Vega, Celina; Mauroy, Axel ULg et al

in Infection, Genetics and Evolution : Journal of Molecular Epidemiology and Evolutionary Genetics of Infectious Diseases (in press)

Detailed reference viewed: 22 (7 ULg)
Peer Reviewed
See detailInfection expérimentale de porcs, par voie intraveineuse ou orale, avec une souche du virus de l’hépatite E (HEV) de sanglier, une souche de HEV porcine et une souche de HEV de sanglier préalablement passée en modèle porcin
Thiry, Damien ULg; Rose, Nicolas; Mauroy, Axel ULg et al

Poster (2016, March)

La transmission zoonotique du HEV est particulièrement mise en cause dans les pays développés dans lesquels la transmission via les eaux usées est beaucoup moins fréquente que dans les pays en voie de ... [more ▼]

La transmission zoonotique du HEV est particulièrement mise en cause dans les pays développés dans lesquels la transmission via les eaux usées est beaucoup moins fréquente que dans les pays en voie de développement. Des séroprévalences élevées sont observées chez certaines espèces animales dans plusieurs pays européens. Cette étude a porté sur la transmission potentielle au porc d\'une souche de HEV provenant du sanglier (WbHEV) par inoculation intraveineuse ou par voie orale et sur l’étude des conséquences de l’infection du porc par une souche de WbHEV, une souche de WbHEV précédemment passée chez le porc et une souche porcine de HEV après inoculation orale. Tout d\'abord, une infection par voie intraveineuse a été réalisée au cours de laquelle cinq porcelets ont été répartis en deux groupes. Le premier était constitué de trois porcs inoculés avec du WbHEV et le second, de deux porcs inoculés avec un foie de porc négatif envers le HEV. Tous les porcs ont été euthanasiés et autopsiés 8, 9 et 10 jours après l’inoculation. Cette première expérience avait pour objectif d’obtenir suffisamment de virus en vue de réaliser les inoculations par voie orale. Elle a également permis d’étudier l’infectivité d’une souche de HEV-3 provenant du sanglier chez le porc. Ensuite, une infection par voie orale a été réalisée sur 12 porcelets répartis en 4 groupes inoculés respectivement avec une souche de WbHEV, une souche de WbHEV précédemment passée chez le porc, une souche porcine de HEV et un foie de porc HEV négatif. Cette expérience a duré 56 jours. Les échantillons récoltés ont ensuite été analysés par qRT-PCR, ELISA, Western blot et histopathologie. Le nombre de porcs virémiques était plus faible après infection orale qu’après inoculation intraveineuse. Ce résultat contraste avec la présence du HEV dans les matières fécales des porcs au cours des deux expériences. Les résultats montrent également une propagation du virus dans différents organes après inoculation intraveineuse, mais pas après inoculation par voie orale. Cette étude fournit la première preuve expérimentale de la propagation précoce du virus dans l\'organisme après infection intraveineuse avec une souche de HEV provenant du sanglier et montre qu’une telle souche pourrait être naturellement transmise entre les sangliers et les porcs, mais aussi entre porcs et donc survivre dans la population porcine. [less ▲]

Detailed reference viewed: 16 (2 ULg)
Full Text
Peer Reviewed
See detailBovine noroviruses: A missing component of calf diarrhoea diagnosis
Di Felice, Elisabetta; Mauroy, Axel ULg; Dal Pozzo, Fabiana ULg et al

in Veterinary Journal (2016), 207

Detailed reference viewed: 91 (17 ULg)
Full Text
Peer Reviewed
See detailComparative virucidal efficacy of seven disinfectants against murine norovirus and feline calicivirus, surrogates of human norovirus
Zonta, William ULg; Mauroy, Axel ULg; Farnir, Frédéric ULg et al

in Food and Environmental Virology (2016)

Human noroviruses (HuNoV) are the leading cause of acute nonbacterial gastroenteritis in humans and can be transmitted either by person-to-person contact or by consumption of contaminated food. Knowledge ... [more ▼]

Human noroviruses (HuNoV) are the leading cause of acute nonbacterial gastroenteritis in humans and can be transmitted either by person-to-person contact or by consumption of contaminated food. Knowledge of an efficient disinfection for both hands and food contact surfaces is helpful for the food sector and provides precious information for public health. The aim of this study was to evaluate the effect of seven disinfectants belonging to different groups of biocides (alcohol, halogen, oxidizing agents, quaternary ammonium compounds, aldehyde and biguanide) on infectious viral titre and on genomic copy number. Due to the absence of a cell culture system for HuNoV, two HuNoV surrogates such as murine norovirus (MNV) and feline calicivirus (FCV), were used and the tests were performed in suspension, on gloves and on stainless steel discs. When, as criteria of efficacy, a log reduction > 3 of the infectious viral titre on both surrogates and in the three tests is used, the most efficacious disinfectants in this study appear to be biocidal products B, C and D, representing the halogens, the oxidizing agents group and a mix of QAC, alcohol and aldehyde, respectively. In addition, these three disinfectants also elicited a significant effect on genomic copy number for both surrogate viruses and in all three tests. The results of this study demonstrate that a halogen compound, oxidizing agents and a mix of QAC, alcohol and aldehyde are advisable for HuNoV disinfection of either potentially contaminated surfaces or materials in contact with foodstuffs. [less ▲]

