References of "De Pauw, Edwin"
     in
Bookmark and Share    
Full Text
See detailTargeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences
Amato, Jussara; Pagano, Bruno; Borbone, Nicola et al

in Bioconjugate Chemistry (2011), 22

The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of ... [more ▼]

The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K+- or NH4+-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1 P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In Kþ buffer, P1-P4 bind the ckit87up quadruplex structure as “quadruplex-binding agents”. The same holds for P1 in NH4þ solution. On the contrary, in NH4þ solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as “quadruplex openers”. [less ▲]

Detailed reference viewed: 17 (6 ULg)
Full Text
See detailNew Methodology to detect toxin-GPCR binding by MALDI-TOF Mass Spectrometry
Echterbille, Julien ULg; De Pauw, Edwin ULg; Gilles, Nicolas et al

Poster (2011)

Detailed reference viewed: 69 (24 ULg)
Full Text
See detailFuran Formation from Lipids in Starch-Based Model Systems, As Influenced by Interactions with Antioxidants and Proteins.
Owczarek-Fendor, A.; De Meulenaer, B.; Scholl, Georges ULg et al

in Journal of Agricultural and Food Chemistry (2011), 59(6), 2368-2376

The formation of furan upon sterilization of a lipid-containing starch gel was investigated in the presence of various antioxidants, namely, alpha-tocopherol, beta-carotene, and ascorbic acid, with and ... [more ▼]

The formation of furan upon sterilization of a lipid-containing starch gel was investigated in the presence of various antioxidants, namely, alpha-tocopherol, beta-carotene, and ascorbic acid, with and without proteins. Results indicated that alpha-tocopherol did not significantly influence furan formation from oxidized lipids. beta-Carotene, suggested previously to be a furan precursor itself, did influence the generation of furan in a concentration-dependent manner, although to a limited extent. Surprisingly, the presence of lipids seemed to limit the furan generation from beta-carotene. Interestingly, the addition of ascorbic acid to the emulsions containing soybean or sunflower oils considerably enhanced the formation of furan from these oils. This was also the case when fresh oils were applied, shown previously to be nearly unable to generate furan. This observation can be explained by an intensified ascorbic acid degradation stimulated by the presence of lipids. [less ▲]

Detailed reference viewed: 25 (10 ULg)
Full Text
See detailMass spectrometric sequencing of peptidic toxins : an overview
Quinton, Loïc ULg; Echterbille, Julien ULg; Pierre, Escoubas et al

in Editions de la SFET – SFET Editions (2010)

Detailed reference viewed: 86 (37 ULg)
Full Text
See detailNovel post-digest isotope coded protein labeling method for phospho- and glycoproteome analysis
Fleron, Maximilien ULg; Greffe, Yannick ULg; Musmeci, Davide ULg et al

in Journal of Proteomics (2010), 73(10), 1986-2005

In the field of proteomics there is an apparent lack of reliable methodology for quantification of posttranslational modifications. Present study offers a novel post-digest ICPL quantification strategy ... [more ▼]

In the field of proteomics there is an apparent lack of reliable methodology for quantification of posttranslational modifications. Present study offers a novel post-digest ICPL quantification strategy directed towards characterization of phosphorylated and glycosylated proteins. The value of the method is demonstrated based on the comparison of two prostate related metastatic cell lines originating from two distinct metastasis sites (PC3 and LNCaP). The method consists of protein digestion, ICPL labeling, mixing of the samples, PTM enrichment and MS-analysis. Phosphorylated peptides were isolated using TiO(2), whereas the enrichment of glycosylated peptides was performed using hydrazide based chemistry. Isolated PTM peptides were analyzed along with non enriched sample using 2D-(SCX-RP)-Nano-HPLC-MS/MS instrumentation. Taken together the novel ICPL labeling method offered a significant improvement of the number of identified (∼600 individual proteins) and quantified proteins (>95%) in comparison to the classical ICPL method. The results were validated using alternative protein quantification strategies as well as label-free MS quantification method. On the biological level, the comparison of PC3 and LNCaP cells has shown specific modulation of proteins implicated in the fundamental process related to metastasis dissemination. Finally, a preliminary study involving clinically relevant autopsy cases reiterated the potential biological value of the discovered proteins. [less ▲]

Detailed reference viewed: 39 (5 ULg)
Full Text
See detailDioxin levels in European eels, a Belgian study
Focant, Jean-François ULg; Geeraerts, C.; Eppe, Gauthier ULg et al

in Organohalogen Compounds (2010, September)

Detailed reference viewed: 22 (2 ULg)
Full Text
See detailPLE for extraction of dioxins in animal feed and ingredients
Focant, Jean-François ULg; Scholl, Georges ULg; De Pauw, Edwin ULg et al

in Organohalogen Compounds (2010, September), 72

Within the entire complex procedure required to measure dioxins and related compounds in biological matrices, the extraction step is often seen as a well controlled step. Although maybe true for many ... [more ▼]

