References of "De Pauw, Edwin"
     in
Bookmark and Share    
Full Text
Peer Reviewed
See detailLevels and trends of PCDD/Fs and PCBs in camel milk (Camelus bactrianus and Camelus dromedarius) from Kazakhstan
Konuspayeva, Gaukhar; Faye, Bernard; De Pauw, Edwin ULg et al

in Chemosphere (2011), 85

To date, despite the fact it represents a very important part of the national dairy production, no data are available concerning the concentrations of polychlorinated dibenzo-p-dioxins (PCDDs ... [more ▼]

To date, despite the fact it represents a very important part of the national dairy production, no data are available concerning the concentrations of polychlorinated dibenzo-p-dioxins (PCDDs), polychlorinated dibenzofurans (PCDFs), and polychlorinated biphenyls (PCBs) in camel milk from the Republic of Kazakhstan. Selected PCDDs, PCDFs, and PCBs were measured in pools of milk from camels (n = 15) located in various places of Kazakhstan (Almaty, Atyrau, Aralsk, Shymkent) and sampled at two different seasons for two different species (Camelus bactrianus and Camelus dromedarius). Non-dioxin-like (NDL- )PCB concentrations (6.3 ± 2.7 ng gÿ1 fat, median 5.1 ng gÿ1 fat, range 0.6–17.4 ng gÿ1 fat) were far below the maximum value of 40 ng gÿ1 fat proposed by the EU. Dioxin-like (DL-)PCB concentrations (1.7 ± 0.7 ng gÿ1 fat, median 1.5 ng gÿ1 fat, range 0.3–4.2 ng gÿ1 fat) and the NDL-PCB to DL-PCB ratio (4.3) were similar to what is reported in EU for cow-based dairy products. PCB 52 and PCB 101 appeared to be proportionally more present in Kazakh camel milk samples (>60% of the sum of the 6 indicator NDL-PCBs) than in European cow milk samples (<10% of the sum of the 6 indicator NDL-PCBs), indicating possible differences in the route of exposure to PCBs in Kazakhstan. PCB 105 and PCB 118 appeared to be present at higher concentrations in camel milk (>80% of the sum of the 12 DL-PCBs). PCB 105, PCB 118 and PCB 156 were the major congeners for DL-PCBs, accounting for 92% of the sum of concentrations of DL-PCBs (88% for Belgian cows). In terms of TEQ, PCB 126 and PCB 118 are the major contributors and represent, respectively, 80% and 14% of the DL-PCB TEQWHO05 concentrations. No significant interracial or geographical trends were observed for NDL- and DL-PCB profiles. However, concentrations of all DL-PCBs appeared to be significantly higher for samples collected in Atyrau region. 2,3,7,8-TCDD level (mean 0.08 ± 0.07 pg gÿ1 fat, median 0.08 pg gÿ1 fat, range 0.00–0.18 pg gÿ1 fat, 60% > LOQs) were very low for all samples and 2,3,4,7,8-PeCDF was the major contributor (27%) to the PCDD/F TEQWHO05. Considering the total TEQWHO05 (sum of DL-PCBs and PCDD/Fs), DL-PCB and PCDD/F contributed for 73% and 27%, respectively. A decrease of only 1% of the total TEQ was observed when using the TEFWHO05 scale instead of the TEFWHO98 scale. Two samples collected in the region of Atyrau exceeded the EU maximum level value of 6.00 pg TEQWHO98 gÿ1 fat (6.4 pg TEQWHO05 gÿ1 fat and 6.9 pg TEQWHO05 gÿ1 fat). Both samples exceeded the EU action level for the sum of DL-PCBs. Based on the fact that camel milk is used to prepare popular traditional fermented drinks like shubat, this suggests that the human exposure in the Caspian Sea region of Atyrau should be expected to be higher than in the other regions studied here. [less ▲]

Detailed reference viewed: 23 (3 ULg)
Full Text
Peer Reviewed
See detailFibulin-3 fragments (FIB3-1 and FIB3-2) are potential new biomarkers for the diagnosis of osteoarthritis
Gharbi, M; Dubuc, JE; Deberg, M et al

in Annals of the Rheumatic Diseases (2011), 70(Suppl 3), 354

Detailed reference viewed: 23 (0 ULg)
Full Text
Peer Reviewed
See detailIdentification of stromal proteins overexpressed in nodular sclerosis Hodgkin lymphoma.
Kischel, Philippe; Waltregny, David ULg; Greffe, Yannick et al

in Proteome Science (2011), 9(1), 63

ABSTRACT: Hodgkin lymphoma (HL) represents a category of lymphoid neoplasms with unique features, notably the usual scarcity of tumour cells in involved tissues. The most common subtype of classical HL ... [more ▼]

