References of "Mauroy, Axel"
     in
Bookmark and Share    
Full Text
Peer Reviewed
See detailClinical pattern characterisation of cattle naturally infected by BTV-8 - Clinical characterisation of BTV-8 infected cattle
Zanella, G; Martinelle, Ludovic ULg; Guyot, Hugues ULg et al

in Transboundary and Emerging Diseases (in press)

Detailed reference viewed: 39 (12 ULg)
Full Text
Peer Reviewed
See detailMolecular epidemiology of norovirus infections in symptomatic and and asymptomatic children from Bobo Dioulasso, Burkina Faso
HUYNEN, Pascale ULg; Mauroy, Axel ULg; Martin, Caroline et al

in Journal of Clinical Virology (2013), 58

Background: Noroviruses (NoV) are a leading cause of gastroenteritis worldwide. Few epidemiologicaldata regarding the NoV strains circulating in African countries are available.Objectives: To determine ... [more ▼]

Background: Noroviruses (NoV) are a leading cause of gastroenteritis worldwide. Few epidemiologicaldata regarding the NoV strains circulating in African countries are available.Objectives: To determine the prevalence of NoV in Bobo Dioulasso (Burkina Faso) in both symptomaticand asymptomatic gastroenteritis patients.Study design: Patients both with and without gastro-intestinal disorders were selected. Clinical andepidemiological data, as well as stool samples, were collected through March to April 2011.NoV molecular detection (genogrouping and genotyping) and viral load quantification were also per-formed for all samples.Results: NoV were detected in 22.2% of the 418 collected stool samples (21.2% and 24.8% from the 293symptomatic patients (SP) and the 125 asymptomatic patients (ASP) respectively).Genogroup (G) distribution was 7.5%, 10.2% and 3.4% for GI, GII and both GI/GII respectively among SPand 12.0%, 11.2% and 1.6% for GI, GII and both GI/GII, respectively, among ASP.Average viral load values were higher in SP than in ASP for GI (p = 0.03) but not for GII.Phylogenic analysis showed a high degree of genotype diversity in SP and ASP. One recombinantGII.7/GII.6 sequence was, to the best of our knowledge, detected for the first time.Conclusions: This study enabled identification of the specific molecular epidemiology of NoV strains cir-culating in a representative country in Eastern Africa, and additionally showed that ASP could play animportant “reservoir” role. A high strain diversity was detected with a surprisingly high proportion ofNoV GI compared to the common genotypes usually reported in comparable epidemiological studies. [less ▲]

Detailed reference viewed: 21 (12 ULg)
Full Text
Peer Reviewed
See detailStudy of the virulence of serotypes 4 and 9 of African horse sickness virus in two mouse models
De la Grandière de Noronha Cotta, Maria Ana ULg; Zonta, William ULg; Mauroy, Axel ULg et al

Poster (2013, October)

African horse sickness (AHSV) is an infectious disease caused by a double stranded positive RNA virus which belongs to the family Reoviridae, genus Orbivirus. The virus has nine serotypes and is ... [more ▼]

African horse sickness (AHSV) is an infectious disease caused by a double stranded positive RNA virus which belongs to the family Reoviridae, genus Orbivirus. The virus has nine serotypes and is transmitted by a culicoides biting midge, principally Culicoides imicola. African horse sickness causes severe morbidity and mortality up to 95 % in horses with severe economic losses. The establishment of an experimental model is needed for the investigation of the pathogenesis of this infection. Two mouse models, interferon-α receptor knock-out mice (A129 KO or IFNAR -/-) and immunocompetent mice (A129 WT), were tested. The viruses used for mice inoculations belonged to the two serotypes which caused epidemics in Europe, serotypes 4 and 9. The virus was inoculated by subcutaneous (SC) route and/or by intra-nasal (IN) route. Whole blood samples were taken from each mouse at regular intervals. The organs (liver, spleen, kidney, lung and brain) were taken at the end of the experiment or when the most affected mice were euthanized. All these samples were tested by a qRT-PCR targeting AHSV genome segment 7. Both serotypes of AHSV were detected by qRT-PCR until three weeks post-infection in blood of IFNAR -/- mice and A129 WT mice infected by SC route. Serotype 4 shows a higher peak of viremia than serotype 9. The peak of viremia was measured between day 2 and day 4 post-infection. These results demonstrate the potential of the immunodeficient mouse model for both clinical and biological features. The setting up of this mouse model has developed a tool for efficient in vivo study to characterize the in vivo virulence of this virus, to monitor the evolution of viral populations during in vivo replication cycles and to test the competence or vectorial capacity of indigenous Culicoides. Research supported by the Belgium Federal Public Service, Health, Food Chain Safety and Environment. [less ▲]