Detailed reference viewed: 30 (7 ULg)
Full Text
Peer Reviewed
See detailBelgian Wildlife as Potential Zoonotic Reservoir of Hepatitis E virus
Thiry, Damien ULg; Mauroy, Axel ULg; Saegerman, Claude ULg et al

in Transboundary and Emerging Diseases (2015)

Detailed reference viewed: 36 (13 ULg)
See detailComparative study of experimental infection of piglets with a field strain of wild boar HEV, a wild boar HEV strain previously passed in porcine model and a swine HEV strain
Thiry, Damien ULg; Rose, Nicolas; Mauroy, Axel ULg et al

Poster (2015, October)

Domestic pig and wild boar are reservoirs for hepatitis E virus (HEV). This study aims to investigate the infection of pigs with HEV strains from wild boar and to compare the behaviour of a wild boar ... [more ▼]

Domestic pig and wild boar are reservoirs for hepatitis E virus (HEV). This study aims to investigate the infection of pigs with HEV strains from wild boar and to compare the behaviour of a wild boar strain to a pig strain in vivo. The objective is to contribute to the elucidation of the crossing barrier between wild boar and pig with this zoonotic virus. A total of 12 specific pathogen free piglets were divided into four groups and orally inoculated respectively with a wild boar HEV strain previously passed in pigs (WbHEV), a wild boar HEV (WbHEVs), a swine HEV (SwHEV) and a negative control group. One pig from each group was euthanized 15 days after inoculation. The remaining pigs were sacrificed on day 56. A serological monitoring by ELISA was realized throughout the experiment, the viral load was determined in different organs by qRT-PCR. Viral RNA was found in several organs and tissues of the inoculated pigs. Most of the pigs were HEV positive at the 15th day and no clinical signs were observed during infection. Liver enzymes (ALT and AST) remained within the reference values. This study provides experimental evidence of the swine infection with a strain of HEV isolated from wild boar and previously passed in pig. Furthermore, these data indicate the possibility of the transfer of the virus from wild boar to pig, for example, in the context of outdoor pig breeding. [less ▲]

Detailed reference viewed: 14 (1 ULg)
Peer Reviewed
See detailFitness evaluation and molecular characterization of a recombinant murine norovirus (MuNoV) during serial passages in cell culture
Ferreira de Oliveira Filho, Edmilson; Di Felice, Elisabetta; Toffoli, Barbara et al

Conference (2015, September 01)

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a ... [more ▼]