ABSTRACT: Hodgkin lymphoma (HL) represents a category of lymphoid neoplasms with unique features, notably the usual scarcity of tumour cells in involved tissues. The most common subtype of classical HL, nodular sclerosis HL, characteristically comprises abundant fibrous tissue stroma. Little information is available about the protein composition of the stromal environment from HL. Moreover, the identification of valid protein targets, specifically and abundantly expressed in HL, would be of utmost importance for targeted therapies and imaging, yet the biomarkers must necessarily be accessible from the bloodstream. To characterize HL stroma and to identify potentially accessible proteins, we used a chemical proteomic approach, consisting in the labelling of accessible proteins and their subsequent purification and identification by mass spectrometry. We performed an analysis of potentially accessible proteins in lymph node biopsies from HL and reactive lymphoid tissues, and in total, more than 1400 proteins were identified in 7 samples. We have identified several extracellular matrix proteins overexpressed in HL, such as versican, fibulin-1, periostin, and other proteins such as S100-A8. These proteins were validated by immunohistochemistry on a larger series of biopsy samples, and bear the potential to become targets for antibody-based anti-cancer therapies. [less ▲]

Detailed reference viewed: 84 (15 ULg)
Full Text
Peer Reviewed
See detailA specific inorganic triphosphatase from Nitrosomonas europaea: structure and catalytic mechanism
Delvaux, David ULg; Murty, Mamidana R.V.S; Gabelica, Valérie ULg et al

in Journal of Biological Chemistry (2011), 286

The CYTH superfamily of proteins is named after its two founding members, the CyaB adenylyl cyclase from Aeromonas hydrophila and the human 25-kDa thiamine triphosphatase. Because these proteins often ... [more ▼]

The CYTH superfamily of proteins is named after its two founding members, the CyaB adenylyl cyclase from Aeromonas hydrophila and the human 25-kDa thiamine triphosphatase. Because these proteins often form a closed β-barrel, they are also referred to as “Triphosphate Tunnel Metalloenzymes” (TTM). Functionally, they are characterized by their ability to bind triphosphorylated substrates and divalent metal ions. These proteins exist in most organisms and catalyze different reactions, depending on their origin. Here we investigate structural and catalytic properties of the recombinant TTM protein from Nitrosomonas europaea (NeuTTM), a 19-kDa protein. Crystallographic data show that it crystallizes as a dimer and that, in contrast to other TTM proteins, it has an open β-barrel structure. We demonstrate that NeuTTM is a highly specific inorganic triphosphatase, hydrolyzing tripolyphosphate (PPPi) with high catalytic efficiency in the presence of Mg2+. These data are supported by native mass spectrometry analysis showing that the enzyme binds PPPi (and Mg-PPPi) with high affinity (Kd < 1.5 μM), while it has a low affinity for ATP or thiamine triphosphate. In contrast to Aeromonas and Yersinia CyaB proteins, NeuTTM has no adenylyl cyclase activity, but it shares several properties with other enzymes of the CYTH superfamily, e.g. heat-stability, alkaline pH optimum and inhibition by Ca2+ and Zn2+ ions. We suggest a catalytic mechanism involving a catalytic dyad formed by K52 and Y28. The present data provide the first characterization of a new type of phosphohydrolase (unrelated to pyrophosphatases or exopolyphosphatases), able to hydrolyze inorganic triphosphate with high specificity. [less ▲]

Detailed reference viewed: 74 (27 ULg)
Full Text
Peer Reviewed
See detailTridentate N-Donor Palladium(II) Complexes as Efficient Coordinating Quadruplex DNA Binders
Largy, Eric; Hamon, Florian; Rosu, Frédéric ULg et al

in Chemistry : A European Journal (2011), 17(47), 13274-13283

Fifteen complexes of palladium, platinum, and copper, featuring five different N-donor tridentate (terpyridine-like) ligands, were prepared with the aim of testing their G-quadruplexDNA binding properties ... [more ▼]

Fifteen complexes of palladium, platinum, and copper, featuring five different N-donor tridentate (terpyridine-like) ligands, were prepared with the aim of testing their G-quadruplexDNA binding properties. The fluorescence resonance energy transfer melting assay indicated a striking positive effect of palladium on G-quadruplex DNA stabilization compared with platinum and copper, as well as an influence of the structure of the organic ligand. Putative binding modes (noncoordinative p stacking and base coordination) of palladium and platinum complexes were investigated by ESI-MS and UV/Vis spectroscopy experiments, which all revealed a greater ability of palladium complexes to coordinate DNA bases. In contrast, platinum compounds tend to predominantly bind to quadruplex DNA in their aqua form by noncoordinative interactions. Remarkably, complexes of [Pd(ttpy)] and [Pd(tMebip)] (ttpy=tolylterpyridine, tMebip=2,2'-(4-p-tolylpyridine-2,6-diyl)bis(1-methyl-1H-benzo[d]imidazole)) coordinate efficiently G-quadruplex structures at room temperature in less than 1 h, and are more efficient than their platinum counterparts for inhibiting the growth of cancer cells. Altogether, these results demonstrate that both the affinity for G-quadruplex DNA and the binding mode of metal complexes can be modulated by modifying either the metal or the organic ligand. [less ▲]