Detailed reference viewed: 22 (5 ULg)
Full Text
Peer Reviewed
See detailStudy of the virulence of serotypes 4 and 9 of the Orbivirus African horse sickness virus in two mouse models
De la Grandière de Noronha Cotta, Maria Ana ULg; Zonta, William ULg; Mauroy, Axel ULg et al

Conference (2013, September 12)

African horse sickness (AHSV) is an infectious disease caused by a double stranded positive RNA virus which belongs to the family Reoviridae, genus Orbivirus. The virus has nine serotypes and is ... [more ▼]

African horse sickness (AHSV) is an infectious disease caused by a double stranded positive RNA virus which belongs to the family Reoviridae, genus Orbivirus. The virus has nine serotypes and is transmitted by a culicoides biting midge, principally Culicoides imicola. The establishment of an experimental model is needed for the investigation of the pathogenesis of this infection. Two mouse models, interferon-α receptor knock-out mice (A129 KO or IFNAR -/-) and immunocompetent mice (A129 WT), were tested. The viruses used for mice inoculations belonged to the two serotypes which caused epidemics in Europe, serotypes 4 and 9. The virus was inoculated by subcutaneous (SC) route and/or by intra-nasal (IN) route. Whole blood samples were taken from each mouse at regular intervals. The organs (liver, spleen, kidney, lung and brain) were taken at the end of the experiment or when the most affected mice were euthanized. All these samples were tested by a qRT-PCR targeting AHSV genome segment 7. Both serotypes of AHSV were detected by qRT-PCR until three weeks post-infection in blood of IFNAR -/- mice and A129 WT mice infected by SC route. Serotype 4 shows a higher peak of viremia than serotype 9. The peak of viremia was measured between day 2 and day 4 post-infection. These results demonstrate the potential of the immunodeficient mouse model for both clinical and biological features. The setting up of this mouse model has developed a tool for efficient in vivo study of AHSV. Research supported by the Belgium Federal Public Service, Health, Food Chain Safety and Environment. [less ▲]

Detailed reference viewed: 18 (3 ULg)
Full Text
Peer Reviewed
See detailEvaluation of a new rapid test for the detection of norovirus antigen in comparison with Real Time RT-PCR
HUYNEN, Pascale ULg; Mauroy, Axel ULg; Gérard, Catherine ULg et al

Poster (2013, September)

Diagnosis of NoV infection mainly relies on molecular methods. A detection of viral antigens can also be performed by immunochromatographic assays, and may be useful in outbreak settings. The aim of this ... [more ▼]

Diagnosis of NoV infection mainly relies on molecular methods. A detection of viral antigens can also be performed by immunochromatographic assays, and may be useful in outbreak settings. The aim of this study was to compare the performances of the new RDT ImmunoCardSTAT!®Norovirus (Meridian Bioscience®, Europe) with a real time RT-PCR. [less ▲]

Detailed reference viewed: 24 (7 ULg)
Full Text
Peer Reviewed
See detailNew norovirus classified as a recombinant GII.g/GII.1 causes an extended foodborne outbreak at a university hospital in Munich
Hoffman, Dieter; Mauroy, Axel ULg; Seebach, Judith et al

in Journal of Clinical Virology (2013), (58), 24-30

Detailed reference viewed: 6 (0 ULg)
Full Text
Peer Reviewed
See detailGenetic and evolutionary perspectives on genogroup III, genotype 2 bovine noroviruses
Mauroy, Axel ULg; Scipioni, Alexandra; Mathijs, Elisabeth et al

in Archives of Virology (2013)

Detailed reference viewed: 8 (2 ULg)
Full Text
Peer Reviewed
See detailMolecular epidemiology of norovirus in symptomatic and asymptomatic population in Burkina Faso
HUYNEN, Pascale ULg; Mauroy, Axel ULg; Martin, Caroline et al

Poster (2012, September)

Background Noroviruses (NoV), belonging to the family Caliciviridae, are now recognized as the leading cause of gastroenteritis outbreaks worldwide, and represent an important cause of sporadic ... [more ▼]

