References of "De Pauw, Edwin"
Bookmark and Share    
Full Text
Peer Reviewed
See detailLevels of PCDD/Fs and PCBs in Camel Milk (Camelus Bactrianus and Camelus Dromedarius) from Kazakhstan
Konuspeyeva, G; Faye, B; De Pauw, Edwin ULg et al

in Organohalogen Compounds (2011), 73

Detailed reference viewed: 18 (0 ULg)
Full Text
Peer Reviewed
Goscinny, Séverine ULg; Touilloux, Romain; Joly, Laure et al

in Organohalogen Compounds (2011)

Pesticide residue analysis requires methods that can determine hundreds of compounds at low levels in complex food matrices. This challenge has given rise to multi residue methods, the only efficient ... [more ▼]

Pesticide residue analysis requires methods that can determine hundreds of compounds at low levels in complex food matrices. This challenge has given rise to multi residue methods, the only efficient analytical approach. This type of analytical method entails a “generic” extraction followed by a soft or no purification step to avoid any analytes looses. With over a 1000 active compounds with different physical chemical properties, gas and liquid chromatography are used as complementary separative techniques. In the past decade, the determination has been performed on tandem mass analyzers, a powerful tool to overcome co-eluting compounds with excellent sensitivity. Nevertheless, these instruments can guarantee these results per acquisition cycles for more or less 150 compounds. This represents a serious limitation when the number of pesticides to be sought for monitoring and MRL enforcement is growing each year. As multiple injections from the same sample are not viable for laboratories, alternative options have to be explored. We propose the investigation of ion mobility (IM) coupled with mass spectrometry as a new approach for pesticide residue analysis in food. [less ▲]

Detailed reference viewed: 54 (2 ULg)
Full Text
Peer Reviewed
See detailDioxins in Human Milk from Different Regions of France: Pilot of the French Longitudinal Study of Children (ELFE)
Vandentoren, S; Frery, N; Bidondo, ML et al

in Organohalogen Compounds (2011), 73

Detailed reference viewed: 19 (3 ULg)
Full Text
Peer Reviewed
See detail2D DIGE, label free quantification, principal component and mass spectrometry analysis for biomarkers discovery in MCF-7/BOS cells exposed to 17β-estradiol and endocrine disruptors.
Collodoro, Mike ULg; Lemaire, Pascale; Eppe, Gauthier ULg et al

in Organohalogen Compounds (2011)

Endocrine system disruption has become a subject of great interest over the last few decades, since it has become evident that natural and also synthetic substances can mimic or reduce the activity of ... [more ▼]

Endocrine system disruption has become a subject of great interest over the last few decades, since it has become evident that natural and also synthetic substances can mimic or reduce the activity of endogenous hormones. Compounds with estrogenic activity are an important family of potential endocrine disruptors that have to be monitored either in the food chain or in the environment. Estrogens are known to induce or promote hormonal dependent cancers, to reduce sperm counts and fertility in men and generate the feminization of exposed wildlife populations. The rapid screening of unwanted chemicals in the food chain is beset by difficulties. The number of toxic compounds is very large and no universal method can cope with their diversity. In this work, emergent differential proteomic techniques are used to discover a set of biomarkers for the development of a multiple estrogen contaminants screening test. [less ▲]

Detailed reference viewed: 33 (3 ULg)
Full Text
Peer Reviewed
See detailReproduction of European eel jeopardised by high levels of dioxins and dioxin-like PCBs
Geeraerts, C.; Focant, Jean-François ULg; Eppe, Gauthier ULg et al

in Science of the Total Environment (2011), 409

ioxins, furans and dioxin-like polychlorinated biphenyls (PCBs) were analysed in muscle tissue from yellow phased European eel (Anguilla anguilla) from 38 sites in Belgium. Dioxin concentrations in eel ... [more ▼]

ioxins, furans and dioxin-like polychlorinated biphenyls (PCBs) were analysed in muscle tissue from yellow phased European eel (Anguilla anguilla) from 38 sites in Belgium. Dioxin concentrations in eel vary considerably between sampling locations, indicating that yellow eel is a good indicator of local pollution levels. Measured levels of dioxin-like PCBs are much higher than those of the dioxins and furans. In the majority of the sites, eel has levels considered to be detrimental for their reproduction. Field levels of dioxin and dioxin-like PCBs are therefore suggested as an additional causal factor contributing to the decline of the European eel. 42% of the sampling sites show especially dioxin-like PCB levels exceeding the European consumption level (with a factor 3 on average). Human consumption of eel, especially in these highly contaminated sites, seems unjustified. [less ▲]

Detailed reference viewed: 32 (4 ULg)
Full Text
Peer Reviewed
See detailEffective temperature of ions in traveling wave ion mobility spectrometry
Morsa, Denis ULg; Gabelica, Valérie ULg; De Pauw, Edwin ULg

in Analytical Chemistry (2011), 83(14), 5775-5782

Traveling wave ion mobility spectrometers (TW IMS) operate at significantly higher fields than drift tube ion mobility spectrometers. Here we measured the fragmentation of the fragile p ... [more ▼]

