References of "Gabelica, Valérie"
Bookmark and Share    
Full Text
Peer Reviewed
See detailProteins in the gas phase
Meyer, Tim; Gabelica, Valérie ULg; Grubmüller, Helmut et al

in Wiley Interdisciplinary Reviews: Computational Molecular Science (in press)

Proteins are complex macromolecules that evolved over billions of years to be active in aqueous solution. Water is a key element that stabilizes their structure, and most structural studies on proteins ... [more ▼]

Proteins are complex macromolecules that evolved over billions of years to be active in aqueous solution. Water is a key element that stabilizes their structure, and most structural studies on proteins have thus been carried out in aqueous environment. However, recent experimental approaches have opened the possibility to gain structural information on proteins from gas-phase measurements. The obtained results revealed significant structural memory in proteins when transferred from water to the gas phase. However, after several years of experimental and theoretical research, the nature of the structural changes induced by vaporization, the exact characteristics of proteins in the gas phase, and the physicochemical forces stabilizing dehydrated proteins are still unclear. We will review here these issues using both experimental and theoretical sources of information. [less ▲]

Detailed reference viewed: 21 (9 ULg)
Full Text
Peer Reviewed
See detailFragmentation and isomerization due to field heating in traveling wave ion mobility
Morsa, Denis ULg; Gabelica, Valérie ULg; De Pauw, Edwin ULg

in Journal of the American Society for Mass Spectrometry (2014), 25(6), 1384-1393

During their travel inside a traveling wave ion mobility cell (TW IMS), ions are susceptible to heating because of the presence of high intensity electric fields. Here, we report effective temperatures T ... [more ▼]

During their travel inside a traveling wave ion mobility cell (TW IMS), ions are susceptible to heating because of the presence of high intensity electric fields. Here, we report effective temperatures T eff,vib obtained at the injection and inside the mobility cell of a SYNAPT G2 HDMS spectrometer for different probe ions: benzylpyridinium ions and leucine enkephalin. Using standard parameter sets, we obtained a temperature of ~800 K at injection and 728 ± 2 K into the IMS cell for p-methoxybenzylpyridinium. We found that T eff,vib inside the cell was dependent on the separation parameters and on the nature of the analyte. While the mean energy of the Boltzmann distributions increases with ion size, the corresponding temperature decreases because of increasing numbers of vibrational normal modes. We also investigated conformational rearrangements of 7+ ions of cytochrome c and reveal isomerization of the most compact structure, therefore highlighting the effects of weak heating on the gas-phase structure of biologically relevant ions. [less ▲]

Detailed reference viewed: 10 (4 ULg)
Full Text
Peer Reviewed
See detailUse of 1,5-diaminonaphthalene to combine matrix-assisted laser desorption/ionization in-source decay fragmentation with hydrogen/deuterium exchange
Lemaire, Pascale; Debois, Delphine ULg; Smargiasso, Nicolas ULg et al

in Rapid Communications in Mass Spectrometry [=RCM] (2013), 27(16), 1837-1846

In-Source Decay (ISD) in Matrix-Assisted Laser Desorption/Ionization (MALDI) mass spectrometry is a fast and easy top-down activation method. Our objective is to find a suitable matrix to locate the ... [more ▼]

In-Source Decay (ISD) in Matrix-Assisted Laser Desorption/Ionization (MALDI) mass spectrometry is a fast and easy top-down activation method. Our objective is to find a suitable matrix to locate the deuterons following in-solution hydrogen/deuterium exchange (HDX). This matrix must circumvent the commonly encountered undesired back-exchange reactions, in order to preserve the regioselective deuteration pattern. The 1,5-diaminonaphthalene (1,5-DAN) matrix is known to be suitable for MALDI-ISD fragmentation. MALDI Mass Spectrometry Imaging (MSI) was employed to compare 1,5-DAN and other commonly used MALDI matrices with respect to the extent of back-exchange and the uniformity of the H/D exchange profiles within the MALDI spots. We tested the back-exchange on the highly sensitive amyloid-beta peptide (1-40), and proved the regioselectivity on ubiquitin and b-endorphin. MALDI-MSI results show that 1,5-DAN leads to the least back-exchange over all the spot. MALDI-ISD fragmentation combined with H/D exchange using 1,5-DAN matrix was validated by localizing deuterons in native ubiquitin. Results agree with previous data obtained by Nuclear Magnetic Resonance (NMR) and Electron Transfer Dissociation (ETD). Moreover, 1,5-DAN matrix was used to study the H/D exchange profile of the methanol-induced helical structure of b-endorphin, and the relative protection can be explained by the polarity of residues involved in hydrogen bond formation. We found that controlling crystallization is the most important parameter when combining H/D exchange with MALDI. The 1,5-DAN matrix is characterized by a fast crystallization kinetics, and therefore gives robust and reliable H/D exchange profiles using MALDI-ISD. [less ▲]