Background Noroviruses (NoV), belonging to the family Caliciviridae, are now recognized as the leading cause of gastroenteritis outbreaks worldwide, and represent an important cause of sporadic gastroenteritis in both children and adults. Many studies describe NoV epidemiology. However, few data are available about the NoV strains circulating in most of African countries, in particular in Burkina Faso. The population of Burkina Faso is characterized by the young age of its habitants, and most are living in rural environment. Objectives The purpose of this epidemiological study was to determine the prevalence of NoV in Bobo Dioulasso (Southern part of Burkina Faso) by molecular diagnosis methods in patients presenting or not gastroenteritis symptoms, to quantify the excreted viral load, and to genotype the circulating strains. Methods Patients with and without gastro-intestinal disorders were selected in several Health Care Centres of Bobo Dioulasso. Clinical and epidemiological data, as well as stool samples, were collected during 8 weeks through March to April 2011. Viral genomic RNA was automatically extracted with a Maxwell® (Promega) instrument. Molecular detection of genogroups (G) I, II and IV NoV in stool samples was performed by a home-made real-time RT-PCR targeting the ORF1-ORF2 polymerase junction region. For each positive sample, viral load was estimated by using standard curves (successive dilutions of recombinant GI and GII plasmids). Molecular characterization was performed on the detected strains, using both polymerase and capsid regions. Results NoV were detected in 21.6% of the 453 collected stool samples, with a distribution of 21.0% and 23.1% in the samples from the 319 symptomatic (SP) and the 134 asymptomatic patients (AP) respectively. Genogroup distribution was 7.2% for GI, 10.7% for GII and 3.1% for both GI and GII among SP’s samples, and was 11.2% for GI, 10.4% for GII and 1.5% for both GI and GII among AP’s samples. Average viral load values were higher for GI NoV in SP than in AP (p=0.02), when they were higher for GII NoV in AP than in SP (p=0.04). Phylogenic analysis showed a high degree of genotypical diversity in both groups of patients. One recombinant strain GII.7/GII.6 was also detected, to our knowledge, for the first time. Conclusion Even if a true pathogenic role of NoV could not be showed from the study design, it allowed to precise the molecular epidemiology of NoV strains prevalent in a representative country of the East African region. It also showed that asymptomatic patients could play an important role as a NoV “reservoir”. Despite the fact that GII strains, and more precisely those belonging to GII.4 genotype, are nowadays highly reported worldwide, the surprising proportion of NoV GI detected in this study suggests that GI and GII strains should be excreted in equal proportion in the environment. The origin of this epidemiologic difference, even if partially explained by the difference in immunity and genetic sensitivity of the population, is still to be solved. [less ▲]

Detailed reference viewed: 30 (3 ULg)
Full Text
Peer Reviewed
See detailTypage des souches de Norovirus circulant dans les populations symptomatiques et asymptomatiques au Burkina Faso
HUYNEN, Pascale ULg; Mauroy, Axel ULg; MARTIN, Caroline et al

Poster (2012)

Appartenant à la famille des Caliciviridae, genre Norovirus, les norovirus (NoV) sont des virus non enveloppés dont le génome est composé d’un ARN monocaténaire de polarité positive ... [more ▼]