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a recombinant Wu20/CW1 strain was obtained after in vitro coinfection of RAW264.7 cells with parental MuNoV strains CW1 and Wu20 (Mathijs et al 2010). The recombinant strain showed reduced plaque size compared to the parental strains and it was suggested that this was due to modified virulence properties in vitro. The aim of this study was to observe and molecularly characterize the natural genetic evolution of the recombinant MuNoV strain across in vitro replications. Methods: MNV strains used in this study were CW1, WU20 (Thackray et al., 2007, kindly provided by prof. H. Virgin) and Rec MNV (Mathijs et al., 2010). RAW 264.7 cells (ATCC TIB-71) grown in Dulbecco’s modified Eagle’s medium (Invitrogen) complemented (DMEMc) with 10 % heat inactivated FCS (BioWhittaker), 2 % penicillin (5000 U /ml) and streptomycin (5000 mg/ml) (PS; Invitrogen) and 1 % HEPES buffer (1 M; Invitrogen). The recombinant strain was serially replicated in vitro in RAW264.7 cells (up to 14 passages). RAW 264.7 (Mouse leukaemic monocyte macrophage) cells were infected with MNV for 72 hours and afterwards lysed by freeze and thaw and viruses purified by ultracentrifugation of both cells and supernatant. Viral plaque sizes of early and late progenies (30 for each virus) were compared with the Image J software. The experiment was repeated two times. RNA was extracted from 140 ml purified suspension 1:5 diluted using the QIAamp Viral RNA Mini KitTM (Qiagen) according to the manufacturer’s instructions. cDNA was generated using a poly-A primer tagged GCCAACGACCGGGAGGCCAGC(T)20 previously described (Müller et al 2007) using superscript ii reverse transcriptase kit (Invitrogen®) treated with RNase H or with other antisense primers using iScript select kit (Bio-Rad®). For the genetic characterization two different studies were conducted. The first study aimed to develop a sequencing strategy in order to obtain the complete genome of the recombinant MNV. Then, in the second study, sequences obtained from different viral passages into RAW cells (e.g. P5 and P14) were compared in order to study the viral adaptation. Primers were designed using the Primer Express® software and netprimer® (Premier biosoft). PCR was performed using taq polymerase with thermopol buffer (new England biolabs) as per manufacturer’s instructions. Afterwards, fragments were excised from agarose gel and DNA purified using the QIAquick Gel Extraction KitTM (Qiagen) and cloning using the PGEM T easy cloning kit (Promega) plasmid DNA was transferred to sequencing by GATC Biotech (Koblenz, Germany). Results: The size of the lysis plaque surface of P2 and P14 showed a considerable divergence. The average plaque size increased from the earlier to the later progenies (from 0.1 mm2 to around 0.5 mm2). A significant difference was demonstrated between them with the Mann and Whitney non parametric statistical test. The genetic characterization of the recombinant strain obtained in vitro was previously based on partial genomic sequences, which provided limited information. Accordingly to our initial molecular analysis of 1.5 kb partial genomic sequence comprising the part of the RdRp and the part of the VP1 did not show any genetic modifications between passage 4 (accession number HM044221) and passage 14 recMNV. Therefore, a strategy for sequencing the complete genome of the different MNV strains was established. The genome of the recombinant MNV was divided into seven regions and the amplification was performed using either new designed or previous published primers. Molecular analysis using the nearly complete genome of the recombinant MNV passage 14 and the two parental strains (CW1 and WU20) showed nine modifications in the genome, comprising three aminoacid changes. Accordingly, two modification were in the RdRp region aa position 1384 Glycine (G) instead of Aspartic acid (D) and aa position 1393 Serine (S) instead of Asparagine (N) and one modification was in the capsid region one modification on aa position 296 Glutamic Acid (E) instead of Lysine. Conclusion: Even preliminary, our data provide evidence of virus adaptation to a new environment (here a cell culture system) after a recombination event. In order to specify whether these hints of genetic mutations could explain fitness modifications during in vitro evolution we need to compare the sequences of passage 14 and the previous viral cellular passages. In addition, two other parameters of in vitro virulence modification will be investigated: (i) virus production and (ii) growth kinetics. The data should provide interesting information about genetic evolution in the genus Norovirus, especially regarding recombination events and explain how a recombinant strain, first disadvantaged compared to its parental strains, could regain fitness by genetic evolution. [less ▲]

Detailed reference viewed: 28 (3 ULg)
Full Text
See detailRare recombination events and occurrence of superinfection exclusion during synchronous and asynchronous infection with homologous murine norovirus strains
Elisabetta, Di Felice; Ludwig, Louisa ULg; Toffoli, Barbara et al

Poster (2015, September 01)

Objective: Human noroviruses (HuNoVs) are recognised as one of the major global causes of non-bacterial gastroenteritis with significant morbidity and mortality in developing countries and a high economic ... [more ▼]