Within the entire complex procedure required to measure dioxins and related compounds in biological matrices, the extraction step is often seen as a well controlled step. Although maybe true for many human and food-related matrices, the situation is very different for animal feed and feed ingredients. Specific European guidelines (e.g. Commission Directive 2006/13/EC, Commission Regulation (EC) No 152/2009) exist for animal feed but only list general requirements for the various stages of the procedure. The liberty is left to laboratories to select, for example, the tools used for the extraction steps. This has the advantage to allow ‘in-house’ methods to be used, as long as they satisfy with all the requirements of the EU Regulation. In that context, it is foreseen that the European Committee for Standardization (CEN) will soon propose a standard for the determination of PCDD/Fs and PCBs in animal feed that would be the reference method to be used to solve potential issues in case of dispute over results reported from different laboratories. A major point of concern is that it has been reported earlier1 that most commonly accepted extraction procedure can conduct to significantly different results for the extraction of dioxins and related compounds in feed and feed additives such as mineral clays and various oxides. Several non-instrumental and instrumental automated approaches are available for extraction. Soxhlet extractors have long been the most used tools for non-instrumental extraction of solids. They have proven to be very efficient but some limitations encouraged the development of other approaches based on instrumental techniques. For feed extraction, pressurized liquid extraction (PLE) (also branded as accelerated solvent extraction ASE®) is the technique of choice for high sample throughput. This study reports on the investigation of the use of various solvent mixtures, extraction temperatures, and instruments (parallel PLE, sequential ASE®) for the extraction of 17 PCDD/Fs and 12 dioxin-like PCBs in mineral clay, bovine feed, fish meal, and in-house quality control animal compound feed. [less ▲]

Detailed reference viewed: 33 (1 ULg)
See detailCaractérisation de la diversité des organismes symbiotiques et des activités glycosyl hydrolases dans le tube digestif de Reticulitermes santonensis (Feytaud) par une approche multidisciplinaire
Bauwens, Julien ULg; Matteotti, Christel ULg; Brognaux, Alison ULg et al

Scientific conference (2010, July 08)

Le bioéthanol cellulosique pourrait être une solution pour satisfaire le besoin croissant en énergie renouvelable. Actuellement, l’efficience de la transformation de la cellulose en sucres fermentescibles ... [more ▼]

Le bioéthanol cellulosique pourrait être une solution pour satisfaire le besoin croissant en énergie renouvelable. Actuellement, l’efficience de la transformation de la cellulose en sucres fermentescibles reste le principal facteur limitant. La recherche de nouvelles glycosyl hydrolases constitue une voie potentielle d’amélioration de la valorisation des composés ligno-cellulosiques. Trois types de glycosyl hydrolases sont généralement produites par les organismes capables d’utiliser efficacement ces composés : les endoglucanases, les exoglucanases/cellobiohydrolases, et les β-glucosidases. Dans les processus de digestion de la cellulose par les animaux, des organismes symbiotiques tels que des bactéries, des protistes et/ou des champignons sont fréquemment observés. Ces organismes contribuent en grande partie voir totalement à la production des complexes enzymatiques nécessaires. Chez les termites inférieures, comme notre modèle Reticulitermes santonensis (Feytaud), des protistes et des bactéries sont impliqués dans un système symbiotique complexe. Une étude multidisciplinaire est menée afin d’approfondir les rôles respectifs des différents groupes de symbiontes, via des approches « omiques », à savoir la protéomique (ESI-LC-MS-MS, 2D-SDS-PAGE couplée avec une analyse en spectrométrie de masse du type MALDI-TOF pour l’identification des protéines), la génomique (avec une approche métagénomique basée sur la construction d’une large banque de cDNA), la métabolomique (caractérisation des produits de dégradation de carbohydrates via une strategie LC-MS). De plus, l’isolation de microorganismes a également été employée dans la caractérisation de la diversité et de l’activité des glycosyl hydrolases chez R. santonensis. [less ▲]

Detailed reference viewed: 75 (34 ULg)
Full Text
See detailInfluence of the matrix on the In Source Decay of permethylated glycans during MALDI-TOF analysis
Smargiasso, Nicolas ULg; De Pauw, Edwin ULg

Poster (2010, June)

Introduction In source decay (ISD) is a common phenomenon occurring very rapidly during ionization process in the source of MALDI-MS instruments and resulting in the presence of well resolved peaks of ... [more ▼]