Appartenant à la famille des Caliciviridae, genre Norovirus, les norovirus (NoV) sont des virus non enveloppés dont le génome est composé d’un ARN monocaténaire de polarité positive d’approximativement 7,5 kb. Les NoV infectent l’homme chez qui ils représentent au niveaumondial un agent majeur de gastroentérites épidémiques, d’origine souvent alimentaire mais aussi sporadique, et ce, toutes classes d'âges confondues. Les souches humaines sont classées génétiquement dans différents génotypes au sein de trois des cinq génogroupes, nommés (G) I, II et IV, composant le genre Norovirus. La voie de transmission des NoV est féco-orale. Les NoV sont très résistants dans l’environnement et la dose infectieuse est faible. Dans la population humaine, une grande diversité de souches appartenant principalement aux G I et II co-circulent. Parmi ces souches, le génotype Lordsdale (GII-4) est prédominant dans les épidémies actuelles, notamment lorsqu'une transmission de personne à personne est incriminée, alors que les souches du G I semblent plus fréquemment rapportées au cours des épidémies d’origine environnementale, comme celles liées à la consommation de fruits de mer. Si de nombreuses études d'épidémiologie moléculaire concernant ces virus ont été réalisées dans les pays industrialisés, les données sont par contre manquantes ou ténues pour bien des pays non industrialisés, et en particulier africains. Au cours d'une étude épidémiologique réalisée à Bobo Dioulasso au Burkina Faso et portant sur la prévalence des NoV dans les échantillons de selles de patients présentant ou non des symptômes de gastro-entérite, les souches détectées ont été quantifiées, leur génogroupe a été déterminé et pour certaines d'entre elles le génotype a été précisé. Quatre cent cinquante trois patients ont été prélevés, dont 319 présentant des symptômes diarrhéiques et 134 sujets témoins ne présentant pas de symptomatologie digestive. La détection des NoV et la quantification des charges virales excrétées ont été effectuées sur tous les échantillons par RT-PCR en temps réel permettant de discriminer les souches appartenant aux G I ou II. Une RT-PCR conventionnelle visant les régions de la polymérase (ORF1 du virus) ou de la capside (ORF2) a ensuite été réalisée sur une partie des échantillons détectés positifs en vue du séquençage de ces régions. Les relations phylogénétiques des souches circulant dans la population du Burkina Faso aux souches de référence ont aussi été inférées. Les résultats de RT-PCR en temps réel ont permis de mettre en évidence que les prévalences apparentes de l'infection par les NoV sont similaires dans les populations symptomatique et asymptomatique : une détection moléculaire de NoV chez 67 patients présentant de la diarrhée (21,0 %) et chez 31 des sujets témoins (23,1 %) a pu être observée. Les génotypes circulant détectés sont très variés dans les deux génogroupes, avec une proportion assez surprenante de NoV appartenant au G I. Université polytechnique de Bobo-Dioulasso, Institut supérieur des Sciences de la Santé (INSSA), Bobo-Dioulasso, Burkina Faso. Cette étude a permis de préciser l'épidémiologie moléculaire des souches de NoV circulant dans un pays représentatif de l'Afrique de l'Ouest. Elle a également montré que des individus asymptomatiques pourraient jouer un rôle assez important de réservoir du virus. Elle souligne enfin que, malgré le fait que les souches GII, et en particulier celles de génotype GII.4, soient à l'heure actuelle rapportées majoritairement au niveau mondial, les souches G I doivent être excrétées en égale proportion dans l'environnement. L'origine épidémiologique de la différence entre les prévalences apparentes des infections par les souches de GI et de GII, bien que partiellement expliquée par les différences de sensibilité génétique et d'immunité de population, reste donc à élucider. Remerciements: à la fondation A. Seghers, au Centre de Coopération au Développement de l'Université de Liège, à R. Boreux (assistance technique), aux membres du laboratoire du CMA de Dô et aux agents de santé de Bobo-Dioulasso (Burkina-Faso). [less ▲]

Detailed reference viewed: 28 (3 ULg)
Full Text
Peer Reviewed
See detailA Review of Known and Hypothetical Transmission Routes for Noroviruses
Mathijs, E.; Stals, A.; Baert, L. et al

in Food and Environmental Virology (2012), 4(4), 131-152

Human noroviruses (NoVs) are considered a worldwide leading cause of acute non-bacterial gastroenteritis. Due to a combination of prolonged shedding of high virus levels in feces, virus particle shedding ... [more ▼]

Human noroviruses (NoVs) are considered a worldwide leading cause of acute non-bacterial gastroenteritis. Due to a combination of prolonged shedding of high virus levels in feces, virus particle shedding during asymptomatic infections, and a high environmental persistence, NoVs are easily transmitted pathogens. Norovirus (NoV) outbreaks have often been reported and tend to affect a lot of people. NoV is spread via feces and vomit, but this NoV spread can occur through several transmission routes. While person-to-person transmission is without a doubt the dominant transmission route, human infective NoV outbreaks are often initiated by contaminated food or water. Zoonotic transmission of NoV has been investigated, but has thus far not been demonstrated. The presented review aims to give an overview of these NoV transmission routes. Regarding NoV person-to-person transmission, the NoV GII. 4 genotype is discussed in the current review as it has been very successful for several decades but reasons for its success have only recently been suggested. Both pre-harvest and post-harvest contamination of food products can lead to NoV food borne illness. Pre-harvest contamination of food products mainly occurs via contact with polluted irrigation water in case of fresh produce or with contaminated harvesting water in case of bivalve molluscan shellfish. On the other hand, an infected food handler is considered as a major cause of post-harvest contamination of food products. Both transmission routes are reviewed by a summary of described NoV food borne outbreaks between 2000 and 2010. A third NoV transmission route occurs via water and the spread of NoV via river water, ground water, and surface water is reviewed. Finally, although zoonotic transmission remains hypothetical, a summary on the bovine and porcine NoV presence observed in animals is given and the presence of human infective NoV in animals is discussed. © 2012 Springer Science+Business Media New York. [less ▲]