Objective: Human noroviruses (HuNoVs) are recognised as one of the major global causes of non-bacterial gastroenteritis with significant morbidity and mortality in developing countries and a high economic impact in developed countries. Spread primarily via the faecal-oral route, HuNoV infection is typically an acute self-limiting gastrointestinal illness. However, chronic HuNoV infection of immunocompromised persons has been identified as a persistent cause of disease and viral populations in such patients have been postulated as possible reservoirs for novel NoV variants. The Norovirus genus belongs to the Caliciviridae family of small, non-enveloped, positive sense, single-stranded RNA viruses. This genus is subdivided into at least six genogroups, which infect humans and various animal species. Until the recent report of low-level infection of cultured human B cells, no viable cell culture system existed for the study of HuNoVs. The robustness of this new cell culture system still poses a major hurdle, so that the murine norovirus (MuNoV), replicating efficiently in murine dendritic or macrophage cells, remains the model of choice for in vitro study of noroviruses. The molecular mechanisms driving viral evolution and specifically that of NoVs, are accumulation of point mutations and recombination, which enables the emergence of new combinations of genetic materials to generate potentially dramatic genomic changes in a recombinant NoV, which clusters within two distinct groups of NoV strains when two different genomic regions are phylogenetically analysed. The mechanism for NoV recombination is proposed to follow the copy-choice mechanism, involving a template shift during simultaneous replication of two strains infecting the same cell. Numerous NoV recombination events have been highlighted by in silico methods and the phenomenon has recently been shown in vitro with two homologous MuNoV strains. The object of this study was to qualitatively and quantitatively assess virus progenies generated by the use of different parameters of co- and superinfection of RAW264.7 cells with two homologous MuNoV strains (CW1 and Wu20) and thus help to specify important parameters for the occurrence of recombination events. As prerequisite for recombination events, co-and superinfection are of special interest in viral diseases, such as NoV, for which a persistent stage can be developed. Methods: Viruses and Cells Murine NoVs isolates CW1 and Wu20 were plaque purified and propagated in RAW 264.7 cells (ATCC TIB-71).Virus stocks were produced by infection of RAW 264.7 cells at an MOI of 0.05 and clarified by centrifugation. Passages 8 and 7 for CW1 and Wu20, respectively, were used for the experiments. Co-infection and superinfection experiments Monolayers of RAW 264.7 cells were infected with Wu20 at a MOI of 1 on ice. After 1 h, the Wu20 inoculums were removed and stored. The cells were washed twice with PBS and infected with CW1 at various MOI (0.1 ; 1 ; 10) and at various delays of co- or superinfection (0 min, 30 min, 1 h, 2 h, 4 h, 8 h, 12 h and 24 h). For co-infections, CW1 and Wu20 were simultaneously inoculated on the cells for 1 h on ice. Twenty-four hours after CW1 co- or superinfections, cells and supernatants were collected. Molecular analysis RNA was extracted both from supernatants from the experiment and from propagations of individual plaques, reverse transcribed into cDNA and analysed via two parallel real time PCR reactions allowing discrimination between CW1 and Wu20 at both genomic extremities (regions 1 and 5, located at the ORF1 and ORF3 terminal respectively), as previously described by Mathijs et al., 2010. For analysis of the supernatants, quantifications were also performed via real time PCR. Accordingly, amplicons corresponding to region 1 were amplified for both CW1 and Wu20, then cloned and in vitro transcribed to provide a standard curve for RNA copies. Following this, values for genomic copies were deduced and results were normalised with GAPDH gene transcripts. Isolation and screening of progeny viruses A plaque assay for virus isolation from the co- or superinfection experiments was set up by modifying the protocol described by Hyde et al. (2009). Thus, after 24 h of incubation, 36 plaques were randomly picked for each condition and propagated by inoculation onto RAW 264.7 cells. After this amplification step, monitoring of recombination events was performed by PCR and Real-Time PCR on extracted, reverse transcribed viral RNA, using two sets of primers to amplify regions 1 and 5. The use of two pairs of TaqMan probes allowed discrimination of the strains WU20 and CW1 in two different regions and identification of recombinant strains. Results: Molecular analysis The Real-Time PCR performed on supernatants collected at 24 h post infection showed a greater number of copies of MuNoV Wu20 cDNA in almost all conditions, except t 0 h, 0.5 h, 1 h, 2 h at the MOI 10, where an increase in the number of copies of the CW1 strain was noted. In particular, the latter showed a peak at 1 h at the MOI 10 (89%) followed by a rapid reduction in later times (t 8 h: 20%). Interestingly, for both viruses expected ratios were never attained during the study with the notable exception of the MOI ratio 0.1/1 and the condition t1 MOI 10/1. Isolation and screening of progeny viruses Molecular analysis conducted on plaques selected in the condition of coinfection at MOI 1 and 10 highlighted a predominance of the strain MuNoV CW1 (90%) from t 0h to t 2h, followed by a sharp reduction from t 4h leading to complete absence at t 24h. The Wu20 strain showed a progressive increase from 4h (10%) to 24h (100%). Overall, the occurrence of recombination events was very rare. Only three putative recombination events were detected at t1 h MOI 1/1 and t 4 h MOI 1/1. Conclusion: The profiles of viral ratios over time are highly interesting. Particularly the infection with CW1 at the MOI 10, with a relative percentage of genomic quantifications of about 50% at the two first time points is intriguing. While the percentage is changed completely at t1 MOI 1 to give the expected ratio of 90/10, it then gradually decreases over the next time points to less than 10% at 24 h post infection. The presence of numerous recombinant viruses as a possible explanation for the t1 MOI 1 peak seems unlikely, as very few putative recombinants were detected during the screening process. The single-step growth kinetics established by Mathijs et al in 2010, showing great similarities for both strains, indicate that the replicative cycle dynamics of the viruses are probably also not responsible. The decrease, especially marked after 8 h, is suggestive of a superinfection exclusion mechanism, where productive infection with Wu20 induces a resistance of the cells to infection with the homologous CW1. Alternatively, in view of the above-mentioned growth curve at high MOI, the decrease might also be due to the end of the first replication cycle having been reached, with no more viable cells left for infection. Considering the 50% viral ratio estimated by genomic copies for the early time-points, the identification of CW1 as the predominant strain (90%) after plaque purification for the same time appears to be somewhat of a discrepancy and merits further investigation Although circulating recombinant NoV strains seem to be common, in vitro recombination is a rare event, at least in the protocol described above, and does not seem to be easily influenced by parameter changes such as time of infection and MOI. Parameters where putative recombinations were identified include t1 MOI 1 and t4 MOI 1. The possible recombinants are yet to be confirmed by sequencing reactions. Further study is necessary to understand mechanisms favouring the predominance of replication of recombinant virus strain in vivo and the challenges of such a replication in vitro. The occurrence of recombination was theoretically limited to one cycle of replication by the protocol (MOI 1 of Wu20). More than one replication cycle might be necessary to enhance the process of recombination by increasing the number of replicating events that could favour recombination. Thus, initial infection at a lower MOI might be an interesting future consideration. Other mechanisms than a time-dependent coinfection might also be worth exploring. Acknowledgements: We thank Professor Herbert Virgin and Dr Larissa Thackray (Washington University, St Louis, MO, USA) for providing the MNV isolates and RAW 264.7 cells. [less ▲]