Detailed reference viewed: 21 (3 ULg)
Full Text
Peer Reviewed
See detailStructural Determinants of Specificity and Catalytic Mechanism in mammalian 25-kDa Thiamine Triphosphatase
Delvaux, David; Kerff, Frédéric ULg; Murty, Mamidanna R.V.S. et al

in Biochimica et Biophysica Acta - General Subjects (2013), 1830

Background: Thiamine triphosphate (ThTP) is present in most organisms and might be involved in intracellular signaling. In mammalian cells, the cytosolic ThTP level is controlled by a specific thiamine ... [more ▼]

Background: Thiamine triphosphate (ThTP) is present in most organisms and might be involved in intracellular signaling. In mammalian cells, the cytosolic ThTP level is controlled by a specific thiamine triphosphatase (ThTPase), belonging to the CYTH superfamily of proteins. CYTH proteins are present in all superkingdoms of life and act on various triphosphorylated substrates. Methods: Using crystallography, mass spectrometry and mutational analysis, we identified the key structural determinants of the high specificity and catalytic efficiency of mammalian ThTPase. Results: Triphosphate binding requires three conserved arginines while the catalytic mechanism relies on an unusual lysine-tyrosine dyad. By docking of the ThTP molecule in the active site, we found that Trp-53 should interact with the thiazole part of the substrate molecule, thus playing a key role in substrate recognition and specificity. Sea anemone and zebrafish CYTH proteins, which retain the corresponding Trp residue, are also specific ThTPases. Surprisingly, the whole chromosome region containing the ThTPase gene is lost in birds. Conclusion: The specificity for ThTP is linked to a stacking interaction between the thiazole heterocycle of thiamine and a tryptophan residue. The latter likely plays a key role in the secondary acquisition of ThTPase activity in early metazoan CYTH enzymes, in the lineage leading from cnidarians to mammals. General significance: We show that ThTPase activity is not restricted to mammals as previously thought but is an acquisition of early metazoans. This, and the identification of critically important residues, allows us to draw an evolutionary perspective of the CYTH family of proteins. [less ▲]

Detailed reference viewed: 65 (27 ULg)
Full Text
Peer Reviewed
See detailUV Spectroscopy of DNA Duplex and Quadruplex Structures in the Gas Phase
Rosu, Frédéric ULg; Gabelica, Valérie ULg; De Pauw, Edwin ULg et al

in Journal of Physical Chemistry A (2012), 116

UV absorption spectroscopy is one of the most widely used methods to monitor nucleic acid folding in solution, but the absorption readout is the weighted average contribution of all species present in ... [more ▼]

UV absorption spectroscopy is one of the most widely used methods to monitor nucleic acid folding in solution, but the absorption readout is the weighted average contribution of all species present in solution. Mass spectrometry, on the other hand, is able to separate constituents of the solution based on their mass, but methods to probe the structure of each constituent are needed. Here, we explored whether gas-phase UV spectroscopy can give an indication of DNA folding in ions isolated by electrospray mass spectrometry. Model DNA single strands, duplexes, and G-quadruplexes were extracted from solution by electrospray; the anions were stored in a quadrupole ion trap and irradiated by a tunable laser to obtain the UV action spectra of each complex. We found that the duplex and quadruplex spectra are significantly different from the spectra of single strands, thereby suggesting that electronic spectroscopy can be used to probe the DNA gas-phase structure and obtain information about the intrinsic properties of high-order DNA structure. [less ▲]