Detailed reference viewed: 14 (1 ULg)
Full Text
Peer Reviewed
See detailFuran formation in baby food model system via lipid oxidation and sugar degradation
Owczarek-Fendor, Agnieszka; De Meulenaer, Bruno; Scholl, Georges ULg et al

in Communications in Agricultural and Applied Biological Sciences (2011), 76(1), 107-110

Detailed reference viewed: 30 (8 ULg)
Full Text
Peer Reviewed
See detailLevels of PCDD/Fs and PCBs in Camel Milk (Camelus Bactrianus and Camelus Dromedarius) from Kazakhstan
Konuspeyeva, G; Faye, B; De Pauw, Edwin ULg et al

in Organohalogen Compounds (2011), 73

Detailed reference viewed: 19 (0 ULg)
Full Text
Peer Reviewed
See detailION MOBILITY – MASS SPECTROMETRY AS A NEW APPROACH FOR THE SCREENING OF PESTICIDE RESIDUES IN FOOD
Goscinny, Séverine ULg; Touilloux, Romain; Joly, Laure et al

in Organohalogen Compounds (2011)

Pesticide residue analysis requires methods that can determine hundreds of compounds at low levels in complex food matrices. This challenge has given rise to multi residue methods, the only efficient ... [more ▼]

Pesticide residue analysis requires methods that can determine hundreds of compounds at low levels in complex food matrices. This challenge has given rise to multi residue methods, the only efficient analytical approach. This type of analytical method entails a “generic” extraction followed by a soft or no purification step to avoid any analytes looses. With over a 1000 active compounds with different physical chemical properties, gas and liquid chromatography are used as complementary separative techniques. In the past decade, the determination has been performed on tandem mass analyzers, a powerful tool to overcome co-eluting compounds with excellent sensitivity. Nevertheless, these instruments can guarantee these results per acquisition cycles for more or less 150 compounds. This represents a serious limitation when the number of pesticides to be sought for monitoring and MRL enforcement is growing each year. As multiple injections from the same sample are not viable for laboratories, alternative options have to be explored. We propose the investigation of ion mobility (IM) coupled with mass spectrometry as a new approach for pesticide residue analysis in food. [less ▲]

Detailed reference viewed: 59 (2 ULg)
Full Text
Peer Reviewed
See detailDioxins in Human Milk from Different Regions of France: Pilot of the French Longitudinal Study of Children (ELFE)
Vandentoren, S; Frery, N; Bidondo, ML et al

in Organohalogen Compounds (2011), 73

Detailed reference viewed: 19 (3 ULg)
Full Text
Peer Reviewed
See detail2D DIGE, label free quantification, principal component and mass spectrometry analysis for biomarkers discovery in MCF-7/BOS cells exposed to 17β-estradiol and endocrine disruptors.
Collodoro, Mike ULg; Lemaire, Pascale; Eppe, Gauthier ULg et al

in Organohalogen Compounds (2011)

Endocrine system disruption has become a subject of great interest over the last few decades, since it has become evident that natural and also synthetic substances can mimic or reduce the activity of ... [more ▼]

Endocrine system disruption has become a subject of great interest over the last few decades, since it has become evident that natural and also synthetic substances can mimic or reduce the activity of endogenous hormones. Compounds with estrogenic activity are an important family of potential endocrine disruptors that have to be monitored either in the food chain or in the environment. Estrogens are known to induce or promote hormonal dependent cancers, to reduce sperm counts and fertility in men and generate the feminization of exposed wildlife populations. The rapid screening of unwanted chemicals in the food chain is beset by difficulties. The number of toxic compounds is very large and no universal method can cope with their diversity. In this work, emergent differential proteomic techniques are used to discover a set of biomarkers for the development of a multiple estrogen contaminants screening test. [less ▲]