Introduction In source decay (ISD) is a common phenomenon occurring very rapidly during ionization process in the source of MALDI-MS instruments and resulting in the presence of well resolved peaks of fragments in mass spectrum. While they make interpretation of spectra more complex, these fragments were shown to be useful to sequence peptides and proteins. Concerning glycans, only a few reports were published, using different matrices on various samples and therefore making it difficult to compare. In this context, the goal of this work is to perform a systematic study allowing to define optimal conditions to induce ISD of glycans or, inversely, to minimize this phenomenon in the study of more complex mixtures. Methods Glycans were purchased from Sigma-Aldrich. Iodomethane was used in DMSO/NaOH to permethylate the glycans. This reaction was stopped by water and permethylated glycans were extracted by chloroform. Spectra were recorded on a Bruker Ultraflex II in positive ion mode. 2,5-dihydroxybenzoic acid (DHB) and 6-aza-2-thiothymine (ATT) were prepared at 20 mg/ml in 50 % acetonitrile, 0.1 % formic acid solution. 9-aminoacridine (9-AA) was dissolved at saturation in a 50 % acetonitrile, 0.1 % formic acid and further diluted 4 times in the same solution. α-Cyano-4-hydroxycinnamic (HCCA) acid was prepared at 20 mg/ml in 97 % acetone, 0,1 % formic acid. In some spots, LiI was added to obtain Li+ adducts instead of Na+ adducts. Preliminary data In source fragmentation of permethylated Lacto-N-difucoHexaose I and LS tetrasaccharide B was first studied in DHB. While the MS/MS of the Na+ adducts of these compounds (performed by LID) produces intenses B and Y fragments, those resulting from in source fragmentation are mainly oxonium ions, resulting from the cleavage of a glycosylic bond without any exchange of hydrogen atoms. These oxonium fragments were also obtained for lithium adducts. It was previously described that these fragments are produced by the cleavage of a protonated glycosidic bond. These ions carry their positive charge on a trivalent oxygen atom and are therefore not present on the spectra as sodium adducts. Since the peaks of protonated glycans are very low in MALDI spectra, it would indicate that protonation of glycosidic bonds of permethylated glycans would strongly favor a fragmentation reaction. Different matrices were tested to compare their ability to induce in source fragmentation of permethylated glycans. Interestingly, ATT gave similar results comparing to DHB while HCCA showed a lesser ability to promote in source fragmentation. However, the most striking result came from the use of 9-AA. This matrix, which is usually used in negative ion mode, was able to produce easily sodium adducts ions of permethylated glycan with a satisfying signal to noise ratio in positive ion mode. Moreover, practically no in source fragmentation was observed with this matrix. The few produced fragments were B ions but no oxonium ions were detected. Presence of these B fragments was increased for Li+ adducts. As 9-AA is the most basic of tested matrices, the absence of oxonium ions could result from its inability to transfer protons to the glycosidic bond of permethylated glycans. 9-AA could therefore become a matrix of choice to study complex mixtures of glycans, by reducing artefact peaks produced by ISD. Novel aspect ISD of permethylated glycans is induced by DHB while 9-AA strongly favors the presence of molecular ions. [less ▲]

Detailed reference viewed: 42 (3 ULg)
Full Text
See detailMALDI-In Source Decay Applied to Mass Spectrometry Imaging: A New Tool for Protein Identification.
Debois, Delphine ULg; Bertrand, Virginie ULg; Quinton, Loïc ULg et al

in Analytical Chemistry (2010), 82(10), 3969-4304

Matrix-assisted laser desorption ionization-mass spectrometry (MALDI-MS) imaging is a powerful technique giving access to the distribution of a large range of biomolecules directly from a tissue section ... [more ▼]

Matrix-assisted laser desorption ionization-mass spectrometry (MALDI-MS) imaging is a powerful technique giving access to the distribution of a large range of biomolecules directly from a tissue section, allowing, for example, the discovery of new pathological biomarkers. Nevertheless, one main difficulty lies in the identification of the detected species, especially proteins. MALDI-in source decay (ISD) is used to fragment ions directly in the mass spectrometer ion source. This technique does not require any special sample treatment but only the use of a specific MALDI matrix such as 2,5-dihydroxybenzoic acid or 1,5-diaminonaphthalene. MALDI-ISD is generally employed on classical, purified samples, but here we demonstrate that ISD can also be performed directly on mixtures and on a tissue slice leading to fragment ions, allowing the identification of major proteins without any further treatment. On a porcine eye lens slice, de novo sequencing was even performed. Crystallins not yet referenced in databases were identified by sequence homology with other mammalian species. On a mouse brain slice, we demonstrate that results obtained with ISD are comparable and even better than those obtained with a classical in situ digestion. [less ▲]

Detailed reference viewed: 133 (35 ULg)
See detailIntegrated “omics” approaches to investigate the chemical aspects of symbiosis in termites and potential application in ligno-cellulosic use.
Bauwens, Julien ULg; Matteotti, Christel ULg; Brognaux, Alison ULg et al

Scientific conference (2010, May 05)