Detailed reference viewed: 27 (8 ULg)
Full Text
Peer Reviewed
See detailMolecular Detection and Genotyping of Noroviruses
Stals, A.; Mathijs, E.; Baert, L. et al

in Food and Environmental Virology (2012), 4(4), 153-167

Noroviruses (NoVs) are a major cause of gastroenteritis worldwide in humans and animals and are known as very infectious viral agents. They are spread through feces and vomit via several transmission ... [more ▼]

Noroviruses (NoVs) are a major cause of gastroenteritis worldwide in humans and animals and are known as very infectious viral agents. They are spread through feces and vomit via several transmission routes involving person-to-person contact, food, and water. Investigation of these transmission routes requires sensitive methods for detection of NoVs. As NoVs cannot be cultivated to date, detection of these viruses relies on the use of molecular methods such as (real-time) reverse transcriptase polymerase chain reaction (RT-PCR). Regardless of the matrix, detection of NoVs generally requires three subsequent steps: a virus extraction step, RNA purification, and molecular detection of the purified RNA, occasionally followed by molecular genotyping. The current review mainly focused on the molecular detection and genotyping of NoVs. The most conserved region in the genome of human infective NoVs is the ORF1/ORF2 junction and has been used as a preferred target region for molecular detection of NoVs by methods such as (real-time) RT-PCR, NASBA, and LAMP. In case of animal NoVs, broad range molecular assays have most frequently been applied for molecular detection. Regarding genotyping of NoVs, five regions situated in the polymerase and capsid genes have been used for conventional RT-PCR amplification and sequencing. As the expected levels of NoVs on food and in water are very low and inhibition of molecular methods can occur in these matrices, quality control including adequate positive and negative controls is an essential part of NoV detection. Although the development of molecular methods for NoV detection has certainly aided in the understanding of NoV transmission, it has also led to new problems such as the question whether low levels of human NoV detected on fresh produce and shellfish could pose a threat to public health. © 2012 Springer Science+Business Media New York. [less ▲]

Detailed reference viewed: 17 (4 ULg)
Full Text
Peer Reviewed
See detailComplete genome sequence of a novel bovine norovirus: Evidence for slow genetic evolution in genogroup III genotype 2 noroviruses
Mauroy, Axel ULg; Scipioni, A.; Mathijs, E. et al

in Journal of Virology (2012), 86(22), 12449-12450

A new genogroup III genotype 2 bovine norovirus, B309/2003/BE, was entirely sequenced and genetically compared to the original Newbury2/1976/UK strain and to Dumfries/1994/UK, detected in 1976 and 1994 ... [more ▼]

A new genogroup III genotype 2 bovine norovirus, B309/2003/BE, was entirely sequenced and genetically compared to the original Newbury2/1976/UK strain and to Dumfries/1994/UK, detected in 1976 and 1994, respectively. Interestingly, except in welldefined coding regions (N-terminal protein, 3A-like protease, hypervariable region of the capsid protein, and C-terminal part of the minor structural protein), very low genetic differences were noted between the entire genomes of these three strains along a 30-year-long period. It allowed some hypotheses of hotspots of genetic evolution through a low genetic evolution background in genotype 2 genogroup III bovine noroviruses. © 2012, American Society for Microbiology. [less ▲]

Detailed reference viewed: 15 (4 ULg)
Peer Reviewed
See detailProfils de liaison et mécanismes d’internalisation des norovirus bovins de génotype 2
Mauroy, Axel ULg; Gillet, Laurent; Mathijs, Elisabeth et al

Poster (2011, April)

Appartenant à la famille des Caliciviridae genre Norovirus, les norovirus (NoV) sont des virus non enveloppés dont le génome est composé d’un ARN monocaténaire de polarité positive d’approximativement 7,5 ... [more ▼]