Traveling wave ion mobility spectrometers (TW IMS) operate at significantly higher fields than drift tube ion mobility spectrometers. Here we measured the fragmentation of the fragile p-methoxybenzylpyridinium ion inside the TW ion mobility cell of the first-generation SYNAPT HDMS spectrometer. The ion’s vibrational internal energy was quantified by a vibrational effective temperature Teff,vib, which is the mean temperature of the ions inside the cell that would result in the same fragmentation yield as observed experimentally. Significant fragmentation of the probe ion inside the TW IMS cell was detected, indicating that field heating of the ions takes place in TW IMS. For typical small molecule IMS conditions, Teff,vib = 555 ± 2 K. The variations of the effective temperature were studied as a function of the IMS parameters, and we found that Teff,vib decreases when the wave height decreases, when the pressure increases, or when the wave speed increases. The energy transfer efficiency of argon is higher than for He, N2 or CO2. Teff,vib being directly related to the ion speed inside the TW IMS, our results also provide new insight on the ion movement in TW IMS. We also discuss the influence of field heating of ions for calibration and structural studies in TW IMS. [less ▲]

Detailed reference viewed: 39 (21 ULg)
Full Text
Peer Reviewed
See detaild(CGGTGGT) forms an octameric parallel G-quadruplex via stacking of unusual G(:C):G(:C):G(:C):G(:C) octads
Borbone, Nicola; Amato, Jussara; Oliviero, Giorgia et al

in Nucleic Acids Research (2011)

Among non-canonical DNA secondary structures, G-quadruplexes are currently widely studied because of their probable involvement in many pivotal biological roles, and for their potential use in ... [more ▼]

Among non-canonical DNA secondary structures, G-quadruplexes are currently widely studied because of their probable involvement in many pivotal biological roles, and for their potential use in nanotechnology. The overall quadruplex scaffold can exhibit several morphologies through intramolecular or intermolecular organization of G-rich oligodeoxyribonucleic acid strands. In particular, several G-rich strands can form higher order assemblies by multimerization between several G-quadruplex units. Here, we report on the identification of a novel dimerization pathway. Our Nuclear magnetic resonance, circular dichroism, UV, gel electrophoresis and mass spectrometry studies on the DNA sequence dCGGTGGT demonstrate that this sequence forms an octamer when annealed in presence of K+ or NH4+ ions, through the 5′-5′ stacking of two tetramolecular G-quadruplex subunits via unusual G(:C):G(:C):G(:C):G(:C) octads. [less ▲]

Detailed reference viewed: 27 (5 ULg)
Full Text
Peer Reviewed
See detailTargeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences
Amato, Jussara; Pagano, Bruno; Borbone, Nicola et al

in Bioconjugate Chemistry (2011), 22

The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of ... [more ▼]

The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K+- or NH4+-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1 P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In Kþ buffer, P1-P4 bind the ckit87up quadruplex structure as “quadruplex-binding agents”. The same holds for P1 in NH4þ solution. On the contrary, in NH4þ solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as “quadruplex openers”. [less ▲]

Detailed reference viewed: 26 (6 ULg)
Full Text
Peer Reviewed
See detailMass spectrometric sequencing of peptidic toxins : an overview
Quinton, Loïc ULg; Echterbille, Julien ULg; Pierre, Escoubas et al

in Editions de la SFET – SFET Editions (2010)

Detailed reference viewed: 91 (39 ULg)
Full Text
Peer Reviewed
See detailNovel post-digest isotope coded protein labeling method for phospho- and glycoproteome analysis
Fleron, Maximilien ULg; Greffe, Yannick ULg; Musmeci, Davide ULg et al

in Journal of Proteomics (2010), 73(10), 1986-2005

In the field of proteomics there is an apparent lack of reliable methodology for quantification of posttranslational modifications. Present study offers a novel post-digest ICPL quantification strategy ... [more ▼]

In the field of proteomics there is an apparent lack of reliable methodology for quantification of posttranslational modifications. Present study offers a novel post-digest ICPL quantification strategy directed towards characterization of phosphorylated and glycosylated proteins. The value of the method is demonstrated based on the comparison of two prostate related metastatic cell lines originating from two distinct metastasis sites (PC3 and LNCaP). The method consists of protein digestion, ICPL labeling, mixing of the samples, PTM enrichment and MS-analysis. Phosphorylated peptides were isolated using TiO(2), whereas the enrichment of glycosylated peptides was performed using hydrazide based chemistry. Isolated PTM peptides were analyzed along with non enriched sample using 2D-(SCX-RP)-Nano-HPLC-MS/MS instrumentation. Taken together the novel ICPL labeling method offered a significant improvement of the number of identified (∼600 individual proteins) and quantified proteins (>95%) in comparison to the classical ICPL method. The results were validated using alternative protein quantification strategies as well as label-free MS quantification method. On the biological level, the comparison of PC3 and LNCaP cells has shown specific modulation of proteins implicated in the fundamental process related to metastasis dissemination. Finally, a preliminary study involving clinically relevant autopsy cases reiterated the potential biological value of the discovered proteins. [less ▲]