Cellulosic bioethanol could be one of the solutions to satisfy the increasing demand in renewable energy. The most limitative problem is the efficiency of cellulose transformation into fermentable sugars ... [more ▼]

Cellulosic bioethanol could be one of the solutions to satisfy the increasing demand in renewable energy. The most limitative problem is the efficiency of cellulose transformation into fermentable sugars. Investigations to select new glycosyl hydrolases are an interesting approach that constitutes a potential opportunity to improve the valorization of lignocellulosic materials. Three major types of glycosyl hydolases are generally produced by organism’s that are able to efficiently use cellulosic compounds: the endoglucanases, the exoglucanases/cellobiohydrolases and the β-glucosidases. In the ability to transform lignocellulosic materials by animals, symbioses are generally observed with a range of micro-organisms including bacteria, protists and/or fungi that largely (or completely) contribute to the production of the needed enzymatic complexes. In termites, such active enzymes are produced in the insect digestive tract, by the termite insect itself or by symbiotic organisms. Within lower termites gut, such as in our model Reticulitermes santonensis (Feytaud), protists and bacteria are associated and involved in a complex symbiotic system. To investigate the respective role of the insect and different groups of symbionts, multidisciplinary “omics” approaches were here developed including proteomics (ESI-LC-MS-MS, 2D-Dige gel coupled with MALDI-TOF mass spectrometry for protein identification), genomics (with a metagenomic approach based on large cDNA bank construction), metabolomics (LC-MS stragety for carbohydrate degradation product characterization). Moreover, microorganism isolation was used to investigate and characterize glycosyl hydrolases diversity and activity in R. santonensis. The integration of this broad range of “omics” techniques allowed characterizing the role of symbionts in insects in a fundamental approach and to invtigate the chemical ecology of xylophagous insects but also corresponding to an efficient way to promote the selection of efficient enzymatic activities to potentially produce biofuels based on the use of existing lignocellulosic materials. [less ▲]

Detailed reference viewed: 84 (26 ULg)
Full Text
See detailNovel Relative ICPL Based Quantitative Phospho- and Glycoproteome Analysis Method
Fleron, Maximilien ULg; Greffe, Yannick ULg; Massart, Anne-Cécile ULg et al

Poster (2010, April 16)

Large scale proteomic analysis remains challenging partially because proteins are inhomogeneous and often influenced by a variety of structural modifications. In particular, these specific chemical ... [more ▼]

Large scale proteomic analysis remains challenging partially because proteins are inhomogeneous and often influenced by a variety of structural modifications. In particular, these specific chemical modifications called posttranslational modifications (PTM) are crucial determinants for the protein function and biological role. Up to now there have been a growing number of studies describing the enrichment and identification of PTM. However, a significant dearth of data offering a reliable methodology for PTM quantification does exist. The present work aims at developing a label based protein PTM quantification strategy and demonstrating its value on comparative analysis of cells originating from two distinct prostate metastasis sites. PC3 and LNCaP cells isolated from bone and lymph node prostate cancer metastasis sites respectively, were lysed and spiked with three non-human proteins serving as internal standards. Following this, the samples were reduced and alkylated, digested with trypsin and subjected to peptide ICPL (isotope coded protein label) labeling. The two peptide containing samples were joined together followed by the affinity isolation of phospho- (using TiO2 metal affinity chromatography) and glycopeptides (oxidized glycans were bound on hydrazide resin). The enriched fraction as well as the flow-through were analyzed on a 2D-(SCX and C18-RP)-nano-HPLC system. The peptide identification and quantification was conducted using electrospray ion-trap mass spectrometer (Bruker, HCT-ultra). Validation of the differentially modulated proteins was conducted in several biological and technical replicates using the label free MSe based quantification strategy. This PTM based, novel relative protein quantification using post-digest ICPL has detected over 598 individual proteins. Of these more than 95 % have been successfully quantified. PTM enrichment methodologies allowed an isolation rate of 91 % and 50 % for phosphorylated and glycosylated proteins respectively. The detailed comparison of PC3 and LNCaP cells has shown specific overexpression of selected proteins indicating differences between these two prostate metastatic cell lines. Several of these modulated proteins have been previously described to be related to prostate cancer (e.g. annexin A2 and vimentin) while others could be considered as potentially novel. These proteins might be implicated in the fundamental process related to metastasis dissemination. However, because of the known discrepancy between cell systems and clinical material, the present study can be regarded only as a step towards elucidation of these complex interactions. [less ▲]

Detailed reference viewed: 19 (2 ULg)
Full Text
See detailMALDI-TOF/TOF sequencing of peptide toxins from animal venoms
Quinton, Loïc ULg; Echterbille, Julien ULg; Gilles, Nicolas et al

Poster (2010, April 16)

Detailed reference viewed: 24 (7 ULg)