Appartenant à la famille des Caliciviridae genre Norovirus, les norovirus (NoV) sont des virus non enveloppés dont le génome est composé d’un ARN monocaténaire de polarité positive d’approximativement 7,5 kb. Les NoV infectent l’homme et les animaux (bovins, porcins, murins). Chez l’homme, ils sont des agents majeurs de gastroentérite sporadique ou épidémique d’origine souvent alimentaire. Chez le bovin, ils causent également une entérite bénigne et les souches mises en cause sont classées génétiquement dans deux génotypes au sein du génogroupe III du genre Norovirus. La voie d’infection des NoV est oro-fécale, ils sont très résistants dans l’environnement et une infection peut survenir même avec une très faible dose infectieuse. Les NoV humains et animaux sont relativement proches génétiquement et coexistent parfois de manière très étroite en Europe du Nord. Il est donc logique d’envisager le risque zoonotique lié aux NoV animaux et plus particulièrement celui lié aux norovirus bovins (BoNoV). Différents systèmes d’expression protéique ont permis d’obtenir des pseudoparticules virales (VLPs) morphologiquement et antigéniquement semblables à certaines souches de NoV, difficilement cultivables en culture de cellules. Les objectifs du travail étaient d’étudier les types de structures pouvant être impliquées dans la liaison de BoNoVLP aux cellules, ainsi que les mécanismes entrant en jeu pour leur internalisation. Dans une première étude, des VLP d’une souche BoNoV obtenues précédemment ont permis d’investiguer le spectre de liaison des BoNoV de génotype 2 par immunofluorescence indirecte sur des cultures cellulaires bovines d’origines tissulaires différentes. Les VLP ont été capables de se fixer sur chacune des lignées testées tandis que la fluorescence diminuait d’intensité après traitement des cellules par le periodate de sodium. Au cours d’une deuxième étude, les structures permettant l’attachement des BoNoV de génotype 2 ont été investiguées quantitativement en cytométrie en flux avec les VLP. Parmi les enzymes et substances utilisées pour traiter les cellules, le periodate de sodium, l’α-galactosidase, la trypsine, la chymotrypsine et la phospholipase C ont très significativement diminué l’intensité du signal tandis que la neuraminidase a également permis de le réduire modérément. Les sulfates d’héparane ou de chondroïtine n’étaient par contre pas impliqués. Une troisième étude, toujours réalisée en cytométrie en flux, a permis d’évaluer les voies d’internalisation des VLP. Au cours de cette étude, il a été montré que les voies liées aux radeaux lipidiques et de la macropinocytose étaient impliquées. Les trois études menées ont permis de montrer que la structure impliquée dans la liaison des BoNoV de génotype 2 est un saccharide présent sur de nombreux types cellulaires bovins ; que cette structure comprend un résidu α-galactose ; qu’un résidu acide neuraminique peut être aussi impliqué dans cette liaison ou peut la faciliter ; que les sulfates d’héparane et de chondroïtine ne le sont pas ; que des voies alternatives peuvent être utilisées pour l’internalisation de la VLP. Les différents résultats peuvent être intégrés dans le profil de risque zoonotique associé aux BoNoV. [less ▲]

Detailed reference viewed: 7 (0 ULg)
Full Text
Peer Reviewed
See detailAlternative attachment factors and internalization pathways for GIII.2 bovine noroviruses.
Mauroy, Axel ULg; Gillet, Laurent ULg; Mathijs, Elisabeth ULg et al

in Journal of General Virology (The) (2011)

Bovine noroviruses belong to the family Caliciviridae, genus Norovirus. Two genotypes are described and viruses genetically related to the Jena and Newbury-2 strains are classified into genotypes 1 and 2 ... [more ▼]

Bovine noroviruses belong to the family Caliciviridae, genus Norovirus. Two genotypes are described and viruses genetically related to the Jena and Newbury-2 strains are classified into genotypes 1 and 2 respectively. In this study, virus-like particles (VLP) of the previously detected B309 Belgian strain, genetically related to genotype 2 bovine noroviruses, were used to investigate virus-host interactions in vitro. B309 VLP were shown to bind to several bovine cell lines. This binding was not affected by heparinase or chondroitinase treatment but was significantly inhibited by both sodium periodate, alpha-galactosidase, trypsin and phospholipase C treatment. Cell treatment by neuraminidase also moderately affected this binding. Taken together, these results show that, in addition to a galactosyl residue, sialic acid could also be involved in binding to susceptible cells. In addition, both the cholesterol-dependent pathway and macropinocytosis are used for B309 VLP internalisation by Madin-Darby Bovine Kidney cells. The data increase the knowledge on bovine norovirus cell interactions. [less ▲]