Detailed reference viewed: 35 (3 ULg)
Full Text
Peer Reviewed
See detailReproduction of European eel jeopardised by high levels of dioxins and dioxin-like PCBs
Geeraerts, C.; Focant, Jean-François ULg; Eppe, Gauthier ULg et al

in Science of the Total Environment (2011), 409

ioxins, furans and dioxin-like polychlorinated biphenyls (PCBs) were analysed in muscle tissue from yellow phased European eel (Anguilla anguilla) from 38 sites in Belgium. Dioxin concentrations in eel ... [more ▼]

ioxins, furans and dioxin-like polychlorinated biphenyls (PCBs) were analysed in muscle tissue from yellow phased European eel (Anguilla anguilla) from 38 sites in Belgium. Dioxin concentrations in eel vary considerably between sampling locations, indicating that yellow eel is a good indicator of local pollution levels. Measured levels of dioxin-like PCBs are much higher than those of the dioxins and furans. In the majority of the sites, eel has levels considered to be detrimental for their reproduction. Field levels of dioxin and dioxin-like PCBs are therefore suggested as an additional causal factor contributing to the decline of the European eel. 42% of the sampling sites show especially dioxin-like PCB levels exceeding the European consumption level (with a factor 3 on average). Human consumption of eel, especially in these highly contaminated sites, seems unjustified. [less ▲]

Detailed reference viewed: 32 (4 ULg)
Full Text
Peer Reviewed
See detailEffective temperature of ions in traveling wave ion mobility spectrometry
Morsa, Denis ULg; Gabelica, Valérie ULg; De Pauw, Edwin ULg

in Analytical Chemistry (2011), 83(14), 5775-5782

Traveling wave ion mobility spectrometers (TW IMS) operate at significantly higher fields than drift tube ion mobility spectrometers. Here we measured the fragmentation of the fragile p ... [more ▼]

Traveling wave ion mobility spectrometers (TW IMS) operate at significantly higher fields than drift tube ion mobility spectrometers. Here we measured the fragmentation of the fragile p-methoxybenzylpyridinium ion inside the TW ion mobility cell of the first-generation SYNAPT HDMS spectrometer. The ion’s vibrational internal energy was quantified by a vibrational effective temperature Teff,vib, which is the mean temperature of the ions inside the cell that would result in the same fragmentation yield as observed experimentally. Significant fragmentation of the probe ion inside the TW IMS cell was detected, indicating that field heating of the ions takes place in TW IMS. For typical small molecule IMS conditions, Teff,vib = 555 ± 2 K. The variations of the effective temperature were studied as a function of the IMS parameters, and we found that Teff,vib decreases when the wave height decreases, when the pressure increases, or when the wave speed increases. The energy transfer efficiency of argon is higher than for He, N2 or CO2. Teff,vib being directly related to the ion speed inside the TW IMS, our results also provide new insight on the ion movement in TW IMS. We also discuss the influence of field heating of ions for calibration and structural studies in TW IMS. [less ▲]

Detailed reference viewed: 40 (22 ULg)
Full Text
Peer Reviewed
See detaild(CGGTGGT) forms an octameric parallel G-quadruplex via stacking of unusual G(:C):G(:C):G(:C):G(:C) octads
Borbone, Nicola; Amato, Jussara; Oliviero, Giorgia et al

in Nucleic Acids Research (2011)

Among non-canonical DNA secondary structures, G-quadruplexes are currently widely studied because of their probable involvement in many pivotal biological roles, and for their potential use in ... [more ▼]

Among non-canonical DNA secondary structures, G-quadruplexes are currently widely studied because of their probable involvement in many pivotal biological roles, and for their potential use in nanotechnology. The overall quadruplex scaffold can exhibit several morphologies through intramolecular or intermolecular organization of G-rich oligodeoxyribonucleic acid strands. In particular, several G-rich strands can form higher order assemblies by multimerization between several G-quadruplex units. Here, we report on the identification of a novel dimerization pathway. Our Nuclear magnetic resonance, circular dichroism, UV, gel electrophoresis and mass spectrometry studies on the DNA sequence dCGGTGGT demonstrate that this sequence forms an octamer when annealed in presence of K+ or NH4+ ions, through the 5′-5′ stacking of two tetramolecular G-quadruplex subunits via unusual G(:C):G(:C):G(:C):G(:C) octads. [less ▲]

Detailed reference viewed: 27 (5 ULg)
Full Text
Peer Reviewed
See detailTargeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences
Amato, Jussara; Pagano, Bruno; Borbone, Nicola et al

in Bioconjugate Chemistry (2011), 22

The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of ... [more ▼]

The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K+- or NH4+-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1 P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In Kþ buffer, P1-P4 bind the ckit87up quadruplex structure as “quadruplex-binding agents”. The same holds for P1 in NH4þ solution. On the contrary, in NH4þ solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as “quadruplex openers”. [less ▲]

Detailed reference viewed: 26 (6 ULg)
Full Text
Peer Reviewed
See detailMass spectrometric sequencing of peptidic toxins : an overview
Quinton, Loïc ULg; Echterbille, Julien ULg; Pierre, Escoubas et al

in Editions de la SFET – SFET Editions (2010)

Detailed reference viewed: 93 (41 ULg)