Detailed reference viewed: 28 (8 ULg)
Full Text
Peer Reviewed
See detailMass spectrometry and ion mobility spectrometry of G-quadruplexes. A study of solvent effects on dimer formation and structural transitions in the telomeric DNA sequence d(TAGGGTTAGGGT).
Ferreira, Ruben; Marchand, Adrien; Gabelica, Valérie ULg

in Methods (2012), 57(1), 56-63

We survey here state of the art mass spectrometry methodologies for investigating G-quadruplexes, and will illustrate them with a new study on a simple model system: the dimeric G-quadruplex of the 12-mer ... [more ▼]

We survey here state of the art mass spectrometry methodologies for investigating G-quadruplexes, and will illustrate them with a new study on a simple model system: the dimeric G-quadruplex of the 12-mer telomeric DNA sequence d(TAGGGTTAGGGT), which can adopt either a parallel or an antiparallel structure. We will discuss the solution conditions compatible with electrospray ionisation, the quantification of complexes using ESI-MS, the interpretation of ammonium ion preservation in the complexes in the gas phase, and the use of ion mobility spectrometry to resolve ambiguities regarding the strand stoichiometry, or separate and characterise different structural isomers. We also describe that adding electrospray-compatible organic co-solvents (methanol, ethanol, isopropanol or acetonitrile) to aqueous ammonium acetate increases the stability and rate of formation of dimeric G-quadruplexes, and causes structural transitions to parallel structures. Structural changes were probed by circular dichroism and ion mobility spectrometry, and the excellent correlation between the two techniques validates the use of ion mobility to investigate G-quadruplex folding. We also demonstrate that parallel G-quadruplex structures are easier to preserve in the gas phase than antiparallel structures. [less ▲]

Detailed reference viewed: 35 (3 ULg)
Full Text
Peer Reviewed
See detailState-of-the-art methodologies for the discovery and characterization of DNA G-quadruplex binders.
Pagano, Bruno; Cosconati, Sandro; Gabelica, Valérie ULg et al

in Current Pharmaceutical Design (2012), 18(14), 1880-99

Nowadays, the molecular basis of interaction between low molecular weight compounds and biological macromolecules is the subject of numerous investigations aimed at the rational design of molecules with ... [more ▼]

Nowadays, the molecular basis of interaction between low molecular weight compounds and biological macromolecules is the subject of numerous investigations aimed at the rational design of molecules with specific therapeutic applications. In the last decades, it has been demonstrated that DNA quadruplexes play a critical role in several biological processes both at telomeric and gene promoting levels thus providing a great stride in the discovery of ligands able to interact with such a biologically relevant DNA conformation. So far, a number of experimental and computational approaches have been successfully employed in order to identify new ligands and to characterize their binding to the DNA. The main focus of this review is the description of these methodologies, placing a particular emphasis on computational methods, isothermal titration calorimetry (ITC), mass spectrometry (MS), nuclear magnetic resonance (NMR), circular dichroism (CD) and fluorescence spectroscopies. [less ▲]

Detailed reference viewed: 16 (4 ULg)
Full Text
Peer Reviewed
See detailStructure of triplex DNA in the gas phase.
Arcella, Annalisa; Portella, Guillem; Ruiz, Maria Luz et al

in Journal of the American Chemical Society (2012), 134(15), 6596-606

Extensive (more than 90 microseconds) molecular dynamics simulations complemented with ion-mobility mass spectrometry experiments have been used to characterize the conformational ensemble of DNA ... [more ▼]

Extensive (more than 90 microseconds) molecular dynamics simulations complemented with ion-mobility mass spectrometry experiments have been used to characterize the conformational ensemble of DNA triplexes in the gas phase. Our results suggest that the ensemble of DNA triplex structures in the gas phase is well-defined over the experimental time scale, with the three strands tightly bound, and for the most abundant charge states it samples conformations only slightly more compact than the solution structure. The degree of structural alteration is however very significant, mimicking that found in duplex and much larger than that suggested for G-quadruplexes. Our data strongly supports that the gas phase triplex maintains an excellent memory of the solution structure, well-preserved helicity, and a significant number of native contacts. Once again, a linear, flexible, and charged polymer as DNA surprises us for its ability to retain three-dimensional structure in the absence of solvent. Results argue against the generally assumed roles of the different physical interactions (solvent screening of phosphate repulsion, hydrophobic effect, and solvation of accessible polar groups) in modulating the stability of DNA structures. [less ▲]