Detailed reference viewed: 65 (6 ULg)
Full Text
Peer Reviewed
See detailHepatitis E Virus and Related Viruses in Animals
Thiry, Damien ULg; Mauroy, Axel ULg; Pavio, Nicole et al

in Transboundary and Emerging Diseases (2015)

Detailed reference viewed: 13 (0 ULg)
See detailInfection expérimentale du porc par une souche du virus de l’hépatite E isolée du sanglier
Thiry, Damien ULg; Rose, Nicolas; Mauroy, Axel ULg et al

Poster (2015, April)

Detailed reference viewed: 22 (0 ULg)
See detailIn vitro study of coinfection/superinfection parameters which can influence recombination events in noroviruses
Di Felice, Elisabetta; Ceci, Chiara; Toffoli, Barbara et al

Poster (2014, October 17)

Noroviruses (NoVs) are non-enveloped, single-stranded, positive-sense RNA viruses. They are important causes of acute non-bacterial gastroenteritis in humans worldwide but their study is currently yet ... [more ▼]

Noroviruses (NoVs) are non-enveloped, single-stranded, positive-sense RNA viruses. They are important causes of acute non-bacterial gastroenteritis in humans worldwide but their study is currently yet hampered by the lack of a cell culture system. NoVs genetically evolve by both point mutations and recombination and the murine norovirus (MuNoV) is considered as the best model for human NoVs. The aim of this study was to develop an experimental model based on the MuNoV in order to investigate coinfection/superinfection parameters that could impact recombination events. Monolayers of RAW264.7 cells were coinfected or superinfected with two MuNoV strains (CW1 and WU20) using different multiplicity of infection (0.1/1; 1/1 and 10/1 for CW1 and Wu20 , respectively) and time delays (0h; 0.5h; 1h; 2h; 4h; 8h; 12h and 24h) for infection. Supernatants were collected at 24 and 48 hours post-infection. Genomic copies of both viruses were first quantified by RT-QPCR. Then, viruses from the supernatants were plaque purified (36 clones per condition) and their recombinant status was checked by a real-time PCR discriminating method using primers targeting both extremity of the MuNoV genome. Results of quantitative and plaque picking assays are compared. Together, the results confirm that recombination does not frequently occur, at least in vitro and raise the issue on why these events are however so usual with in silico detection methods. The data also showed that superinfection exclusion seems to be triggered from 4h post infection with the first MuNoV. The mechanisms of the later should be still studied. [less ▲]

Detailed reference viewed: 20 (3 ULg)
See detailEffect of biocides on murine norovirus and feline calicivirus, surrogates of human norovirus, in suspension, glove and stainless steel disc tests
Zonta, William ULg; Mauroy, Axel ULg; Thiry, Etienne ULg

Poster (2014, October 17)

Human noroviruses (HuNoV) are one of the major agents of human gastroenteritis and transmission occurs mainly by the faecal-oral route. The purpose of this work was to test biocide products on surrogate ... [more ▼]