Detailed reference viewed: 51 (8 ULg)
Full Text
Peer Reviewed
See detailDioxin levels in European eels, a Belgian study
Focant, Jean-François ULg; Geeraerts, C.; Eppe, Gauthier ULg et al

in Organohalogen Compounds (2010, September)

Detailed reference viewed: 29 (2 ULg)
Full Text
Peer Reviewed
See detailPLE for extraction of dioxins in animal feed and ingredients
Focant, Jean-François ULg; Scholl, Georges ULg; De Pauw, Edwin ULg et al

in Organohalogen Compounds (2010, September), 72

Within the entire complex procedure required to measure dioxins and related compounds in biological matrices, the extraction step is often seen as a well controlled step. Although maybe true for many ... [more ▼]

Within the entire complex procedure required to measure dioxins and related compounds in biological matrices, the extraction step is often seen as a well controlled step. Although maybe true for many human and food-related matrices, the situation is very different for animal feed and feed ingredients. Specific European guidelines (e.g. Commission Directive 2006/13/EC, Commission Regulation (EC) No 152/2009) exist for animal feed but only list general requirements for the various stages of the procedure. The liberty is left to laboratories to select, for example, the tools used for the extraction steps. This has the advantage to allow ‘in-house’ methods to be used, as long as they satisfy with all the requirements of the EU Regulation. In that context, it is foreseen that the European Committee for Standardization (CEN) will soon propose a standard for the determination of PCDD/Fs and PCBs in animal feed that would be the reference method to be used to solve potential issues in case of dispute over results reported from different laboratories. A major point of concern is that it has been reported earlier1 that most commonly accepted extraction procedure can conduct to significantly different results for the extraction of dioxins and related compounds in feed and feed additives such as mineral clays and various oxides. Several non-instrumental and instrumental automated approaches are available for extraction. Soxhlet extractors have long been the most used tools for non-instrumental extraction of solids. They have proven to be very efficient but some limitations encouraged the development of other approaches based on instrumental techniques. For feed extraction, pressurized liquid extraction (PLE) (also branded as accelerated solvent extraction ASE®) is the technique of choice for high sample throughput. This study reports on the investigation of the use of various solvent mixtures, extraction temperatures, and instruments (parallel PLE, sequential ASE®) for the extraction of 17 PCDD/Fs and 12 dioxin-like PCBs in mineral clay, bovine feed, fish meal, and in-house quality control animal compound feed. [less ▲]

Detailed reference viewed: 60 (3 ULg)
See detailCaractérisation de la diversité des organismes symbiotiques et des activités glycosyl hydrolases dans le tube digestif de Reticulitermes santonensis (Feytaud) par une approche multidisciplinaire
Bauwens, Julien ULg; Matteotti, Christel ULg; Brognaux, Alison ULg et al

Scientific conference (2010, July 08)

Le bioéthanol cellulosique pourrait être une solution pour satisfaire le besoin croissant en énergie renouvelable. Actuellement, l’efficience de la transformation de la cellulose en sucres fermentescibles ... [more ▼]

Le bioéthanol cellulosique pourrait être une solution pour satisfaire le besoin croissant en énergie renouvelable. Actuellement, l’efficience de la transformation de la cellulose en sucres fermentescibles reste le principal facteur limitant. La recherche de nouvelles glycosyl hydrolases constitue une voie potentielle d’amélioration de la valorisation des composés ligno-cellulosiques. Trois types de glycosyl hydrolases sont généralement produites par les organismes capables d’utiliser efficacement ces composés : les endoglucanases, les exoglucanases/cellobiohydrolases, et les β-glucosidases. Dans les processus de digestion de la cellulose par les animaux, des organismes symbiotiques tels que des bactéries, des protistes et/ou des champignons sont fréquemment observés. Ces organismes contribuent en grande partie voir totalement à la production des complexes enzymatiques nécessaires. Chez les termites inférieures, comme notre modèle Reticulitermes santonensis (Feytaud), des protistes et des bactéries sont impliqués dans un système symbiotique complexe. Une étude multidisciplinaire est menée afin d’approfondir les rôles respectifs des différents groupes de symbiontes, via des approches « omiques », à savoir la protéomique (ESI-LC-MS-MS, 2D-SDS-PAGE couplée avec une analyse en spectrométrie de masse du type MALDI-TOF pour l’identification des protéines), la génomique (avec une approche métagénomique basée sur la construction d’une large banque de cDNA), la métabolomique (caractérisation des produits de dégradation de carbohydrates via une strategie LC-MS). De plus, l’isolation de microorganismes a également été employée dans la caractérisation de la diversité et de l’activité des glycosyl hydrolases chez R. santonensis. [less ▲]

Detailed reference viewed: 93 (37 ULg)