Internal energy of ions in traveling wave ion mobility spectrometry : comparison between Synapt G1 and Synapt G2

Poster (2012, May)

Internal energy of ions inside ion mobility mass spectrometers

Conference (2012, April)

IR and UV spectroscopy of DNA Higher-Order Structures in the gas phase

Conference (2012, January 22)

Structure of triplex DNA in the gas phase.

in Journal of the American Chemical Society (2012), 134(15), 6596-606

Extensive (more than 90 microseconds) molecular dynamics simulations complemented with ion-mobility mass spectrometry experiments have been used to characterize the conformational ensemble of DNA ... [more ▼]

Extensive (more than 90 microseconds) molecular dynamics simulations complemented with ion-mobility mass spectrometry experiments have been used to characterize the conformational ensemble of DNA triplexes in the gas phase. Our results suggest that the ensemble of DNA triplex structures in the gas phase is well-defined over the experimental time scale, with the three strands tightly bound, and for the most abundant charge states it samples conformations only slightly more compact than the solution structure. The degree of structural alteration is however very significant, mimicking that found in duplex and much larger than that suggested for G-quadruplexes. Our data strongly supports that the gas phase triplex maintains an excellent memory of the solution structure, well-preserved helicity, and a significant number of native contacts. Once again, a linear, flexible, and charged polymer as DNA surprises us for its ability to retain three-dimensional structure in the absence of solvent. Results argue against the generally assumed roles of the different physical interactions (solvent screening of phosphate repulsion, hydrophobic effect, and solvation of accessible polar groups) in modulating the stability of DNA structures. [less ▲]

Ion heating in travelling-wave based ion mobility spectrometer

Poster (2011, August 01)

A specific inorganic triphosphatase from Nitrosomonas europaea: structure and catalytic mechanism

in Journal of Biological Chemistry (2011), 286

The CYTH superfamily of proteins is named after its two founding members, the CyaB adenylyl cyclase from Aeromonas hydrophila and the human 25-kDa thiamine triphosphatase. Because these proteins often ... [more ▼]

The CYTH superfamily of proteins is named after its two founding members, the CyaB adenylyl cyclase from Aeromonas hydrophila and the human 25-kDa thiamine triphosphatase. Because these proteins often form a closed β-barrel, they are also referred to as “Triphosphate Tunnel Metalloenzymes” (TTM). Functionally, they are characterized by their ability to bind triphosphorylated substrates and divalent metal ions. These proteins exist in most organisms and catalyze different reactions, depending on their origin. Here we investigate structural and catalytic properties of the recombinant TTM protein from Nitrosomonas europaea (NeuTTM), a 19-kDa protein. Crystallographic data show that it crystallizes as a dimer and that, in contrast to other TTM proteins, it has an open β-barrel structure. We demonstrate that NeuTTM is a highly specific inorganic triphosphatase, hydrolyzing tripolyphosphate (PPPi) with high catalytic efficiency in the presence of Mg2+. These data are supported by native mass spectrometry analysis showing that the enzyme binds PPPi (and Mg-PPPi) with high affinity (Kd < 1.5 μM), while it has a low affinity for ATP or thiamine triphosphate. In contrast to Aeromonas and Yersinia CyaB proteins, NeuTTM has no adenylyl cyclase activity, but it shares several properties with other enzymes of the CYTH superfamily, e.g. heat-stability, alkaline pH optimum and inhibition by Ca2+ and Zn2+ ions. We suggest a catalytic mechanism involving a catalytic dyad formed by K52 and Y28. The present data provide the first characterization of a new type of phosphohydrolase (unrelated to pyrophosphatases or exopolyphosphatases), able to hydrolyze inorganic triphosphate with high specificity. [less ▲]

Effective temperature of ions in traveling wave ion mobility spectrometry

in Analytical Chemistry (2011), 83(14), 5775-5782

Traveling wave ion mobility spectrometers (TW IMS) operate at significantly higher fields than drift tube ion mobility spectrometers. Here we measured the fragmentation of the fragile p ... [more ▼]

Traveling wave ion mobility spectrometers (TW IMS) operate at significantly higher fields than drift tube ion mobility spectrometers. Here we measured the fragmentation of the fragile p-methoxybenzylpyridinium ion inside the TW ion mobility cell of the first-generation SYNAPT HDMS spectrometer. The ion’s vibrational internal energy was quantified by a vibrational effective temperature Teff,vib, which is the mean temperature of the ions inside the cell that would result in the same fragmentation yield as observed experimentally. Significant fragmentation of the probe ion inside the TW IMS cell was detected, indicating that field heating of the ions takes place in TW IMS. For typical small molecule IMS conditions, Teff,vib = 555 ± 2 K. The variations of the effective temperature were studied as a function of the IMS parameters, and we found that Teff,vib decreases when the wave height decreases, when the pressure increases, or when the wave speed increases. The energy transfer efficiency of argon is higher than for He, N2 or CO2. Teff,vib being directly related to the ion speed inside the TW IMS, our results also provide new insight on the ion movement in TW IMS. We also discuss the influence of field heating of ions for calibration and structural studies in TW IMS. [less ▲]

Targeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences

in Bioconjugate Chemistry (2011), 22

The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of ... [more ▼]

The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K+- or NH4+-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1 P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In Kþ buffer, P1-P4 bind the ckit87up quadruplex structure as “quadruplex-binding agents”. The same holds for P1 in NH4þ solution. On the contrary, in NH4þ solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as “quadruplex openers”. [less ▲]

Mass spectrometry of G-quadruplexes

Conference (2010, May 31)

Tetramolecular G-quadruplex formation pathways studied by electrospray mass spectrometry

in Nucleic Acids Research (2010)

Electrospray mass spectrometry was used to investigate the mechanism of tetramolecular G-quadruplex formation by the DNA oligonucleotide dTG5T, in ammonium acetate. The intermediates and products were ... [more ▼]

Electrospray mass spectrometry was used to investigate the mechanism of tetramolecular G-quadruplex formation by the DNA oligonucleotide dTG5T, in ammonium acetate. The intermediates and products were separated according to their mass (number of strands and inner cations) and quantified. The study of the temporal evolution of each species allows us to propose the following formation mechanism. (i) Monomers, dimers and trimers are present at equilibrium already in the absence of ammonium acetate. (ii) The addition of cations promotes the formation of tetramers and pentamers that incorporate ammonium ions and therefore presumably have stacked guanine quartets in their structure. (iii) The pentamers eventually disappear and tetramers become predominant. However, these tetramers do not have their four strands perfectly aligned to give five G-quartets: the structures contain one ammonium ion too few, and ion mobility spectrometry shows that their conformation is more extended. (iv) At 4°C, the rearrangement of the kinetically trapped tetramers with presumably slipped strand(s) into the perfect G-quadruplex structure is extremely slow (not complete after 4 months). We also show that the addition of methanol to the monomer solution significantly accelerates the cation-induced G-quadruplex assembly. [less ▲]