Human noroviruses (HuNoV) are one of the major agents of human gastroenteritis and transmission occurs mainly by the faecal-oral route. The purpose of this work was to test biocide products on surrogate viruses of HuNoV in order to get information on the residual viral infectivity and on the integrity of viral genomes after biocide treatment in various conditions. Murine norovirus (MNN) and feline calicivirus (FCV) have been chosen as HuNoV surrogates because presenting comparable structure and physico-chemical properties. Two biocide products have been chosen, Ethanol (70%) and Kenocid 2100® (Peracetic acid and hydrogen peroxide) and used in 3 different conditions (in suspension, on gloves and on stainless steel discs). The biocide product was tested according to Afnor norm EN 14476. The reduction of viral titre was inferred and RNA extraction followed by a 1 step RT-qPCR was performed. If biocides products tested are able to show a 4 log reduction of the viral infectious titre, they are considered as effective. Efficacy against HuNoV can be extrapolated from these results. MNV is sensitive to Ethanol and Kenocid 2100® with and without any effect on genomic copy numbers respectively. FCV is sensitive to Kenocid 2100® with an effect on genomic copy numbers but is resistant to EtOH. The absence of effect of Kenocid 2100® on genomic copy numbers of MNV indicates this biocide product does not interfere directly on the viral genome. It may likely act on the viral structure, the capsid for example. This project is financed by Federal Public Service, Health, Food Chain Safety and Environment, in Belgium (RT 10/6 TRAVIFOOD). [less ▲]

Detailed reference viewed: 44 (0 ULg)
See detailFitness evolution of a recombinant murine norovirus during serial passages in cell culture
Oliveira-Filho, Edmilson; Di Felice, Elisabetta; Toffoli, Barbara et al

Poster (2014, October 17)

Human norovirus (NoV) infections are among the most important causes of gastroenteritis in both children and adults and often occur as outbreaks which may be foodborne. Recombination can dramatically ... [more ▼]

Human norovirus (NoV) infections are among the most important causes of gastroenteritis in both children and adults and often occur as outbreaks which may be foodborne. Recombination can dramatically change virulence properties of the viruses and has been often evidenced in silico for different NoV strains. Recently, after in vitro coinfection of RAW264.7 cells with parental murine norovirus (MuNoV) strains CW1 and Wu20, we obtained a recombinant Wu20/CW1 strain (Mathijs et al., 2010). This recombinant strain showed reduced plaque size compared to the parental strains. The aim of the study was to observe and molecularly characterize the natural genetic evolution of the recombinant MuNoV strain across in vitro replications. The recombinant strain was serially replicated in vitro (up to 14 passages). Viral plaque diameters of early and late progenies were compared with the Image software. A significant difference was shown between them with the Mann and Whitney non parametric statistical test. The average size of plaques increased from the earlier to the later progenies (from 0.1 mm2 to around 0.5 mm2). Molecular investigations are currently performed in order to specify in which genetic region mutations occur and whether or not this could explain fitness modifications during in vitro evolution. In addition two other parameters of in vitro virulence modification will be investigated (i) virus production and (ii) one step growth kinetics. The data should provide interesting information about genetic evolution in the genus Norovirus, especially regarding recombination events and explain how a recombinant strain, first disadvantaged compared to its parental strains, could regain fitness by genetic evolution. Mathijs, E., Muylkens, B., Mauroy, A., Ziant, D., Delwiche, T., Thiry, E., 2010. Experimental evidence of recombination in murine noroviruses. J Gen Virol 91, 2723-2733. [less ▲]

Detailed reference viewed: 8 (0 ULg)
See detailExperimental in vivo infection of pigs by a wild boar hepatitis E virus strain
Thiry, Damien ULg; Rose, Nicolas; Paboeuf, Frédéric et al

Conference (2014, October 17)

Detailed reference viewed: 14 (3 ULg)
See detailExperimental in vivo infection of pigs by a Belgian wild boar hepatitis E virus strain
Thiry, Damien ULg; Rose, Nicolas; Paboeuf, Frédéric et al

Poster (2014, October)

Detailed reference viewed: 16 (3 ULg)
Peer Reviewed
See detailFITNESS EVALUATION OF A RECOMBINANT MURINE NOROVIRUS DURING SERIAL PASSAGES IN CELL CULTURE
Oliveira-Filho, Edmilson; Di Felice, Elisabetta; Toffoli, Barbara et al

Poster (2014, September 28)

Noroviruses are single stranded positive sense RNA viruses which can infect human and different animal species. Human norovirus (NoV) infections are among the most important causes of gastroenteritis in ... [more ▼]