Detailed reference viewed: 24 (5 ULg)
Full Text
Peer Reviewed
See detaild(TG(n)T) DNA sequences do not necessarily form tetramolecular G-quadruplexes.
Joly, Laure; Rosu, Frédéric ULg; Gabelica, Valérie ULg

in Chemical Communications (2012), 48(67), 8386-8

Contrasting with the common belief that d(TG(n)T) DNA sequences would form tetramolecular G-quadruplex assemblies, mass spectrometry reveals that these sequences tend to fold into G-quadruplex trimers ... [more ▼]

Contrasting with the common belief that d(TG(n)T) DNA sequences would form tetramolecular G-quadruplex assemblies, mass spectrometry reveals that these sequences tend to fold into G-quadruplex trimers, dimers, and eventually monomers as the G-tract length increases. The final structure also depends on the ionic strength. [less ▲]

Detailed reference viewed: 33 (5 ULg)
Full Text
Peer Reviewed
See detailA specific inorganic triphosphatase from Nitrosomonas europaea: structure and catalytic mechanism
Delvaux, David ULg; Murty, Mamidana R.V.S; Gabelica, Valérie ULg et al

in Journal of Biological Chemistry (2011), 286

The CYTH superfamily of proteins is named after its two founding members, the CyaB adenylyl cyclase from Aeromonas hydrophila and the human 25-kDa thiamine triphosphatase. Because these proteins often ... [more ▼]

The CYTH superfamily of proteins is named after its two founding members, the CyaB adenylyl cyclase from Aeromonas hydrophila and the human 25-kDa thiamine triphosphatase. Because these proteins often form a closed β-barrel, they are also referred to as “Triphosphate Tunnel Metalloenzymes” (TTM). Functionally, they are characterized by their ability to bind triphosphorylated substrates and divalent metal ions. These proteins exist in most organisms and catalyze different reactions, depending on their origin. Here we investigate structural and catalytic properties of the recombinant TTM protein from Nitrosomonas europaea (NeuTTM), a 19-kDa protein. Crystallographic data show that it crystallizes as a dimer and that, in contrast to other TTM proteins, it has an open β-barrel structure. We demonstrate that NeuTTM is a highly specific inorganic triphosphatase, hydrolyzing tripolyphosphate (PPPi) with high catalytic efficiency in the presence of Mg2+. These data are supported by native mass spectrometry analysis showing that the enzyme binds PPPi (and Mg-PPPi) with high affinity (Kd < 1.5 μM), while it has a low affinity for ATP or thiamine triphosphate. In contrast to Aeromonas and Yersinia CyaB proteins, NeuTTM has no adenylyl cyclase activity, but it shares several properties with other enzymes of the CYTH superfamily, e.g. heat-stability, alkaline pH optimum and inhibition by Ca2+ and Zn2+ ions. We suggest a catalytic mechanism involving a catalytic dyad formed by K52 and Y28. The present data provide the first characterization of a new type of phosphohydrolase (unrelated to pyrophosphatases or exopolyphosphatases), able to hydrolyze inorganic triphosphate with high specificity. [less ▲]

Detailed reference viewed: 74 (27 ULg)
Full Text
Peer Reviewed
See detailTridentate N-Donor Palladium(II) Complexes as Efficient Coordinating Quadruplex DNA Binders
Largy, Eric; Hamon, Florian; Rosu, Frédéric ULg et al

in Chemistry : A European Journal (2011), 17(47), 13274-13283

Fifteen complexes of palladium, platinum, and copper, featuring five different N-donor tridentate (terpyridine-like) ligands, were prepared with the aim of testing their G-quadruplexDNA binding properties ... [more ▼]