Detailed reference viewed: 29 (9 ULg)
Full Text
Peer Reviewed
See detailLes Norovirus : grands coupables méconnus de gastro-entérites
Mauroy, Axel ULg; HUYNEN, Pascale ULg; De Mol, Patrick ULg et al

in Revue de la Médecine Générale [=RMG] (2011), (285), 316-321

Recently, noroviruses emer- ged worldwide as a main and frequent cause of sporadic and epidemic gastroenteritis. The symptomatology they cause is usually benign. Their real impact lies on Public Health ... [more ▼]

Recently, noroviruses emer- ged worldwide as a main and frequent cause of sporadic and epidemic gastroenteritis. The symptomatology they cause is usually benign. Their real impact lies on Public Health and Food Safety levels. [less ▲]

Detailed reference viewed: 29 (2 ULg)
Full Text
Peer Reviewed
See detailVirus de la diahrée virale bovine : de la diversité à la singularité
Mauroy, Axel ULg; Thiry, Etienne ULg

in Point Vétérinaire (2011)

Detailed reference viewed: 13 (1 ULg)
Full Text
Peer Reviewed
See detailExperimental evidence of recombination in murine noroviruses
Mathijs, Elisabeth ULg; Muylkens, Benoît ULg; Mauroy, Axel ULg et al

in Journal of General Virology (The) (2010)

Detailed reference viewed: 19 (8 ULg)
Peer Reviewed
See detailMolecular detection of kobuviruses and recombinant noroviruses in cattle in continental europe
Mauroy, Axel ULg; Scipioni, Alexandra; Mathijs, Elisabeth et al

Poster (2009, August)

Introduction and Objectives Noroviruses (NoV) and Kobuviruses (KoV), belong to the family Caliciviridae genus Norovirus and to the family Picornaviridae genus Kobuvirus respectively. Both have a single ... [more ▼]