Noroviruses are single stranded positive sense RNA viruses which can infect human and different animal species. Human norovirus (NoV) infections are among the most important causes of gastroenteritis in both children and adults. Infections often occur as outbreaks which may be foodborne. Due to the lack of an efficient cell culture system as well as a workable animal model, many aspects of the NoV infection in human are still poorly understood. The murine norovirus (MuNoV) grows easily in cell culture in contrast to the Human NoV, and constitutes an excellent animal model. Recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Recently, after in vitro coinfection of RAW264.7 cells with parental MuNoV strains CW1 and Wu20, we obtained a recombinant Wu20/CW1 strain. This recombinant strain showed reduced plaque size compared to the parental strains. The aim of the study was to observe and molecularly characterize the natural genetic evolution of the recombinant MuNoV strain across in vitro replications. Viral fitness is a complex concept. Here we defined this fitness as the ability of a viral population to adapt to the cell culture system. Thus, the recombinant strain was serially replicated in vitro in RAW264.7 cells (up to 14 passages). Viral plaque sizes of early and late progenies were compared with the Image J software. A significant difference was shown between them with the Mann and Whitney non parametric statistical test. Afterwards, viruses from different cell passages were cloned and sequenced. The average plaque size increased from the earlier to the later progenies (from 0.1 mm2 to around 0.5 mm2). Molecular investigations are currently performed in order to specify in which genetic region mutations occur and whether or not this could explain fitness modifications during in vitro evolution. In addition, two other parameters of in vitro virulence modification will be investigated: (i) virus production and (ii) one step growth kinetics. The data should provide interesting information about genetic evolution in the genus Norovirus, especially regarding recombination events and explain how a recombinant strain, first disadvantaged compared to its parental strains, could regain fitness by genetic evolution. [less ▲]

Detailed reference viewed: 39 (5 ULg)
Peer Reviewed
See detailHigh throughput sequencing analysis reveals genetic variability and selection pressure in different murine norovirus genomic regions during in vitro replication
Mauroy, Axel ULg; Taminiau, Bernard ULg; Nezer, Carine et al

Poster (2014, July)

Murine norovirus (MuNoV), a single stranded positive sense RNA virus belonging to the Caliciviridae family, is considered as a representative model for human norovirus infections, one of the most ... [more ▼]

Murine norovirus (MuNoV), a single stranded positive sense RNA virus belonging to the Caliciviridae family, is considered as a representative model for human norovirus infections, one of the most important etiological cause of both epidemic and sporadic gastroenteritis cases worldwide. Four open reading frames are described into its genome: ORF1 codes the non-structural (NS) proteins, including the viral RNA dependent RNA polymerase (RdRp); ORF2 codes the single capsid protein (VP1), wherein two domains are present: a relatively conserved domain (“shell”) and a more variable domain (“protruding”); ORF3 codes a minor structural protein; and ORF4, currently only found in viruses genetically related to MuNoV codes a virulence factor. In this study, we demonstrated by high throughput sequencing that, during serial passages of MuNoV in cell culture, the substitution rates, estimated by Bayesian inferences, did not significantly differ across the five targeted genomic regions except one. These rates were similar in four genomic regions encompassing partial non-structural 1-2 protein (NS1-2)-, NS5-, NS6-, NS7 (RdRp)- and VP1-coding sequences (coding the conserved part of the protein also including the ORF4 region). In the partial minor structural protein-coding region, this substitution rate was however estimated to be at least one log higher when expressed as substitution/site/day. The precise localisation of the detected nucleotide point mutations (substitution, deletion and insertion) were reported as well as the quantitative increase or decrease of the sequences harbouring them along ten cell culture passages. The non-silent amino acid mutations were also depicted in 3D models for four out of the five studied regions. These results have important implications for different norovirus research fields, especially in terms of diagnosis, classification methodology and genetic evolution. [less ▲]

Detailed reference viewed: 45 (1 ULg)
Peer Reviewed
See detailSTUDIO in vitro DEI PARAMETRI DI COINFEZIONE E SUPERINFEZIONE CHE INFLUENZANO LA RICOMBINAZIONE NEI NOROVIRUS
Di Felice, Elisabetta; Ceci, Chiara; Zonta, William ULg et al

Poster (2014, June)

I norovirus (NoV) sono piccoli virus (38-40 nm) a RNA monocatenario sprovvisti di envelope appartenenti alla famiglia Caliciviridae. I NoV attualmente vengono riconosciuti come una delle più importanti ... [more ▼]