Fifteen complexes of palladium, platinum, and copper, featuring five different N-donor tridentate (terpyridine-like) ligands, were prepared with the aim of testing their G-quadruplexDNA binding properties. The fluorescence resonance energy transfer melting assay indicated a striking positive effect of palladium on G-quadruplex DNA stabilization compared with platinum and copper, as well as an influence of the structure of the organic ligand. Putative binding modes (noncoordinative p stacking and base coordination) of palladium and platinum complexes were investigated by ESI-MS and UV/Vis spectroscopy experiments, which all revealed a greater ability of palladium complexes to coordinate DNA bases. In contrast, platinum compounds tend to predominantly bind to quadruplex DNA in their aqua form by noncoordinative interactions. Remarkably, complexes of [Pd(ttpy)] and [Pd(tMebip)] (ttpy=tolylterpyridine, tMebip=2,2'-(4-p-tolylpyridine-2,6-diyl)bis(1-methyl-1H-benzo[d]imidazole)) coordinate efficiently G-quadruplex structures at room temperature in less than 1 h, and are more efficient than their platinum counterparts for inhibiting the growth of cancer cells. Altogether, these results demonstrate that both the affinity for G-quadruplex DNA and the binding mode of metal complexes can be modulated by modifying either the metal or the organic ligand. [less ▲]

Detailed reference viewed: 14 (1 ULg)
Full Text
Peer Reviewed
See detailEffective temperature of ions in traveling wave ion mobility spectrometry
Morsa, Denis ULg; Gabelica, Valérie ULg; De Pauw, Edwin ULg

in Analytical Chemistry (2011), 83(14), 5775-5782

Traveling wave ion mobility spectrometers (TW IMS) operate at significantly higher fields than drift tube ion mobility spectrometers. Here we measured the fragmentation of the fragile p ... [more ▼]

Traveling wave ion mobility spectrometers (TW IMS) operate at significantly higher fields than drift tube ion mobility spectrometers. Here we measured the fragmentation of the fragile p-methoxybenzylpyridinium ion inside the TW ion mobility cell of the first-generation SYNAPT HDMS spectrometer. The ion’s vibrational internal energy was quantified by a vibrational effective temperature Teff,vib, which is the mean temperature of the ions inside the cell that would result in the same fragmentation yield as observed experimentally. Significant fragmentation of the probe ion inside the TW IMS cell was detected, indicating that field heating of the ions takes place in TW IMS. For typical small molecule IMS conditions, Teff,vib = 555 ± 2 K. The variations of the effective temperature were studied as a function of the IMS parameters, and we found that Teff,vib decreases when the wave height decreases, when the pressure increases, or when the wave speed increases. The energy transfer efficiency of argon is higher than for He, N2 or CO2. Teff,vib being directly related to the ion speed inside the TW IMS, our results also provide new insight on the ion movement in TW IMS. We also discuss the influence of field heating of ions for calibration and structural studies in TW IMS. [less ▲]

Detailed reference viewed: 40 (22 ULg)
Full Text
Peer Reviewed
See detaild(CGGTGGT) forms an octameric parallel G-quadruplex via stacking of unusual G(:C):G(:C):G(:C):G(:C) octads
Borbone, Nicola; Amato, Jussara; Oliviero, Giorgia et al

in Nucleic Acids Research (2011)

Among non-canonical DNA secondary structures, G-quadruplexes are currently widely studied because of their probable involvement in many pivotal biological roles, and for their potential use in ... [more ▼]

Among non-canonical DNA secondary structures, G-quadruplexes are currently widely studied because of their probable involvement in many pivotal biological roles, and for their potential use in nanotechnology. The overall quadruplex scaffold can exhibit several morphologies through intramolecular or intermolecular organization of G-rich oligodeoxyribonucleic acid strands. In particular, several G-rich strands can form higher order assemblies by multimerization between several G-quadruplex units. Here, we report on the identification of a novel dimerization pathway. Our Nuclear magnetic resonance, circular dichroism, UV, gel electrophoresis and mass spectrometry studies on the DNA sequence dCGGTGGT demonstrate that this sequence forms an octamer when annealed in presence of K+ or NH4+ ions, through the 5′-5′ stacking of two tetramolecular G-quadruplex subunits via unusual G(:C):G(:C):G(:C):G(:C) octads. [less ▲]

Detailed reference viewed: 27 (5 ULg)
Full Text
Peer Reviewed
See detailTargeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences
Amato, Jussara; Pagano, Bruno; Borbone, Nicola et al

in Bioconjugate Chemistry (2011), 22

The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of ... [more ▼]

The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K+- or NH4+-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1 P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In Kþ buffer, P1-P4 bind the ckit87up quadruplex structure as “quadruplex-binding agents”. The same holds for P1 in NH4þ solution. On the contrary, in NH4þ solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as “quadruplex openers”. [less ▲]

Detailed reference viewed: 27 (6 ULg)