Introduction and Objectives Noroviruses (NoV) and Kobuviruses (KoV), belong to the family Caliciviridae genus Norovirus and to the family Picornaviridae genus Kobuvirus respectively. Both have a single stranded positive-sense RNA genome. They both infect the gastrointestinal tract of different animal species including human beings. Two NoV and one KoV prototype strains have been already identified in the bovine (Bo) species: Jena virus (JV) and Newbury 2 (NB2) for BoNoV; U1 for BoKoV. Genogroup (G) III gathers all BoNoV strains and is further subdivided into two genotypes where viruses genetically related to JV and NB2 are assigned to the genotype 1 and 2 respectively. Recombination is a common event in NoV and is usually reported near the overlapping region between open reading frame (ORF) 1 (end of the polymerase gene) and ORF2 (beginning of the single capsid protein gene). Two GIII.1/GIII.2 BoNoV recombinant strains have been described including the recombinant strain Bo/NoV/Thirsk10/00/UK (Thirsk10), identified in the year 2000 in Great Britain. To our knowledge, no other genetically related strains have been reported since [1]. Bovine KoV were detected by RT-PCR in stool samples of healthy calves from Japan, in samples from diarrhoeic calves from Thailand [2] and were also identified very recently in Hungary. Bovine NoV prevalence studies performed in different areas have shown the predominance of the GIII.2 genotype but this could reflect a GIII.1 specificity failure in the RT-PCR methods. The aim of this study was to screen cattle stool samples with two primer sets targeting the polymerase and the capsid region. The primer pair targeting the capsid region was designed based on a GIII.1 sequence in order to improve their detection. Materials and methods A stool bank (n=300) was created with calf and young stock diarrhoeic samples from five provinces in Belgium (Hainaut, Liège, Namur, Luxembourg, Walloon Brabant) and received from a Belgian diagnostic laboratory through the year 2008. Viral RNA extraction was performed and one step RT-PCR was carried out on 2 µl of each viral RNA extraction using the CBECu-F/R primers (nucleotidic position on JV: 4543-4565 and 5051-5074) and a primer pair, named AMG1-F/R, designed from the JV genomic sequence (F: tgtgggaaggtagtcgcgaca, nucleotidic position on JV: 5012-5032; R: cacatgggggaactgagtggc, 5462-5482). Combined approaches with the CBECu-F and AMG1-R primers, additional internal primers (F2: atgatgccagaggtttcca, position on JV: 4727-4745; R2: gcaaaaatccatgggtcaat, 5193-5211) or CBECu-F and a polyTVN-linker were also carried out on some positive samples. RT-PCR products were directly sequenced twice or cloned before sequencing. Sequencing was carried out at the GIGA facilities of the University of Liège with BigDye terminator kit. Nucleotidic sequences were analysed with the BioEdit software. Nucleotidic similarity with the NCBI genetic database was assessed using the BLAST tool. Phylogenetic inference was performed with the MEGA software. Phylogenetic tree was constructed by neighbour-joining analysis where evolutionary distances were computed using the Maximum Composite Likelihood method. The confidence values of the internal nodes were calculated by performing 1,000 replicate bootstrap values. Genetic recombination was analysed with the Simplot software and the Recombinant Detection Program. Results Twenty-eight positive samples were identified in the 300 samples: 24 and 23 BoNoV sequences with the CBECu and AMG1 primer pairs respectively, giving a combined apparent molecular prevalence of 9.33% (CI 95%: [9.27; 9.38%]). Using BLAST, three sequences amplified with CBECu-F/R (BV164, BV362, and BV416) were genetically more related to the GIII.1 JV and Aba Z5/02/HUN sequences and one (BV168) to the recombinant strain Thirsk10. The others were genetically related to GIII.2 BoNoV. All the sequences amplified with AMG1-F/R but one genetically matched with GIII.2 BoNoV. The AMG1-amplicon of the BV416 sample matched with the recombinant strain Thirsk10. A 2410 nucleotide (nt)-large genomic sequence was obtained from BV416 with CBECu-F/TVN linker, which was a recombinant sequence genetically related to the Thirsk10 strain. This result was confirmed by phylogenetic and by Simplot analysis. The potential recombination breakpoint of BV416 was located near or within the ORF1/ORF2 overlapping region depending on the bioinformatic program used. Comparison between its different genomic regions and the JV, Newbury2 and Thirsk10 genomic sequences showed that the polymerase region of BV416 was genetically more related to the GIII.1 than to the recombinant strain. F2/R2 amplicons from BV164 and BV362 were genetically related to GIII.2 and GIII.1 BoNoV respectively. Surprisingly, three amplicons obtained with the combined primer pair CBECu-F/AMG1-R on BoNoV positive samples at the expected molecular weight did not match genetically with BoNoV but did so with different genomic regions of the BoKoV U1 strain (86%, 92% and 93% of nucleotidic identity by BLAST for BV228, 250 and 253 respectively on sequences of about 500-700 nt). Discussion and conclusions In this study, very few genotype 1 BoNoV were identified (BV362 was the sole GIII.1 sequence obtained in the ORF1/2 overlapping region), confirming results reported in a previous study on BoNoV infection in the same area [3]. A recombinant status was clarified for BV416. Co-infection with GIII.1 and GIII.2 BoNoV was evidenced in the BV164 sample but could not be excluded in the BV168 sample because an overlapping sequence could not be obtained, although genetic analyses related its CBECu-F/R sequence to the Thirsk10 sequence. These results raise issues about the genetic characterization by primers targeting either the polymerase region or the capsid region. By exclusion of the potential recombination breakpoint, these primers can lead to the misclassification of strains and to the underestimation of circulation of recombinant strains. Multiple alignment and bioinformatic analysis performed with JV, Aba Z5, NB2, Thirk10 and BV416 sequences has suggested a recombination breakpoint for BV416 located near the ORF1/ORF2 overlapping region and one quite similar to those determined for the Thirsk10 strain. Nevertheless the greater similarity of BV416 with the Jena and Aba Z5 viruses in the polymerase region and the exact localization of the recombination breakpoint suggest another origin or genetic evolution than the Thirsk10 strain. The identification, in geographically and temporally different samples, of sequences that could be genetically related to the recombinant Thirsk10 strain suggests at least that Thirsk10-related strains circulate in the north European cattle population. Furthermore, the low detection rate of GIII.1 BoNoV could reflect an evolution of the viral population pattern to the benefit of the Thirsk10-related and genotype 2 strains in the studied region. To date, BoKoV-related sequences have been very rarely identified, and in only three countries (namely Japan, Thailand and Hungary). Their detection in another European country suggests their wider distribution, making them at least emerging bovine viruses in the studied region. In conclusion, prevalence studies on BoNoV using RT-PCR assays, even targeting relatively well conserved genomic regions, need to take into account in their protocols both their high genetic variability and their relative genetic proximity with other viruses, in order to maximize sensitivity and specificity. This study also showed that recombination events could lead to emerging strains in the BoNoV population, as already found for HuNoV. The molecular detection of bovine kobuvirus-related sequences in the studied area extends the distribution of these viruses in Europe. [less ▲]

Detailed reference viewed: 10 (0 ULg)