I norovirus (NoV) sono piccoli virus (38-40 nm) a RNA monocatenario sprovvisti di envelope appartenenti alla famiglia Caliciviridae. I NoV attualmente vengono riconosciuti come una delle più importanti cause di gastroenterite acute di origine non batterica nell'uomo coinvolgendo tutte le classi di età e soprattutto contesti comunitari. I meccanismi molecolari che influenzano l'evoluzione dei NoV sono l'accumulo di mutazioni puntiformi e la ricombinazione. L’obiettivo sarà quello di dimostrare che la ricombinazione è un evento che può essere influenzabile dall’impiego di diversi parametri di coinfezione/superinfezione. In letteratura, gli studi sugli eventi ricombinanti che caratterizzano i NoV umani risultano piuttosto limitati a causa dell'assenza di un substrato cellulare che ne permetta la replicazione in vitro. Nel presente lavoro è stato sviluppato un modello sperimentale basato sull’impiego dell’unico NoV, il norovirus murino (MNV), in grado di replicare su substrato cellulare. A tal fine monostrati di cellule RAW264.7 sono stati coinfettati e superinfettati con due ceppi di MNV (CW1 e WU20) utilizzando diversi indici di molteplicità (MOI) e differenti tempi di infezione. I surnatanti sono stati collezionati a 24 e 48 ore post-infezione e quindi sottoposti a metodo delle placche. All’interno della popolazione virale risultante da tale coinfezione/superinfezione, 36 cloni per ciascuna condizione sono stati selezionati e purificati dalle placche e, successivamente, utilizzati per infettare nuovi monostrati cellulari di RAW264.7. Il monitoraggio degli eventi ricombinanti è stato eseguito mediante PCR e Real-Time PCR dopo estrazione dell'RNA virale e retrotrascrizione, impiegando due set di primer in grado di amplificare le regioni site all’estremità iniziale di ORF1 e all’estremità terminale di ORF3. I risultati che permetteranno di quantificare la distribuzione dei ceppi presenti nel surnatante della superinfezione, sono ancora in corso di analisi. [less ▲]

Detailed reference viewed: 29 (3 ULg)
Peer Reviewed
See detailETEROGENEITÀ GENETICA DI NOROVIRUS BOVINI IDENTIFICATI IN ITALIA
Di Felice, Eliabetta; Di Profio, Federica; Melegari, Irene et al

Poster (2014, June)

I norovirus (NoV) sono piccoli virus a RNA monocatenario appartenenti alla famiglia Caliciviridae. Sulla base dell’analisi di sequenza del gene ORF2 codificante per la proteina capsidica VP1, i NoV sono ... [more ▼]

I norovirus (NoV) sono piccoli virus a RNA monocatenario appartenenti alla famiglia Caliciviridae. Sulla base dell’analisi di sequenza del gene ORF2 codificante per la proteina capsidica VP1, i NoV sono attualmente classificati in sei genogruppi (G), con GI, GII e GIV responsabili di gastroenterite nell’uomo. Calicivirus enterici morfologicamente simili a NoV umani sono stati identificati per la prima volta in vitelli diarroici nel Regno Unito nel 1978 e in Germania nel 1980. Il sequenziamento nucleotidico dell’intero genoma ha permesso di classificare i NoV bovini (BoNoV) all’interno del genogruppo III in due genotipi, GIII.1 (prototipo Bo/Jena/80/DE) e GIII.2 (prototipo Bo/Newbury/76/UK). I BoNoV hanno una diffusione mondiale con una maggiore prevalenza di virus GIII.2-like. Tuttavia, studi recenti basati sull’analisi nucleotidica a livello della giunzione fra la polimerasi (RdRp) ed il capside, hanno dimostrato la circolazione di ceppi ricombinanti. Nel presente lavoro vengono riportati i risultati di un’indagine per la ricerca e tipizzazione di BoNoV condotta su quattro allevamenti bovini ubicati nelle province di Teramo e Pescara. A tal fine, 104 tamponi rettali collezionati da vitelli asintomatici sono stati sottoposti a nested RT-PCR impiegando due set di primer specifici per BoNoV in grado di amplificare un frammento di 326 bp della RdRp. L’RNA di BoNoV è stato identificato nel 10,5% (11/104) degli animali testati. L'analisi di sequenza ha evidenziato per nove sequenze un’elevata identità nucleotidica (nt) (88-96%) con i ceppi GIII.2-like, mentre per due è stata rilevata la maggiore identità (87-90% nt) con i BoNoV GIII.1-like. Per sette ceppi è stata ottenuta anche una sequenza di circa 750 bp che includeva oltre che la regione parziale della RdRp, la regione 5’ capsidica. Sulla base dell’analisi molecolare, cinque ceppi sono risultati strettamente correlati con BoNoV GIII.2-like, mentre solo uno dei due ceppi con polimerasi GIII.1-like, ha mostrato la maggiore identità nucleotidica nei confronti di BoNoV appartenenti al genotipo 1. Il ceppo 80/TE/IT che possedeva una polimerasi GIII.1-like, a livello capsidico ha mostrato la più alta identità con ceppi GIII.2-like, suggerendo un fenomeno di ricombinazione a livello della giunzione ORF1/ORF2. [less ▲]

Detailed reference viewed: 28 (0 ULg)